ID: 997468198

View in Genome Browser
Species Human (GRCh38)
Location 5:134102147-134102169
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468198_997468218 19 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468218 5:134102189-134102211 CGCCGCTCTGGGGGGACTCTGGG No data
997468198_997468208 7 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468208 5:134102177-134102199 GTGAGCAGCCCCCGCCGCTCTGG No data
997468198_997468209 8 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468209 5:134102178-134102200 TGAGCAGCCCCCGCCGCTCTGGG No data
997468198_997468211 10 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468198_997468212 11 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468198_997468217 18 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468217 5:134102188-134102210 CCGCCGCTCTGGGGGGACTCTGG No data
997468198_997468220 29 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468220 5:134102199-134102221 GGGGGACTCTGGGCCTCGCCTGG No data
997468198_997468221 30 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468221 5:134102200-134102222 GGGGACTCTGGGCCTCGCCTGGG No data
997468198_997468210 9 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468198 Original CRISPR CCCTGGTGGCTGGATTTGGA AGG (reversed) Intergenic