ID: 997468207

View in Genome Browser
Species Human (GRCh38)
Location 5:134102164-134102186
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468207_997468210 -8 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468207_997468221 13 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468221 5:134102200-134102222 GGGGACTCTGGGCCTCGCCTGGG No data
997468207_997468224 23 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468224 5:134102210-134102232 GGCCTCGCCTGGGCTGAGAGGGG No data
997468207_997468217 1 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468217 5:134102188-134102210 CCGCCGCTCTGGGGGGACTCTGG No data
997468207_997468218 2 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468218 5:134102189-134102211 CGCCGCTCTGGGGGGACTCTGGG No data
997468207_997468208 -10 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468208 5:134102177-134102199 GTGAGCAGCCCCCGCCGCTCTGG No data
997468207_997468227 29 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468227 5:134102216-134102238 GCCTGGGCTGAGAGGGGAGGAGG No data
997468207_997468212 -6 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468207_997468209 -9 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468209 5:134102178-134102200 TGAGCAGCCCCCGCCGCTCTGGG No data
997468207_997468222 21 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468222 5:134102208-134102230 TGGGCCTCGCCTGGGCTGAGAGG No data
997468207_997468223 22 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468223 5:134102209-134102231 GGGCCTCGCCTGGGCTGAGAGGG No data
997468207_997468220 12 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468220 5:134102199-134102221 GGGGGACTCTGGGCCTCGCCTGG No data
997468207_997468211 -7 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468207_997468226 26 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468226 5:134102213-134102235 CTCGCCTGGGCTGAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468207 Original CRISPR GGCTGCTCACAGACCCCCCC TGG (reversed) Intergenic