ID: 997468196

View in Genome Browser
Species Human (GRCh38)
Location 5:134102146-134102168
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468196_997468209 9 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468209 5:134102178-134102200 TGAGCAGCCCCCGCCGCTCTGGG No data
997468196_997468220 30 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468220 5:134102199-134102221 GGGGGACTCTGGGCCTCGCCTGG No data
997468196_997468210 10 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468196_997468212 12 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468196_997468208 8 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468208 5:134102177-134102199 GTGAGCAGCCCCCGCCGCTCTGG No data
997468196_997468217 19 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468217 5:134102188-134102210 CCGCCGCTCTGGGGGGACTCTGG No data
997468196_997468211 11 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468196_997468218 20 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468218 5:134102189-134102211 CGCCGCTCTGGGGGGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468196 Original CRISPR CCTGGTGGCTGGATTTGGAA GGG (reversed) Intergenic