ID: 997468206

View in Genome Browser
Species Human (GRCh38)
Location 5:134102161-134102183
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468206_997468211 -4 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468206_997468212 -3 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468206_997468226 29 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468226 5:134102213-134102235 CTCGCCTGGGCTGAGAGGGGAGG No data
997468206_997468210 -5 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468206_997468208 -7 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468208 5:134102177-134102199 GTGAGCAGCCCCCGCCGCTCTGG No data
997468206_997468221 16 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468221 5:134102200-134102222 GGGGACTCTGGGCCTCGCCTGGG No data
997468206_997468220 15 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468220 5:134102199-134102221 GGGGGACTCTGGGCCTCGCCTGG No data
997468206_997468223 25 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468223 5:134102209-134102231 GGGCCTCGCCTGGGCTGAGAGGG No data
997468206_997468209 -6 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468209 5:134102178-134102200 TGAGCAGCCCCCGCCGCTCTGGG No data
997468206_997468217 4 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468217 5:134102188-134102210 CCGCCGCTCTGGGGGGACTCTGG No data
997468206_997468224 26 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468224 5:134102210-134102232 GGCCTCGCCTGGGCTGAGAGGGG No data
997468206_997468222 24 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468222 5:134102208-134102230 TGGGCCTCGCCTGGGCTGAGAGG No data
997468206_997468218 5 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468218 5:134102189-134102211 CGCCGCTCTGGGGGGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468206 Original CRISPR TGCTCACAGACCCCCCCTGG TGG (reversed) Intergenic