ID: 997475143

View in Genome Browser
Species Human (GRCh38)
Location 5:134138388-134138410
Sequence CGGGGTCACCCATGGGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997475143 Original CRISPR CGGGGTCACCCATGGGATTT AGG (reversed) Intronic
908186733 1:61659478-61659500 TGGGGTCTCCCAAAGGATTTAGG + Intergenic
908599275 1:65721735-65721757 AGGGGCCTCCCATGGGATGTAGG - Intergenic
911157893 1:94654825-94654847 CCTGGTCACCCATGGGCATTAGG - Intergenic
913509132 1:119546677-119546699 GGAGGTAACCCATGGGAGTTGGG - Intergenic
916883575 1:169045986-169046008 CGGGGTCTCCCAGGTGATTGAGG + Intergenic
917978633 1:180255918-180255940 CGGGGTCCCCAGTGGGATCTGGG + Intronic
921264910 1:213414410-213414432 TGAGGACACTCATGGGATTTAGG - Intergenic
1065865975 10:29915926-29915948 CAGGAGAACCCATGGGATTTAGG - Intergenic
1066028388 10:31390000-31390022 CAGGGTCATCCAGTGGATTTTGG - Intronic
1066139586 10:32489871-32489893 CTGGGTCACACATGGAATTGGGG + Intronic
1068859990 10:61838412-61838434 CGGGGTCACTGATGGACTTTGGG - Intergenic
1076628260 10:131834830-131834852 CAGGGTCACCCATGGGGGTGTGG - Intergenic
1078109653 11:8382209-8382231 TGGGGTGACACTTGGGATTTGGG + Intergenic
1079135213 11:17772683-17772705 CGGGGTCACCCACGGAACTAAGG - Intronic
1082267446 11:50134802-50134824 CGGGGTCACACATGTGACTTAGG + Intergenic
1082288641 11:50343764-50343786 CGGGGTCACACATGTGACTTAGG - Intergenic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1083869307 11:65477321-65477343 CTGGGTCCGCCTTGGGATTTGGG - Intergenic
1085259465 11:75195935-75195957 CTGGGGCACCCCAGGGATTTGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088599908 11:111464737-111464759 TGGGGTAACCCCTGGGATCTAGG + Intergenic
1089567301 11:119378494-119378516 GGGGGTCATCCAAGGGAATTTGG + Intronic
1090423861 11:126593638-126593660 GGGGGTCATCCATGGGGTCTGGG + Intronic
1104330340 12:127838733-127838755 GGTGGTCACCCATGAGATTCGGG - Intergenic
1104558287 12:129821829-129821851 CTGGACCACCCCTGGGATTTAGG + Intronic
1105418230 13:20231689-20231711 CGGGGTGTCCCCTTGGATTTGGG - Intronic
1112405572 13:99117237-99117259 CAGTGTCATCCATGGCATTTGGG + Intergenic
1119432985 14:74580375-74580397 AGGGTTCAGCCATTGGATTTAGG - Intronic
1121253832 14:92517420-92517442 CTGGGTCACCTAGGGGATTGGGG + Intronic
1123117245 14:105900268-105900290 CGGGGTCCCCCAGGGTATTGGGG + Intergenic
1128017045 15:64356545-64356567 CTGGGTCAGCCACGGGATTAAGG - Intronic
1132613125 16:827559-827581 CGGAGTCACCCCAGGGATTCTGG + Intergenic
1141869837 16:86777556-86777578 CGAGGCCACACATTGGATTTCGG - Intergenic
1145831600 17:27920839-27920861 CAGGGACACACATGGGACTTTGG + Intergenic
1152533834 17:80938788-80938810 CGGGGTCAGACATGAGGTTTGGG + Intronic
1153844066 18:9032923-9032945 CCAGGGCACCCATGGGACTTTGG + Intergenic
1154435327 18:14337692-14337714 GGGGGCTACCCATGGGAATTGGG + Intergenic
1155166587 18:23237173-23237195 GGGGGTCATCCAAGAGATTTGGG - Exonic
1159158902 18:64619099-64619121 AGAGGCCACCCTTGGGATTTTGG - Intergenic
1159967242 18:74607179-74607201 CGGAGTCACCCAGAGGGTTTGGG + Intronic
925291475 2:2751264-2751286 CGGGGCCACCCCTGGGCTCTGGG - Intergenic
929233495 2:39583899-39583921 CGTGGAAACACATGGGATTTGGG - Intergenic
936071238 2:109372827-109372849 CCGTGTCACCCGTGGGCTTTCGG - Intronic
936473170 2:112816571-112816593 CAGGGTAACCCAAGTGATTTTGG + Intergenic
942597187 2:177602190-177602212 CTGTGTCGCCCATGGGGTTTTGG + Intergenic
943964899 2:194320504-194320526 CTTGGTTACCCATGGGATTATGG - Intergenic
945903599 2:215566240-215566262 CAAGATCTCCCATGGGATTTAGG + Intergenic
948761028 2:240191107-240191129 AGGGGTCACCCAGGGGTTCTAGG + Intergenic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1176045370 20:63089837-63089859 CGGCCTCACCCATGGGATGGCGG + Intergenic
1183264562 22:36817296-36817318 AGGGGCCACCTCTGGGATTTAGG + Intronic
950546890 3:13643524-13643546 AGGGGTGACCACTGGGATTTGGG - Intergenic
953913405 3:46904075-46904097 CTGGGTCCCCCATGGGGTCTAGG - Intergenic
954462630 3:50636259-50636281 GGGGATCAGCCATGTGATTTGGG + Intronic
956909181 3:73799630-73799652 TGGGGTCACACATGTGACTTGGG + Intergenic
963260717 3:143188547-143188569 CAGGCCCACCCATGGGATATGGG + Intergenic
965571876 3:170181429-170181451 CAGGGTCACCCTTGGGACTCCGG - Intronic
982215452 4:153079435-153079457 CGGGGACACTCTTGGGATTTTGG - Intergenic
983775275 4:171598370-171598392 CTGCATCACCCATGGGACTTGGG - Intergenic
989963800 5:50445579-50445601 CGGGGTCCTCCATGGCGTTTGGG - Intergenic
997475143 5:134138388-134138410 CGGGGTCACCCATGGGATTTAGG - Intronic
1003902898 6:10671462-10671484 CGGGGTCTCATCTGGGATTTCGG + Exonic
1009893593 6:69719968-69719990 CAGGATCACCCAGGGTATTTTGG - Intronic
1018251577 6:161877211-161877233 GGGGGACACCAGTGGGATTTGGG - Intronic
1019414858 7:922483-922505 AGGGGTCTCCCATGGCATCTTGG - Intronic
1020796985 7:12687540-12687562 GCGGGTGACCAATGGGATTTGGG + Exonic
1030406713 7:109123990-109124012 CGTGGTCAGCCATGGAACTTGGG + Intergenic
1036771506 8:11581580-11581602 CTGGGTCACCCATGACATGTGGG + Intergenic
1036784595 8:11677525-11677547 CGGGGGACCCCAGGGGATTTGGG - Intronic
1058096020 9:100861275-100861297 CGGGGTCATTCATGGGACATGGG - Intergenic
1059450758 9:114370323-114370345 CTGGGCCTCCCCTGGGATTTGGG - Intronic
1062076078 9:134590677-134590699 GGGGGTCATCCATGGGTTTGGGG + Intergenic
1189144021 X:38637469-38637491 CTGGGCCACCCAAGGGATCTGGG - Intronic
1189192764 X:39124971-39124993 CGGTGCCACCTCTGGGATTTTGG - Intergenic
1190254772 X:48754239-48754261 CAGGGTCACACAGGGGGTTTGGG - Intergenic
1195922088 X:109994061-109994083 TGGGGTCAGCCATGGCATTCTGG + Intergenic
1197448488 X:126581137-126581159 CGGGGCCACCCCTGGGATAGGGG + Intergenic
1197566057 X:128088336-128088358 CTGGGGCACACATGGGGTTTGGG - Intergenic
1199205099 X:145139563-145139585 AGGGATCACCCATTGGATTTTGG - Intergenic