ID: 997470637

View in Genome Browser
Species Human (GRCh38)
Location 5:134115154-134115176
Sequence AGGTGAGCCCCCGCCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997470633_997470637 -8 Left 997470633 5:134115139-134115161 CCCGCGGCGAGGCCGAGGTGAGC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470626_997470637 12 Left 997470626 5:134115119-134115141 CCCGGGGGCCGGCGCCGGGGCCC 0: 1
1: 0
2: 13
3: 67
4: 556
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470631_997470637 -2 Left 997470631 5:134115133-134115155 CCGGGGCCCGCGGCGAGGCCGAG 0: 1
1: 1
2: 3
3: 31
4: 241
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470627_997470637 11 Left 997470627 5:134115120-134115142 CCGGGGGCCGGCGCCGGGGCCCG 0: 1
1: 1
2: 13
3: 89
4: 621
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470622_997470637 20 Left 997470622 5:134115111-134115133 CCGGGGGTCCCGGGGGCCGGCGC 0: 1
1: 0
2: 1
3: 57
4: 413
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470629_997470637 4 Left 997470629 5:134115127-134115149 CCGGCGCCGGGGCCCGCGGCGAG 0: 1
1: 0
2: 1
3: 31
4: 295
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470621_997470637 21 Left 997470621 5:134115110-134115132 CCCGGGGGTCCCGGGGGCCGGCG 0: 1
1: 0
2: 5
3: 32
4: 427
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
997470634_997470637 -9 Left 997470634 5:134115140-134115162 CCGCGGCGAGGCCGAGGTGAGCC 0: 1
1: 0
2: 3
3: 17
4: 118
Right 997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997470637 Original CRISPR AGGTGAGCCCCCGCCGGCGC CGG Exonic
900136271 1:1118397-1118419 AGCAGAGCCCCTGCCGGCGTGGG + Intergenic
900762655 1:4483352-4483374 AGGTGAGCCCCAGCCAGTGTGGG - Intergenic
903155593 1:21440385-21440407 AGGTGTGCGCCCGCCGGTCCCGG - Intronic
912756098 1:112325901-112325923 AGGTGAGCCCCAGCAGGAGTAGG + Intergenic
914824896 1:151133191-151133213 GGGCGTGCCCCCGCCGGAGCTGG - Exonic
921155170 1:212433246-212433268 AGGAGGCCCCCCGCCGGCCCAGG - Intronic
924561146 1:245156788-245156810 GCGAGAGCCCCCGGCGGCGCTGG + Intronic
1064011996 10:11742745-11742767 AGGTCAGCCCCGGGCCGCGCGGG + Exonic
1064998053 10:21313792-21313814 AGGTGAGCCCCCAGCTGTGCTGG + Intergenic
1067084045 10:43228921-43228943 AGCTGAGCCCCGGCCAGCCCTGG - Intronic
1067091303 10:43266912-43266934 GCATGAGCCGCCGCCGGCGCCGG - Intronic
1067559960 10:47298408-47298430 AGGTTACCCCCAGCCGGTGCAGG + Intergenic
1067937598 10:50624587-50624609 AGGTGGGCCCCAGGCGGGGCGGG - Intronic
1070642621 10:78180531-78180553 AGGTCAGCCCCGGCCAGAGCAGG + Intergenic
1076864585 10:133160568-133160590 AGGTGAGCCCCCGGCCCCACTGG + Exonic
1077412894 11:2411614-2411636 TGGTGAGCCCCCGGGGGCCCTGG - Exonic
1077532356 11:3103218-3103240 AGGTGAGCCCCTGCCAGCCAGGG - Exonic
1077635814 11:3840873-3840895 AGGTGAGGCCCGGCCGGGGCTGG - Exonic
1080385806 11:31810548-31810570 AGCTCAGCCCGCGCTGGCGCTGG + Intronic
1084028456 11:66467065-66467087 AGGCGGGCCCCGGCGGGCGCGGG + Intronic
1084642938 11:70436658-70436680 AGGAGAGCCTCCGCCAGCCCAGG - Intergenic
1089527671 11:119107699-119107721 GGGTGAGCCCCAGCCGGGACCGG + Exonic
1089567853 11:119381526-119381548 GGGTGAGTCCCGGCTGGCGCTGG + Exonic
1089610321 11:119665148-119665170 AGGTGTGCCGGCGCCGACGCAGG + Exonic
1096772509 12:53945021-53945043 AGGTGAGCAGCTACCGGCGCGGG + Exonic
1097007831 12:55931792-55931814 AGCAGAGCTGCCGCCGGCGCGGG + Intronic
1097029186 12:56079547-56079569 GGGAGAGGCCCGGCCGGCGCCGG + Intergenic
1100977983 12:100142404-100142426 AGGCCAGCCCCCGGCGCCGCCGG + Intronic
1101504238 12:105331191-105331213 AGGTGAGCCCCGGCGGCTGCAGG - Intronic
1103562537 12:121800122-121800144 AGATGAGCCGCCGCCCGGGCCGG - Intronic
1104623665 12:130337019-130337041 AGGTGATCCCCCGCAGGTGAAGG + Intergenic
1104891106 12:132140599-132140621 AGGTGAGGCCCCGGCTGGGCGGG - Exonic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113601613 13:111573367-111573389 AGATGAGCCCCAGCCGGGGAGGG + Intergenic
1113886982 13:113666199-113666221 AGGTGTGCCCCCGCTGTCCCAGG + Intergenic
1114612523 14:24052104-24052126 AGAGGAGCCGCCGCCGCCGCCGG - Exonic
1118339264 14:64880409-64880431 AGGTGAACCCCCGCCGTGGCGGG + Intergenic
1128374623 15:67066107-67066129 AGGAGCGCCCCCGGCGGGGCTGG - Exonic
1129672444 15:77614742-77614764 AGTTGAGCCGCCAGCGGCGCCGG + Exonic
1131838888 15:96416193-96416215 TTCTGAGCCCACGCCGGCGCGGG - Intergenic
1132606749 16:796860-796882 AGGTGAGCCCACCCAGGCTCTGG + Exonic
1133325041 16:4937115-4937137 AGGTGAGCGAGCGGCGGCGCGGG + Exonic
1134402189 16:13920371-13920393 AGGTGCGGCCGCGCTGGCGCGGG + Exonic
1134656075 16:15949509-15949531 AGGTGAGCGGGCGCCGGGGCGGG + Intergenic
1135486704 16:22871886-22871908 AGGTGAGCCCACCCTGGCCCTGG - Intronic
1136372078 16:29842791-29842813 AGGTGAGCCCACGCCTTCCCTGG - Intronic
1141667712 16:85474465-85474487 ATGTGACTCCCCGCCGGGGCTGG - Intergenic
1141674491 16:85510468-85510490 AGGTGTGCCCCCGCCAAGGCGGG - Intergenic
1142030520 16:87836189-87836211 TGGTGAGCCCCGGCAGGGGCGGG - Intronic
1142292570 16:89199751-89199773 AGGTGAGCCACCTCCTGGGCTGG - Exonic
1142764170 17:2056448-2056470 AGGTGAGCGGCCGCCGGTGGAGG - Intronic
1146581160 17:34040016-34040038 CGGGCAGCCACCGCCGGCGCCGG + Intronic
1146630037 17:34463207-34463229 AGGTGACCCCCAGCTGGTGCTGG + Intergenic
1146903367 17:36602175-36602197 AGGTGAGCCCGCTGCGGCCCCGG + Exonic
1147720248 17:42535597-42535619 ATGTGAGCCCAGGCCGGCGGTGG - Intergenic
1148128375 17:45248160-45248182 AGGTGCGTCCCCGACGGGGCGGG - Intergenic
1150108224 17:62478013-62478035 AGCCGAGCCCCCGCCCCCGCGGG - Intronic
1150108413 17:62478598-62478620 AGGGGACCCCGCGCCGGCGGAGG - Intronic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1151906491 17:77052737-77052759 GGGTGAGCCCCGGCAGGTGCAGG + Intergenic
1152817451 17:82416460-82416482 AGGTGAGCCCCCTACAGCTCAGG + Intronic
1152900446 17:82938002-82938024 AGGTGAGCCCCACCCCGCGCAGG - Intronic
1152930106 17:83104988-83105010 AGGTGAGCCCCCGCCTGGACCGG - Intergenic
1153995975 18:10441703-10441725 AGGTGAGCTCCTCCCGGTGCTGG - Intergenic
1155910381 18:31498317-31498339 AGGGGAGCCACCGCCGGGGAGGG + Intronic
1158729890 18:60011110-60011132 GGGTGACGCCCCGGCGGCGCGGG + Intergenic
1160025509 18:75212028-75212050 AGGGGAGGCCCAGCCTGCGCTGG + Intronic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160727656 19:624698-624720 AGGTGAGCCCACGTGGGCCCCGG - Exonic
1160932962 19:1579256-1579278 AGGTGACCCCCGGCCTGCGAGGG - Intronic
1161572873 19:5040040-5040062 AGGTGTGCCCCCGGGGGCGGGGG - Intronic
1161663702 19:5562315-5562337 AGGTGAGCCCTGGCAGGGGCAGG - Intergenic
1161724596 19:5921180-5921202 AGGTGAGCTGCCGACGGCGGGGG - Exonic
1161733784 19:5978111-5978133 AGGCGAGCCTGGGCCGGCGCGGG - Exonic
1162951291 19:14073356-14073378 AGGAGAGCCTGCGCCGGAGCCGG + Exonic
1163687381 19:18719434-18719456 AGGTGGGCCCCGGCAGGCCCAGG + Intronic
1164492473 19:28727559-28727581 AGGTGAGCGCCCGCCGGGCCGGG - Intergenic
1166979305 19:46623437-46623459 CGGTGAGTCCCCTCCGGAGCTGG - Exonic
932779185 2:74549348-74549370 AGGTGAGGGGCCGCGGGCGCCGG - Exonic
935196567 2:100820000-100820022 AGGAGAGACCCCGCAGGCGGAGG + Intergenic
942890549 2:180981206-180981228 AGGCGAGCCACGGCCGGCGGCGG - Intronic
949041299 2:241851121-241851143 AGCTGAGCCCCTGCGGGCGGGGG + Exonic
1169164061 20:3407521-3407543 GGGGCAGCCCCTGCCGGCGCGGG + Exonic
1169978114 20:11353353-11353375 AGGTGATCCTCCCCCGGAGCTGG - Intergenic
1170629942 20:18057514-18057536 AGGTGAGCGCGCGCGGGGGCCGG - Exonic
1174569717 20:51492830-51492852 AAGTGAGCGCCGGCCGGGGCTGG + Intronic
1175199282 20:57266703-57266725 AGGTGGGAGGCCGCCGGCGCGGG - Intergenic
1180099650 21:45578594-45578616 AGGTGAGCCCCAGGCTGCCCAGG - Intergenic
1180699718 22:17774559-17774581 CGGGGAGCCCGCGCCGGCGCGGG + Intronic
1183607074 22:38872101-38872123 AGGTGAGCCGCCGCCCGGGGCGG - Exonic
1183675915 22:39298751-39298773 AGGTGAGTCCCTGCCAGGGCAGG + Intergenic
1184226034 22:43129300-43129322 AAGTGAGGCCCCGGCGGCTCAGG + Exonic
950407330 3:12812977-12812999 AGGTGAGCCCCTGCAGGGCCAGG - Exonic
961222735 3:125212797-125212819 AGGGGTGCCCCCGCCGGGACGGG - Intronic
961368655 3:126416507-126416529 AGGTGCGTCCCCTCCGGCGCGGG + Exonic
961670098 3:128522852-128522874 AGGTGGGCTCCCTCCGGAGCAGG + Intergenic
961825618 3:129597637-129597659 GGGAGGGCCCCCGCTGGCGCTGG + Intronic
965590774 3:170358135-170358157 CCGTCAGCCCCCGGCGGCGCAGG + Intronic
969245022 4:5926279-5926301 AGGTCAGCCTCCGCCGTAGCAGG - Intronic
972245660 4:37243941-37243963 AGGTGCGCACCCGGCCGCGCGGG + Intergenic
977400394 4:96524239-96524261 TGGAGGACCCCCGCCGGCGCTGG + Intergenic
980053896 4:128061879-128061901 GGGAGAGCCGTCGCCGGCGCTGG + Intronic
981504322 4:145482495-145482517 AGGGGTCGCCCCGCCGGCGCGGG - Intronic
985068385 4:186144814-186144836 AGGGGAGGCGGCGCCGGCGCGGG + Intronic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG + Exonic
1001342801 5:170862508-170862530 AGTTGAGCCCCAGCCGGAGCGGG + Intronic
1002320361 5:178371778-178371800 AGCTGAGCCCCCACCGCCCCAGG + Intronic
1003963295 6:11229361-11229383 CGCTGAGCCCCCGCCCGGGCTGG + Intronic
1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG + Exonic
1007686613 6:43670841-43670863 AGGTGAGGCCCGGCCAGAGCAGG - Exonic
1015376084 6:132512646-132512668 AGCTGGGCCCCAGCCGGCTCTGG + Intronic
1016657942 6:146543363-146543385 CGCTGAGCCCCCCCCGGGGCCGG - Intergenic
1018876636 6:167827236-167827258 AGGTGAGCACCGCCGGGCGCGGG + Exonic
1019143453 6:169962293-169962315 AGGCGCCCCGCCGCCGGCGCAGG - Intergenic
1019395694 7:816672-816694 AGGTGAGCTCCCGGCGGGCCGGG + Intronic
1019526728 7:1483721-1483743 AGGTGAGCCGCCACAGGCCCCGG - Exonic
1019538295 7:1540018-1540040 TGGTGAGACCCCGCAGGTGCTGG - Exonic
1019635901 7:2075387-2075409 AGGGGAGAGCCCGCCGTCGCTGG - Intronic
1029075060 7:97928417-97928439 AGAGGAGCCCGCGCCGGCCCCGG - Intergenic
1032037272 7:128530547-128530569 AGCCGAGCCCCCGCCCCCGCCGG - Intergenic
1033033337 7:137847196-137847218 AGGTGGGCGCCCGCCGGTCCTGG - Intergenic
1034342614 7:150368317-150368339 AGGTGCGCCACCGCCGTCCCGGG + Intronic
1036557955 8:9876498-9876520 AGGTGAGCCCCAGCCTGGGATGG - Intergenic
1048610310 8:136015089-136015111 AGGTGAGCCACAGCCAGTGCTGG + Intergenic
1052995409 9:34549434-34549456 AGGTGACCACCCGCAGGCCCAGG + Intergenic
1053435219 9:38069412-38069434 AGGTGCGCCCACCCCGGCCCCGG - Intergenic
1053510989 9:38687676-38687698 AGGTGAGCCCGGGCCGCCGCAGG + Intergenic
1061874817 9:133538423-133538445 AGGTGAGGCCCGGCCCGGGCAGG + Exonic
1061990361 9:134155372-134155394 AGGTGAGCCCCCGCAGGCTTGGG + Exonic
1062624855 9:137438139-137438161 AGGTGCGTCCCCGCCGGCAGGGG - Exonic
1062685637 9:137811634-137811656 AGGTCAGCGCCAGCCCGCGCTGG - Intronic
1192181792 X:68920774-68920796 AGCTGAGCCCAGGCCGGGGCTGG + Intergenic