ID: 997468211

View in Genome Browser
Species Human (GRCh38)
Location 5:134102180-134102202
Sequence AGCAGCCCCCGCCGCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468203_997468211 6 Left 997468203 5:134102151-134102173 CCAAATCCAGCCACCAGGGGGGG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468198_997468211 10 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468196_997468211 11 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468206_997468211 -4 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468207_997468211 -7 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468195_997468211 12 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468205_997468211 0 Left 997468205 5:134102157-134102179 CCAGCCACCAGGGGGGGTCTGTG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468211 Original CRISPR AGCAGCCCCCGCCGCTCTGG GGG Intergenic