ID: 997475066

View in Genome Browser
Species Human (GRCh38)
Location 5:134138036-134138058
Sequence CTGAAAAATGAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 705}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997475066_997475071 3 Left 997475066 5:134138036-134138058 CCACCCTCCTTCTCATTTTTCAG 0: 1
1: 0
2: 3
3: 53
4: 705
Right 997475071 5:134138062-134138084 AAGGCCAATCAGCCCCCCCACGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997475066 Original CRISPR CTGAAAAATGAGAAGGAGGG TGG (reversed) Intronic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
900771333 1:4547231-4547253 ATTAAAAATGAAAGGGAGGGTGG + Intergenic
901199001 1:7456187-7456209 AGGAAAAATGGGAGGGAGGGAGG + Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
901724774 1:11232529-11232551 CTGCAAAATGAAAAAGAGGGTGG + Intronic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902577489 1:17387442-17387464 CTCAAAAAAGAAAAGGAGGGGGG + Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903552556 1:24168132-24168154 TGGAAAAATGGGAAGGAAGGAGG - Intronic
904543305 1:31248657-31248679 ATGGAAAATGACAAGGAGCGGGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905524492 1:38625892-38625914 TGGAAAAAAGAGAAAGAGGGAGG + Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
905745592 1:40414726-40414748 CTGAAAAATGAAAGGAATGGGGG - Intronic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
906172762 1:43741598-43741620 CTTAAAAATGAAGAGGAGGCTGG + Intronic
906380521 1:45329440-45329462 GTGAAAAAATGGAAGGAGGGAGG + Intronic
906398697 1:45489338-45489360 CTGAAAGATGAGAAGGGCTGTGG - Intronic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
908330505 1:63066220-63066242 CTTAAAAGAGAGAAAGAGGGAGG - Intergenic
908387623 1:63657625-63657647 GTGAAAAGGGAGAAGCAGGGAGG - Intronic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
908605668 1:65793903-65793925 GTGAAAAACGGGAAGGAAGGAGG - Intronic
908877195 1:68690990-68691012 TTGAAACATGAGAAGGAGTTGGG + Intergenic
909395965 1:75171057-75171079 GTGAAAGTTGAGAATGAGGGAGG + Intergenic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
910488457 1:87742071-87742093 ATGAAAAAGGAGAAGGGGAGGGG - Intergenic
910744864 1:90562358-90562380 CTGACAACTAAGAAGGAGGCTGG + Intergenic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911722916 1:101211026-101211048 ATGAAAAATGAGGAGGTAGGAGG + Intergenic
912630791 1:111245040-111245062 CTTAAAAATGAGAAAGCTGGGGG - Intergenic
912637591 1:111312381-111312403 CTGAAAAATAAGTAGGATGAGGG + Exonic
913044806 1:115064821-115064843 CTGGAATATGTGAAAGAGGGAGG + Intronic
913172019 1:116241660-116241682 CTGACAGATGAGCAGGAGGTAGG + Intergenic
913172266 1:116243668-116243690 ATGAAACATGAGCAGGAGCGAGG + Intergenic
913379996 1:118200009-118200031 CTAACAAATATGAAGGAGGGTGG + Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
916061787 1:161103814-161103836 CTGAAAAATCAGAGTGTGGGGGG + Intronic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916555722 1:165892730-165892752 CAGAAGAATGTAAAGGAGGGAGG + Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
917815485 1:178705651-178705673 GTGAAAAGTGAGAATGAGGCCGG - Intergenic
917930499 1:179819283-179819305 GAGAAAACTGAGAAGGAGAGAGG - Intergenic
917933893 1:179845404-179845426 CTTAAAAATGAGAACCAGTGGGG - Exonic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
920079638 1:203362981-203363003 CTCTAAAATGAGAAGGAATGGGG - Intergenic
920246290 1:204590003-204590025 CTCAAAAAAGAAAAGGGGGGGGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920443977 1:206001858-206001880 GTGAGAAATGAGAGGGAAGGGGG - Intronic
920723655 1:208413531-208413553 CTGTAAAATGAGAATGACAGTGG - Intergenic
921260345 1:213380839-213380861 CTGAGACATGAGAGGGAGAGAGG - Intergenic
921317313 1:213904997-213905019 GGGAAAAATGAAAAGCAGGGAGG + Intergenic
921352325 1:214248925-214248947 CTGAACCATGGGAAGGAAGGAGG - Intergenic
921660355 1:217793817-217793839 GTGAAAACTGAAAAGGAGGCCGG + Intronic
921700591 1:218264720-218264742 CTTAAAACTGAAAAGGAGGGAGG - Intergenic
922304873 1:224335709-224335731 TTAAAAAATGAGAAGTAAGGAGG + Intergenic
922908560 1:229196267-229196289 CTGAAAAATGAGGCCGAGTGAGG + Intergenic
923257917 1:232237345-232237367 CGGAAAAATGACAACGAGAGAGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924053697 1:240103551-240103573 GTGAAGTATGAGAAGGATGGAGG - Intronic
924262031 1:242241549-242241571 CTGAAAAATGACAAATAAGGTGG + Intronic
924427119 1:243962073-243962095 CTGAAGATTGAGGATGAGGGTGG + Intergenic
924671181 1:246127597-246127619 GTGAAATATGAAAAGGAGGCTGG + Intronic
924859623 1:247907727-247907749 CTGAAAACTGTGAATGAGGCCGG - Intergenic
924945298 1:248842507-248842529 CTGAGCAATGAGTACGAGGGAGG + Intronic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063661653 10:8038269-8038291 AAGATAAATGAAAAGGAGGGTGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064133809 10:12732911-12732933 GAGGAAACTGAGAAGGAGGGAGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065500860 10:26381097-26381119 GTGAAAGAGGAGGAGGAGGGAGG - Intergenic
1067909542 10:50332174-50332196 CTGGAGAATGATAGGGAGGGTGG - Intronic
1069819367 10:71217941-71217963 CTGGGAGGTGAGAAGGAGGGCGG - Intronic
1069841963 10:71345601-71345623 TGGAAGAATGAGAAGGAGAGGGG + Intronic
1069894692 10:71673124-71673146 CTGAAAAATGAATAAGAAGGGGG - Intronic
1070726933 10:78798616-78798638 CTGGAATATAGGAAGGAGGGAGG - Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071817786 10:89250834-89250856 CTGAAAATCTCGAAGGAGGGGGG + Intronic
1072161203 10:92768610-92768632 CTGAGAGATGAGAGAGAGGGAGG + Intergenic
1072286162 10:93917610-93917632 CTGAAGAATGAGGGGGAGTGGGG + Intronic
1073503039 10:103959311-103959333 CTGAAAGATTAGAAGGGGGAAGG + Intergenic
1073540049 10:104310750-104310772 CTGAAAAATGACCAGGACTGTGG - Exonic
1073541946 10:104322081-104322103 CTGCAAAATGCAGAGGAGGGAGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074677307 10:115866256-115866278 CTGAACAATTATAAGGAGTGGGG + Intronic
1075112927 10:119602575-119602597 GTGAAAATAGAGAAGGAAGGAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076326564 10:129628181-129628203 GTAAAAAATGAAAAGGAAGGCGG - Intronic
1076826325 10:132971417-132971439 CCAAAAAAAGAAAAGGAGGGAGG - Intergenic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1077422710 11:2460500-2460522 AGGAAAAAAGGGAAGGAGGGAGG - Intronic
1077924109 11:6663372-6663394 GTGAAAAATGGGCACGAGGGAGG + Intergenic
1078634904 11:13040327-13040349 CTGAAAAAGGATAAGGGGCGGGG - Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1078996542 11:16706597-16706619 CAGGAAAATGAGAAGCAGAGAGG + Intronic
1079321005 11:19451269-19451291 ATGAAAGAAGAGAATGAGGGAGG - Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1079464967 11:20721416-20721438 GTGAAAAATGTGAAGGAGAAAGG - Intronic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080225070 11:29950706-29950728 CTGACACATGCAAAGGAGGGTGG + Intergenic
1080599985 11:33812255-33812277 ATGAAAAGTGAGAAGGGTGGAGG - Intergenic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1080830919 11:35892628-35892650 CTGAAAAATCAGAAGGGTAGTGG + Intergenic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1081031048 11:38084214-38084236 CTGAAAAATAAGAGGAAGAGAGG - Intergenic
1081067124 11:38557685-38557707 GTGGGAATTGAGAAGGAGGGTGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083491640 11:63018498-63018520 ATGAAAAGAGAGAAGGTGGGAGG - Intergenic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084551284 11:69843639-69843661 TTTAAAAATGAGGAGGGGGGTGG + Intergenic
1085024676 11:73229566-73229588 CTGTAGAATGAGAGGGCGGGAGG + Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1085796879 11:79549869-79549891 TTAGAAAATGAGAATGAGGGAGG + Intergenic
1086153730 11:83642367-83642389 CTGAAAACAGAGAAGGGGTGAGG - Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087287330 11:96279023-96279045 CTGAAAAGTGAGTGAGAGGGAGG + Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1089183977 11:116602515-116602537 CTGAAAAAGGGGCAGGATGGAGG - Intergenic
1089529638 11:119118242-119118264 ATGAAAGGTGAGAAGGTGGGAGG - Exonic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090223197 11:125049161-125049183 CTGAAAAATGAGAAACAGTGAGG - Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090984177 11:131751048-131751070 CTGAAGAGTGATTAGGAGGGTGG - Intronic
1091468101 12:703207-703229 TTGAAAAATGCGTAGGAGGAAGG + Intergenic
1091504522 12:1053584-1053606 ATGAAAAATAAATAGGAGGGAGG - Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095328901 12:40932991-40933013 TTGAAAAGAGAGAAGGAGAGAGG - Intronic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095785378 12:46103076-46103098 CTGAAAAAGGAGGACGAGAGAGG - Intergenic
1096097207 12:48943616-48943638 CTGCAAACTGAGAAGGGTGGTGG - Intronic
1096233703 12:49911827-49911849 CTGAACAATGATGAGGATGGTGG - Intergenic
1096476152 12:51910507-51910529 GTGATAAAGTAGAAGGAGGGTGG + Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097430906 12:59505572-59505594 CTGAAAAATGAAGAGAAGGTTGG - Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099300155 12:80883131-80883153 GTGAAGGATGAGAAGGAGAGAGG - Intronic
1099306203 12:80959269-80959291 TTTAAAAATGCGAAGGAGGCAGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1100868492 12:98885056-98885078 GTGAAAGATGAGAAAAAGGGAGG - Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101758208 12:107638185-107638207 TTAAAAAATGAGAAGAAGTGAGG + Intronic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1101856698 12:108449625-108449647 CTGAAATATGAGAATGCAGGAGG + Intergenic
1102143336 12:110635310-110635332 ATGACAGATGAGATGGAGGGTGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104527559 12:129538757-129538779 CTGCACAATGAGATGAAGGGAGG + Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106258286 13:28041300-28041322 CTGAAAAAGGAGAAGAGAGGAGG + Intronic
1106961670 13:35005774-35005796 CTGAAAAATGAGAATAAGTTAGG + Intronic
1107512237 13:41096370-41096392 CTCAAAAAAAAAAAGGAGGGGGG - Intergenic
1107873053 13:44764601-44764623 CTGAGAGATGTGAAGGACGGAGG + Intergenic
1108184895 13:47878755-47878777 CTGGAAAATGAGTAAGAGTGAGG - Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108299876 13:49062506-49062528 CTGAAAAATAGGAAGTAGTGTGG - Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108977553 13:56467575-56467597 CTGAAAAAAGAGGATGTGGGAGG + Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110846501 13:80195808-80195830 AGGAAAAAAGGGAAGGAGGGAGG + Intergenic
1111105376 13:83638726-83638748 CTGAGAAATGAGAATTAAGGTGG - Intergenic
1111263459 13:85775244-85775266 CTGAAAAATGATATGCAGTGTGG + Intergenic
1111446171 13:88348034-88348056 GGGAAAAAAGGGAAGGAGGGAGG + Intergenic
1111446208 13:88348174-88348196 GGGAAAAAAGGGAAGGAGGGAGG + Intergenic
1111829915 13:93315074-93315096 TTGATGGATGAGAAGGAGGGAGG + Intronic
1112206584 13:97329872-97329894 CTGAAAAATGAGTAGGAACTTGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112696737 13:101958119-101958141 CTGAAAGCTGAGTAGGAGGAAGG - Intronic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1114127169 14:19742093-19742115 CCAAAAACTGAGAAGGATGGTGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118749322 14:68794997-68795019 CTGAAAAATGGGAGCGGGGGAGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119647880 14:76361544-76361566 CTGAAAAATGTGTAGGAGAAGGG + Intronic
1120444137 14:84572351-84572373 CTGAAAAATAAGGAGGAAAGAGG - Intergenic
1120628006 14:86853374-86853396 CTGAAAGTTGAGAAGGATGCAGG + Intergenic
1120754797 14:88232807-88232829 CCCAAAAATCAGAAGGAAGGTGG - Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121554165 14:94823714-94823736 CTGAAAGGTGAGGAAGAGGGTGG - Intergenic
1121599286 14:95191155-95191177 CTGCTTAATGAGAAAGAGGGTGG - Exonic
1121958067 14:98232196-98232218 CTGAAAAATGATTAAGAGGGTGG + Intergenic
1122648157 14:103208454-103208476 CTGAAAAATAAGAAGCAAAGAGG - Intergenic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122822996 14:104356387-104356409 CGGACAAATGAGAAAGACGGAGG - Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1123570625 15:21603732-21603754 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1123606738 15:22039085-22039107 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1123954666 15:25322922-25322944 CTGAAAAATGAGAAGAGGAAGGG - Intergenic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124363818 15:29057349-29057371 CTGTAAAATGAGTAGAAGAGAGG - Intronic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1125770900 15:42165170-42165192 CTTAAAAATGTGAGGGAGGCTGG - Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127229495 15:56973170-56973192 CTGACAGATGGGAGGGAGGGAGG - Intronic
1127718708 15:61678283-61678305 CTGGAATATGAGAATGTGGGTGG - Intergenic
1127966171 15:63924401-63924423 CCCAAAAATCAGAAGGAAGGAGG + Intronic
1128151537 15:65366406-65366428 ATAAAGAAAGAGAAGGAGGGAGG + Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128518323 15:68358179-68358201 CTAAAAAGTGACAAGGAAGGTGG - Intronic
1128808618 15:70553699-70553721 GTGTAAAATGAAAAGGAAGGTGG + Intergenic
1128821332 15:70657661-70657683 ATTAAAAAAGAGAAAGAGGGAGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129915287 15:79264790-79264812 TTGAAAAAAGGAAAGGAGGGGGG + Intergenic
1130839211 15:87682034-87682056 GTGAAAAATGGCAGGGAGGGAGG + Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1202978978 15_KI270727v1_random:330855-330877 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1133402202 16:5496407-5496429 CTGAATAGTGAGAAGGAGCTGGG - Intergenic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1134100011 16:11445524-11445546 CTAAAAGATGAGTAGAAGGGAGG + Intronic
1134270843 16:12731674-12731696 CTGACAAATGCGGGGGAGGGAGG - Intronic
1135213724 16:20546253-20546275 CAGAAAAAAGGGACGGAGGGAGG - Intronic
1135497453 16:22964956-22964978 AAGAAAGATGAAAAGGAGGGAGG - Intergenic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1136136874 16:28261627-28261649 CTCAAAAAAGAGAAAGAGAGAGG + Intergenic
1136619248 16:31417042-31417064 CTCAAAAAAAAGAGGGAGGGAGG - Intronic
1137063836 16:35815749-35815771 CTGAAAAATGGGAGGGAGACTGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137553969 16:49458664-49458686 CTGAATAGTGAGAAGGACAGGGG + Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138202585 16:55101092-55101114 AGGAAAAAAGAGAGGGAGGGAGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1138659084 16:58507322-58507344 CTGCAAAATGAGGAAGAGGTCGG + Intronic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139263902 16:65622115-65622137 CTGAAAAATGAGCAGGAATTAGG + Intergenic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1141776471 16:86126428-86126450 TTAAAAAATGAGAAGTAGGCTGG + Intergenic
1141886822 16:86898129-86898151 AGGAAAAGTGAGAGGGAGGGAGG - Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1143104575 17:4522578-4522600 CTGAGAGAAGAGAAAGAGGGAGG - Intronic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143539091 17:7558889-7558911 CTTGAAAATAAAAAGGAGGGAGG - Exonic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1144359563 17:14479086-14479108 CTGAAAACAGAGAACCAGGGAGG - Intergenic
1144504358 17:15817464-15817486 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1144634115 17:16893132-16893154 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1145168212 17:20632973-20632995 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1146164302 17:30575942-30575964 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1146521290 17:33527514-33527536 GTGAAAAATGACCAGGAGTGGGG + Intronic
1147842940 17:43385466-43385488 TTGATAGCTGAGAAGGAGGGGGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148542221 17:48489932-48489954 GTGAAAAACAAAAAGGAGGGGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148792820 17:50183292-50183314 CTTAAAAAGGAGTAGGCGGGAGG + Exonic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1153284461 18:3445426-3445448 TTAAAAAATGAGAAGAAGGCCGG + Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153738461 18:8097708-8097730 CTGAAACCTGAGGAGGAGGTAGG + Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1155723946 18:29055238-29055260 CTGTAAAAAGATAAGGAAGGGGG + Intergenic
1156465140 18:37343964-37343986 CTGAAAAATGGGGAGGAGTTTGG - Intronic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157691763 18:49688595-49688617 CTGAAAAATAAAAAGTATGGAGG + Intergenic
1158183613 18:54746011-54746033 ATGAAAACTGAGAAGGGAGGCGG + Intronic
1158770638 18:60513050-60513072 CTGAAAAATGACCATGAGGGAGG - Intergenic
1158996807 18:62929596-62929618 CTGAAAGGTGGGAAAGAGGGTGG + Intronic
1159233170 18:65635423-65635445 CCTAAAAATGAGAAGTAGGGTGG + Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1161836295 19:6649353-6649375 GTGAAGAGTGAGGAGGAGGGCGG - Intergenic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1163409255 19:17143400-17143422 CTCAAAGCCGAGAAGGAGGGAGG + Intronic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166322581 19:42027788-42027810 ATGAAAAGTGAGTAGGAGGAGGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166772486 19:45292271-45292293 CTTAAAAAAGAGAAAAAGGGTGG + Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925905218 2:8536141-8536163 CTGAAAAATTAGAACCAGGAGGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927628627 2:24750911-24750933 CTTAAAAGGGGGAAGGAGGGGGG + Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928471785 2:31582154-31582176 GTGAAAAATGAGAAGGACTGGGG - Intergenic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929401870 2:41592220-41592242 AGGAAAAAAGAGAGGGAGGGAGG + Intergenic
929632523 2:43479379-43479401 CTGCAAAATGAGAATGAGACTGG + Intronic
929744393 2:44640999-44641021 CTGTAACATAAAAAGGAGGGAGG - Intronic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
929870268 2:45753225-45753247 CAGAAACATGGGGAGGAGGGTGG - Intronic
930388940 2:50736111-50736133 CTGAAATACGGGAAGCAGGGGGG - Intronic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
932162376 2:69473260-69473282 CTGTAAAATGAAGAGGATGGTGG + Exonic
932236509 2:70125001-70125023 GTGGAAAATGAGGAAGAGGGCGG + Intergenic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
932531548 2:72539325-72539347 CTGAAAAATGTGAAGCAGCTTGG - Intronic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
935469694 2:103443492-103443514 CTGAAGGATAGGAAGGAGGGTGG + Intergenic
935480566 2:103583008-103583030 AGGAAAACTGAGAAGAAGGGAGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935815425 2:106842699-106842721 CTGAACAGTGAGAAGGACGCCGG + Intronic
935854299 2:107258086-107258108 GGGCAAAATGAGAAGGAGGGAGG + Intergenic
936240360 2:110783020-110783042 CTTAATAATGAGGAGCAGGGAGG + Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
937979007 2:127602050-127602072 CATAAAAATGCGAAGGAGAGAGG - Intronic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938894776 2:135739182-135739204 CTGAAAGAAGTGAAGGATGGTGG - Intergenic
939106956 2:137960252-137960274 CTCAATAATGAAAAGGATGGAGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939262371 2:139827542-139827564 GTAAAAAATGAGAAAGAGTGGGG - Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939568197 2:143809840-143809862 CTGAAAAATAAGCAGGGTGGGGG + Intergenic
939717759 2:145606243-145606265 CTGAAAAATGAAAAAGAAGCAGG + Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941354075 2:164467435-164467457 CTTAAATATGAGAAGGAGACTGG + Intergenic
941384991 2:164841542-164841564 CTGGAAAAGGAGGAGGAGCGGGG + Intronic
941505539 2:166339431-166339453 ATGAAAAAATAGGAGGAGGGAGG + Intronic
941646077 2:168042876-168042898 CTCCAAAATTAGAAGGAAGGTGG - Intronic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
943134185 2:183890814-183890836 ATCAAAAAGGAGAAGGAGAGAGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943695694 2:190928137-190928159 CTGAAATATGACAAGGATAGGGG - Intronic
944278967 2:197872377-197872399 ATTACAAATGAGAAAGAGGGAGG - Intronic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
946391830 2:219420786-219420808 CCCAAAAATGAGAAGGATGCAGG - Intronic
946693067 2:222324099-222324121 CTGTAAAATGAGGATAAGGGTGG + Intergenic
946899119 2:224355378-224355400 ATGAAGAATGAGGAGGATGGAGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
948253947 2:236552474-236552496 CGCAAGAATGAAAAGGAGGGGGG - Intergenic
1169922460 20:10749826-10749848 CTTCAAAATGGGAAGGAGTGGGG - Intergenic
1170801155 20:19591384-19591406 CTGAAAAATGCAAAGGAAAGTGG + Intronic
1170894737 20:20403014-20403036 GTGAGAAATGACAAGGAAGGAGG - Intronic
1171233395 20:23505582-23505604 TTGAAGAATGAGAAAGAGTGGGG + Intergenic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173196467 20:40917875-40917897 CTGAAAAATGAGCAGCAGCCGGG + Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173545378 20:43893794-43893816 CTGGAAGATGTGAAGTAGGGGGG + Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1173966746 20:47118236-47118258 CTGAAAAGAGAGAGGGAAGGGGG - Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174660225 20:52205937-52205959 ATGAAAAATCAGAAGGTAGGTGG - Intergenic
1174943026 20:54952903-54952925 CTGAAAATTCAGAAAGGGGGAGG - Intergenic
1175065311 20:56279619-56279641 AAGAAAAATGAAAAGGAGAGGGG + Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175723246 20:61300284-61300306 TTGAAAAATGAGCAGGAGAAGGG + Intronic
1176008624 20:62880216-62880238 CTCCAAACTGAGAGGGAGGGGGG + Exonic
1176031037 20:63011800-63011822 CTAAGAAATGAGAGGGATGGGGG + Intergenic
1177050866 21:16231033-16231055 CTGAAAAATAAGAATGATTGAGG - Intergenic
1177277106 21:18926819-18926841 AGGAAAAAAGAGAGGGAGGGAGG - Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1178275626 21:31234301-31234323 CTGAAAAGAGAGCAGGAGAGGGG + Intronic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178974693 21:37210837-37210859 CTGAAAAAAGAGATGGGGAGGGG - Intergenic
1179261661 21:39763441-39763463 CTGGGAGATGAAAAGGAGGGAGG - Intronic
1179494537 21:41763500-41763522 GGGAAAAGTGAGAAGCAGGGAGG + Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180647797 22:17353933-17353955 GTGAAAAAGGAAAAGGATGGGGG - Intergenic
1180716877 22:17877837-17877859 CTCAAAAAAAAGAAGAAGGGAGG - Intronic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181847753 22:25725946-25725968 CTCAAAAAAAAAAAGGAGGGGGG + Exonic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182473026 22:30560367-30560389 CTGTAAAATGAGAAAGCTGGAGG + Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1183017502 22:35001307-35001329 AGGAAGAATGTGAAGGAGGGAGG + Intergenic
1183688309 22:39374625-39374647 CTGAAACATGGGAAGAAGGGTGG - Intronic
1183881480 22:40835068-40835090 CTGAAAAATTAGGAGAAGGCGGG - Intronic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184728211 22:46358226-46358248 CAGAAACATGAGTAGGTGGGAGG + Intergenic
949494400 3:4618263-4618285 CTGGAAAGTGAGAAGGCGTGAGG - Intronic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950628173 3:14263766-14263788 TTGAAAAATGAGAAGGATTTGGG - Intergenic
950956881 3:17063304-17063326 CTAAAAAAAAAGAAGGAAGGAGG - Intronic
951320565 3:21239193-21239215 CTGAAAAATGAGTGGGCTGGGGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
952413765 3:33072297-33072319 CTTAAAAAGGAAAAGGATGGGGG - Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955153898 3:56396797-56396819 CTGAAGCATGGGGAGGAGGGTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955809268 3:62769526-62769548 CTCAAAGATGAGAATTAGGGTGG - Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
957651811 3:83016295-83016317 CTGAAAAATTAGAAGTACGAAGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959065666 3:101654404-101654426 CTGGAAAATGAAGAAGAGGGGGG + Intronic
959421161 3:106130839-106130861 CTGACAAATGAGAAAGACGATGG - Intergenic
960071282 3:113434006-113434028 TTGAAAATAGAGAAAGAGGGAGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960934453 3:122889017-122889039 TTGACAAAAGAGGAGGAGGGAGG - Intergenic
962714826 3:138116812-138116834 TGGAAAAAAGAGAAAGAGGGAGG - Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963303088 3:143620613-143620635 TTGAAAAAGGAGAAACAGGGGGG + Intronic
963366083 3:144336432-144336454 CTTAAAAATTAGAAAGAGGCTGG + Intergenic
964642576 3:158925863-158925885 GTGATAAATGAGAATGATGGGGG + Intergenic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966517790 3:180838181-180838203 CTGAAAGAAAGGAAGGAGGGAGG + Intronic
966667725 3:182491067-182491089 CACAAAAATGAAAAGGAGTGTGG - Intergenic
966758300 3:183392211-183392233 TTGAAAAATGAGATGGCGTGGGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967260732 3:187639274-187639296 CTGGAAGATGACAAGGTGGGAGG - Intergenic
967336687 3:188352045-188352067 AAGAAAAATGACAAGGGGGGAGG - Intronic
968020068 3:195378045-195378067 GTGAAAAAGAAGAGGGAGGGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968633548 4:1665820-1665842 ATGAAGAATGGGAGGGAGGGAGG + Intronic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970027319 4:11637166-11637188 GTGAAAAATGAAGAGGAAGGAGG + Intergenic
970537750 4:17046612-17046634 ATGAATCATGAGAAGAAGGGTGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972294248 4:37721445-37721467 CTGGGAAATGAGAATAAGGGAGG + Intergenic
972335283 4:38102458-38102480 TTGAGAAGTGAGAAGAAGGGAGG + Intronic
972693244 4:41420035-41420057 CTGATAAATGTGGATGAGGGGGG + Intronic
972986254 4:44769559-44769581 ATGGAAAATGAGAGGGAAGGAGG - Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974174938 4:58309734-58309756 ATCAAAAATGGGAAGGAGAGGGG + Intergenic
974266611 4:59593999-59594021 GTGAAAGGTGAGAAGGAGAGAGG - Intergenic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
975941174 4:79648642-79648664 CTGAAAAATGAGTAGGAATTAGG + Intergenic
976053887 4:81040099-81040121 CTGAGAATTGAAAAGGAGGTTGG - Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977245148 4:94622657-94622679 GGGAAAGGTGAGAAGGAGGGAGG - Intronic
977338343 4:95726285-95726307 TTGAAGTATGTGAAGGAGGGAGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978154158 4:105471218-105471240 TTAAAAAATGAGATGCAGGGAGG + Intronic
979361002 4:119765022-119765044 TTGAAAAATGAGAAAGTGTGTGG + Intergenic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
980825950 4:138073347-138073369 CTGATAAATGAAAAAGAAGGTGG + Intergenic
981034792 4:140158152-140158174 ATGAGAAATGAGATGGAGGCTGG + Intergenic
981118910 4:141025539-141025561 ATGAAAAATGAGAAGGAATGGGG + Intronic
981147215 4:141339304-141339326 CTGACAAATGAGAAGGGACGGGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
982404812 4:155007771-155007793 GGGAAAGATGAGAAGAAGGGAGG - Intergenic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983696778 4:170542023-170542045 GTGGAGAATGAGAAGGAGAGTGG + Intergenic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985203599 4:187508625-187508647 ATGAAAGATGAGAGGAAGGGAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
986773791 5:10995901-10995923 ATGGAAAATGAGAAGAAGTGAGG + Intronic
987113461 5:14708509-14708531 CTGAAAAGTGGGAAGGAGAAAGG + Exonic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
989437303 5:41429703-41429725 TAGAAATATGATAAGGAGGGAGG + Intronic
989555174 5:42786144-42786166 CAAAAAATTGAGGAGGAGGGAGG - Intronic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990861469 5:60332327-60332349 CCGAAAACAGAGAGGGAGGGGGG - Intronic
991985726 5:72284487-72284509 ATGGAAAAAGAGAAGGGGGGAGG + Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992450372 5:76870823-76870845 TTAAAAAATGAGGAGGAGGCTGG + Intronic
992720194 5:79553039-79553061 CTGAAATTTGAGAAAAAGGGAGG + Intergenic
992784945 5:80160694-80160716 CTCAAACATAGGAAGGAGGGAGG - Intronic
993990004 5:94644644-94644666 CTGAAAGATGAGCAGAAGGCAGG - Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
996983049 5:129523456-129523478 ATGATAAATGACAAGGAGAGGGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998888232 5:146717743-146717765 CTAGAAAATGGTAAGGAGGGAGG - Intronic
998985920 5:147756635-147756657 CTGAGAGAAGAAAAGGAGGGTGG + Intronic
999122664 5:149221110-149221132 CTTGAAAATGAGTAGGAGGTGGG + Intronic
999125245 5:149241463-149241485 CTGAAAGATGAGAAGGGGCCTGG + Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999721925 5:154405011-154405033 AAGAAAAATGAAGAGGAGGGAGG + Intronic
999859793 5:155633365-155633387 CTGAAAGAGGACAGGGAGGGTGG - Intergenic
1000330513 5:160201630-160201652 GTGAGAAATGAGAAGGGGAGAGG - Intronic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1002085881 5:176775037-176775059 CAGCAAACTGAGGAGGAGGGAGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1004106877 6:12673984-12674006 ATGAGAAATGAGCAGGAGAGGGG - Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004331861 6:14728982-14729004 GAAAAAAATGGGAAGGAGGGAGG + Intergenic
1004869534 6:19890757-19890779 GGGAAAAAAGAGAGGGAGGGAGG - Intergenic
1005858891 6:29886474-29886496 CTGAAGGATGAGAAGAATGGAGG + Intergenic
1005866442 6:29941276-29941298 CTGAAGGATGAGAAGGATGGAGG + Exonic
1005885912 6:30097584-30097606 GTGAAAAATGGGAAGCAGGTGGG + Intergenic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1007127544 6:39440120-39440142 ATGAACAGTGAGAAGGGGGGTGG + Intronic
1007271423 6:40640436-40640458 AGAAAGAATGAGAAGGAGGGAGG - Intergenic
1007970141 6:46043786-46043808 GTGAAAAATGAGGAGGGAGGTGG + Intronic
1010912116 6:81571223-81571245 ATGAAAAATAAGTGGGAGGGAGG - Intronic
1011459772 6:87590710-87590732 CTGAAAAATGAGTAGAAGTTAGG + Intronic
1012702178 6:102473416-102473438 CTGAAAAGTGAAAAGGAGCATGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1014069932 6:117169089-117169111 CTGAAGCCTGAGAAGGATGGTGG - Intergenic
1014699508 6:124666293-124666315 CTGAAATAGGAGAATGAAGGTGG + Intronic
1014795713 6:125721960-125721982 CTGAAGAGTGAGAATGAGAGCGG - Intergenic
1014912276 6:127109164-127109186 CTGAAATTTGACAAGGAGAGAGG - Intergenic
1015308865 6:131742491-131742513 CTGACAAATGAGAAGAGGAGAGG - Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015877037 6:137833202-137833224 CTGAAAAATGAAAAGGCTGCTGG + Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017224880 6:152009179-152009201 AGGAAAAATGAGAAAGTGGGTGG - Intronic
1017418532 6:154247542-154247564 TTGTAAAGAGAGAAGGAGGGAGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018019961 6:159752752-159752774 CTCAAAAAAGAGGAGGAGAGAGG - Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018412294 6:163563344-163563366 CGGAAAAATGAGAAGGGAGTAGG - Intronic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019772998 7:2895484-2895506 CTGAAAAATGAGAGGGGTGGGGG - Intergenic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022162092 7:27721331-27721353 CTGAAAAATAGCAAGGAGGATGG + Intergenic
1022268647 7:28784462-28784484 AAGCAAAATGAGCAGGAGGGAGG - Intronic
1022697814 7:32727990-32728012 ACGAAGAATGAGAGGGAGGGAGG - Intergenic
1022841181 7:34165425-34165447 CTGCAAAATGTGAAGAATGGAGG - Intergenic
1023336607 7:39177215-39177237 CTGAATCATTAAAAGGAGGGTGG - Intronic
1024775927 7:52785495-52785517 CTGAGAAGTGAAAGGGAGGGAGG - Intergenic
1025763017 7:64412485-64412507 TTAAAAAATGAGGAGTAGGGAGG - Intergenic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1027132236 7:75599248-75599270 CTGAAAAACAAGAAGGGGGGAGG + Intronic
1027174779 7:75896409-75896431 CTGCAGAATGAGAAAGAGTGAGG + Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028516900 7:91687856-91687878 AGGAAAGAAGAGAAGGAGGGAGG - Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029574990 7:101397535-101397557 CTCAAAAAAAAAAAGGAGGGGGG - Intronic
1030114589 7:106053674-106053696 CAGAAAGAAGGGAAGGAGGGAGG - Intergenic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030862302 7:114649447-114649469 CTGAAAAATGAGAGGATTGGTGG - Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031446123 7:121857020-121857042 TTGAAGAATGGGAGGGAGGGAGG + Intergenic
1031949368 7:127876148-127876170 CTGAATAATGACAATGAAGGGGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032422834 7:131796802-131796824 CTAATAAATGATAAGGAGAGGGG + Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032757797 7:134907754-134907776 ATCAAAAATGAAAAGGCGGGGGG - Intronic
1033148716 7:138894240-138894262 CTGAAAGATGAGGAAGAGGGAGG - Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034030292 7:147755090-147755112 GTGAAAAATGAGAAGTAGCAGGG + Intronic
1034457330 7:151177950-151177972 ATGAAAAATAAGAAGGAGCCGGG + Intronic
1034829051 7:154293446-154293468 CTGAAGGATGAGAAGGGGAGAGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035173406 7:157033504-157033526 CTGAGAAATGACAATGTGGGTGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036220247 8:6915215-6915237 CTGATAAATGATGAGGAGAGTGG + Intergenic
1036608917 8:10333189-10333211 CTGAAAGATGAGTAGGAGTGTGG - Intronic
1036619054 8:10410987-10411009 AGGAAAGACGAGAAGGAGGGAGG - Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1037297306 8:17414209-17414231 CTGAAAGATGAGTAAGAGCGAGG - Intergenic
1037660673 8:20923971-20923993 TGGAAAAATGAGAATAAGGGAGG + Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1040491058 8:47922604-47922626 CTTAAAAATGAAAAGCAGGCTGG - Intronic
1040723837 8:50357124-50357146 GTGGGAAATGAGCAGGAGGGAGG - Intronic
1040825862 8:51619879-51619901 ATGAAAAATGAGCAGCTGGGTGG - Intronic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041396769 8:57399593-57399615 AGAAAAAAAGAGAAGGAGGGAGG - Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1041985578 8:63918788-63918810 ATCAAAAATGACAAGGAAGGAGG + Intergenic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045231749 8:100312600-100312622 ATGAAAGAAGGGAAGGAGGGAGG + Intronic
1045826795 8:106407673-106407695 CTGAAACATGTGATGGAGGAAGG + Intronic
1046522695 8:115345816-115345838 TTTAAAAATGAGAAGTAGGTGGG + Intergenic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1048224700 8:132574004-132574026 CTGAAAGATGTGAAGGAATGTGG + Intronic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1048616453 8:136080474-136080496 GTGAAAGAAGGGAAGGAGGGAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048921857 8:139238618-139238640 CTGAAACATGGGGAGAAGGGGGG + Intergenic
1048957051 8:139545959-139545981 GTGAAAGATGAGCAAGAGGGGGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049356804 8:142193077-142193099 AGGAAAAAGGAGCAGGAGGGAGG + Intergenic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1049971804 9:828199-828221 CTGAAAAATCAGAAAGATAGTGG + Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1051461226 9:17318538-17318560 GTGAAATATGAGAAGAAAGGAGG + Intronic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052754153 9:32523800-32523822 CTGAAATGTGATAAGGAGAGGGG - Intronic
1053318651 9:37075634-37075656 CTGGAAAATAAAAAGGAAGGAGG + Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1054894488 9:70293337-70293359 CTAAAAAAAGAGTAGGGGGGTGG - Intronic
1055094515 9:72398045-72398067 CTGAAAAGTGAGTAAGAGGCTGG + Intergenic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057437983 9:95059588-95059610 CAGAAAGATGAGGAGCAGGGAGG + Intronic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059976442 9:119722885-119722907 CTGAGAGAAGAGAAAGAGGGAGG - Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1061049944 9:128189325-128189347 CTTAAAAATGATAAGCAGGTAGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061714018 9:132507517-132507539 CTGACAAATGTGAAGGATGCAGG + Intronic
1185431185 X:13006-13028 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185431987 X:16686-16708 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185440452 X:225403-225425 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185755441 X:2649823-2649845 AGGGAAAGTGAGAAGGAGGGAGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186849676 X:13568526-13568548 ATGAAATGTGAGAAGTAGGGAGG - Intergenic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187664411 X:21588821-21588843 TTGAAAAATGACAAAGATGGAGG - Intronic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1190545322 X:51519638-51519660 CTAAACAATGAGCAGGATGGTGG - Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1191920153 X:66246903-66246925 TTCAAAAATGAGAGGGTGGGAGG - Intronic
1192056300 X:67777231-67777253 TTGAAAGCTGAAAAGGAGGGAGG + Intergenic
1192314301 X:70040056-70040078 CTGCAAAATGAGCTGGAGGCTGG - Intergenic
1192869861 X:75175086-75175108 CATAAAAATGGGAAGGAGAGGGG - Intergenic
1193138524 X:78000278-78000300 ATTAAAAAAGAAAAGGAGGGAGG + Intronic
1193819212 X:86142139-86142161 CTGAAAAAAGGAAATGAGGGAGG + Intergenic
1194294505 X:92111731-92111753 ATGAAAAATGAGAATTAGAGTGG - Intronic
1194661721 X:96635147-96635169 GTTAAAAATGAGAAGCAGGCAGG - Intergenic
1194866342 X:99073285-99073307 GTGAAAAATGACAAAGAGAGAGG - Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196255652 X:113515241-113515263 CTGAAAAATGAGGACAAGTGTGG - Intergenic
1196321775 X:114349370-114349392 CTCAAAAAGGAAAAGGGGGGGGG + Intergenic
1197949883 X:131882858-131882880 CTGGAAGTAGAGAAGGAGGGCGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198131802 X:133703411-133703433 CTGAAACATAAGAAGAAGGCAGG + Intronic
1198673050 X:139102313-139102335 CTGCAAAATGAGAATGATGCTGG + Intronic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199061392 X:143359249-143359271 CTGAAAAATGGGAAACAGGCTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1199907788 X:152252134-152252156 TTGAAAAATGAAAGGGAGGGAGG - Intronic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201286857 Y:12386850-12386872 CTGTTCAATGAAAAGGAGGGCGG - Intergenic
1201782931 Y:17743279-17743301 AAGAAAGATGAGAGGGAGGGTGG + Intergenic
1201818622 Y:18162708-18162730 AAGAAAGATGAGAGGGAGGGTGG - Intergenic