ID: 997473154

View in Genome Browser
Species Human (GRCh38)
Location 5:134127908-134127930
Sequence ATTTTGTTCTTAAGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997473152_997473154 24 Left 997473152 5:134127861-134127883 CCTTTGTCTTGGGACATACTTGC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997473154 Original CRISPR ATTTTGTTCTTAAGTAAAAA AGG Intronic
No off target data available for this crispr