ID: 997468210

View in Genome Browser
Species Human (GRCh38)
Location 5:134102179-134102201
Sequence GAGCAGCCCCCGCCGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468198_997468210 9 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468207_997468210 -8 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468206_997468210 -5 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468203_997468210 5 Left 997468203 5:134102151-134102173 CCAAATCCAGCCACCAGGGGGGG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468205_997468210 -1 Left 997468205 5:134102157-134102179 CCAGCCACCAGGGGGGGTCTGTG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468196_997468210 10 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468195_997468210 11 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468210 Original CRISPR GAGCAGCCCCCGCCGCTCTG GGG Intergenic