ID: 997468212

View in Genome Browser
Species Human (GRCh38)
Location 5:134102181-134102203
Sequence GCAGCCCCCGCCGCTCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468205_997468212 1 Left 997468205 5:134102157-134102179 CCAGCCACCAGGGGGGGTCTGTG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468195_997468212 13 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468203_997468212 7 Left 997468203 5:134102151-134102173 CCAAATCCAGCCACCAGGGGGGG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468207_997468212 -6 Left 997468207 5:134102164-134102186 CCAGGGGGGGTCTGTGAGCAGCC No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468198_997468212 11 Left 997468198 5:134102147-134102169 CCTTCCAAATCCAGCCACCAGGG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468196_997468212 12 Left 997468196 5:134102146-134102168 CCCTTCCAAATCCAGCCACCAGG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468206_997468212 -3 Left 997468206 5:134102161-134102183 CCACCAGGGGGGGTCTGTGAGCA No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468212 Original CRISPR GCAGCCCCCGCCGCTCTGGG GGG Intergenic