ID: 997469452

View in Genome Browser
Species Human (GRCh38)
Location 5:134108776-134108798
Sequence GGATGGCCAAACTCTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997469449_997469452 -2 Left 997469449 5:134108755-134108777 CCATTCTAGGCAAGGTTCAATGG No data
Right 997469452 5:134108776-134108798 GGATGGCCAAACTCTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997469452 Original CRISPR GGATGGCCAAACTCTCCCCC AGG Intergenic
No off target data available for this crispr