ID: 997477069

View in Genome Browser
Species Human (GRCh38)
Location 5:134149450-134149472
Sequence TTTCACATGGGACAGCCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997477064_997477069 26 Left 997477064 5:134149401-134149423 CCTCAATAGGTCAGTCAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997477069 Original CRISPR TTTCACATGGGACAGCCACT GGG Exonic
900555897 1:3280319-3280341 TGTCCCCTGAGACAGCCACTGGG - Intronic
905973404 1:42157440-42157462 GTTCAGATGGCACAGCCTCTTGG - Intergenic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
909969187 1:81959095-81959117 TTTAATATGGTACAACCACTTGG - Intronic
911935124 1:103960416-103960438 TTGGACATGGGACAACAACTTGG - Intergenic
912138093 1:106685688-106685710 TTCCATAGGGGACAACCACTGGG - Intergenic
914460654 1:147880316-147880338 TTTCAAATGGTACAGCCACTTGG - Intergenic
915239138 1:154507399-154507421 TTTCACATTGAACAGAAACTGGG - Intronic
916828546 1:168466997-168467019 TTTCACAGGGGAGAGAGACTGGG + Intergenic
918463169 1:184796316-184796338 TTTAACATGGGACAGGCCCTGGG + Intronic
918654205 1:187003648-187003670 TTGCACATGGGACAGCCTACAGG - Intergenic
918762965 1:188437611-188437633 ATACACATGGGACAGCTCCTAGG - Intergenic
918823287 1:189287466-189287488 TTTGAATTGGTACAGCCACTTGG - Intergenic
918938455 1:190955812-190955834 TTTCACAAGGGACAGAAAGTAGG + Intergenic
920212472 1:204338266-204338288 TTACATATGTGGCAGCCACTGGG - Intronic
920732223 1:208497745-208497767 TTTAACATGCCTCAGCCACTTGG - Intergenic
921929954 1:220747097-220747119 TTTCACAAGGAACAGCCAAAGGG + Intergenic
923023800 1:230188336-230188358 TTCCAGCTGGGACTGCCACTTGG - Intronic
1067920942 10:50456683-50456705 TTTCACATGGGCCAAACCCTGGG - Intronic
1070902919 10:80046493-80046515 TATCACTTTGGACAGCCAATTGG - Intergenic
1072209854 10:93236507-93236529 TTTCAAATGTCACAGACACTGGG + Intergenic
1072816432 10:98513811-98513833 TGTCAAATGGTACAGCCACTAGG + Intronic
1073729875 10:106274837-106274859 TTTCACATAGTACACCCACTGGG + Intergenic
1074430626 10:113391101-113391123 TTTCACAAAGGCCAGCCACTTGG + Intergenic
1076609443 10:131712132-131712154 TGTCAAATGGCACAGCCTCTTGG - Intergenic
1077317120 11:1924594-1924616 TTTCTCTTGGGGCAGCCACGTGG + Intronic
1081875472 11:46405381-46405403 TTTACCATGTGTCAGCCACTTGG - Intronic
1082703669 11:56465812-56465834 CTTCACATGCAACAGCCATTGGG - Intergenic
1084324784 11:68393838-68393860 AGCCACATGGGACACCCACTAGG - Intronic
1085508824 11:77075025-77075047 TTTCCCATGTGGCAGCCACATGG + Intronic
1086056252 11:82650790-82650812 TTTCACATTGATCAGTCACTGGG - Intergenic
1086195368 11:84132252-84132274 TTTCACATTGGATTACCACTGGG + Intronic
1089614355 11:119686898-119686920 TTTCCCATGTGCCAGGCACTGGG - Intronic
1090534438 11:127625320-127625342 TTTCACTTGAGACACCCACCAGG - Intergenic
1090698206 11:129269920-129269942 TGTAAAATGGCACAGCCACTTGG + Intronic
1091262250 11:134244010-134244032 TTCCACATGGAACAGCCTGTGGG - Intronic
1091795927 12:3297524-3297546 TTTCTCTTGGGAAAGCCACTAGG + Intergenic
1092808003 12:12244982-12245004 TGTAAAATGGTACAGCCACTTGG + Intronic
1099743153 12:86668170-86668192 TTTAACATGCCTCAGCCACTTGG + Intronic
1104378747 12:128288534-128288556 TTTTCCCTGGGACAGCCACATGG + Intronic
1104419173 12:128621112-128621134 GTTCACATGGGCCAGCCCCCAGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1114509654 14:23247859-23247881 TGTAAAATGGTACAGCCACTTGG - Intronic
1115745299 14:36430371-36430393 TTTCACCTGCGAAAGCCGCTGGG - Intergenic
1119552205 14:75523156-75523178 TTTCCCAGGAGACAGCCAATAGG + Intronic
1119785940 14:77314373-77314395 TTTCTCATGGCACAGCAAGTGGG - Intronic
1122202408 14:100130564-100130586 TCTCACTTGGGTCAGCCAATTGG - Intronic
1123631412 15:22262697-22262719 CTTCACACGGGAACGCCACTCGG - Intergenic
1124512386 15:30338210-30338232 TTCCAGATGGGACAGCCCGTAGG + Intergenic
1124730528 15:32192541-32192563 TTCCAGATGGGACAGCCCGTAGG - Intergenic
1125315134 15:38423203-38423225 TGTAAAATGGCACAGCCACTGGG - Intergenic
1127083668 15:55405398-55405420 TGTGACATGTGACAGCTACTGGG + Intronic
1127841409 15:62835375-62835397 TTTCATATGTGGGAGCCACTAGG - Intronic
1130791702 15:87162244-87162266 TTTAACATGAGACAGTCCCTTGG + Intergenic
1130906143 15:88241989-88242011 TCTCTGATGGGCCAGCCACTTGG - Intronic
1135817606 16:25649834-25649856 TTTCTGATGGGACAGCCAGAAGG + Intergenic
1136364525 16:29803543-29803565 TTTCACATCGCACAGTCACAGGG + Exonic
1137570188 16:49560317-49560339 TGTCAACTGGGAGAGCCACTTGG - Intronic
1140417618 16:74787361-74787383 GTGCAGATGGGACTGCCACTTGG - Intergenic
1140618580 16:76697983-76698005 TGTAAAATGTGACAGCCACTTGG - Intergenic
1141210268 16:81973237-81973259 TTTAACATGCCTCAGCCACTTGG + Intergenic
1147384783 17:40074697-40074719 GTTCAGATGTGACAGGCACTTGG + Intronic
1148842790 17:50509396-50509418 TTGCACCTGGGAGAGCCACAGGG + Intronic
1151696866 17:75722282-75722304 TTTCCCATGGCTCAGCCTCTGGG + Intronic
1157139285 18:45089508-45089530 ATTCTCATGGGACACCTACTAGG - Intergenic
1158458137 18:57625199-57625221 GTTCACATGAGTCAGCCTCTGGG - Intergenic
1158983059 18:62784129-62784151 CTTCACATGGGGCAGACAGTGGG + Intronic
1159514101 18:69435242-69435264 TTGCACATTGGCCAGTCACTAGG + Intronic
1162747613 19:12807442-12807464 TGTCACATGATACAGCCACTGGG + Exonic
1163028017 19:14524900-14524922 TTTCACATGGGTATCCCACTGGG - Intronic
926170303 2:10548921-10548943 TTCCAGATGGGACATCCACCCGG - Intergenic
926386481 2:12340325-12340347 TCACTCATGGGACAGCAACTGGG - Intergenic
930504442 2:52264502-52264524 TTGCACATGGGACAGCCCTTGGG - Intergenic
933420939 2:82044026-82044048 TGTTGCATGGGACAGCCACCTGG - Intergenic
934058492 2:88272459-88272481 ATTCACCTGGGAGAGGCACTGGG - Intergenic
934985121 2:98879672-98879694 GTGCACCTGGGACAGCTACTCGG - Intronic
935284398 2:101551187-101551209 TTACACAGGTGACAACCACTAGG + Intergenic
936028838 2:109054880-109054902 ATGCACATGGGACAGGCAATAGG + Intergenic
938099867 2:128491349-128491371 CTGCACATGGGACAGTCCCTTGG - Intergenic
939257992 2:139769706-139769728 TTTAACATAAGACAGCCCCTAGG - Intergenic
940318611 2:152350318-152350340 TTGCCCATGGGACAGCCTCAAGG + Intronic
940363108 2:152816774-152816796 TTTCATATGCTGCAGCCACTGGG + Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
943625896 2:190198981-190199003 TTTCACAGGGAACAGTCAATAGG + Intronic
947743295 2:232494761-232494783 TTCCACCTGTGACAGCCTCTTGG + Intergenic
948432888 2:237931277-237931299 TTTAACATGGTAAAGCCACAGGG + Intergenic
1175226715 20:57448860-57448882 TTTCACCTGGCTCAGCCACCAGG + Intergenic
1178120248 21:29462248-29462270 TTTCATATGAGACAGCCCATGGG + Intronic
1178252642 21:31019324-31019346 TGTGACATGGGAAAACCACTGGG - Intergenic
1179432975 21:41337459-41337481 TTTCACAGGGGTCAGCAATTTGG - Intronic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1180882422 22:19215433-19215455 TTCCGCATGGGCCAGCCACCTGG - Intronic
1182760705 22:32720435-32720457 TCTCACATGGGCAAGTCACTTGG - Intronic
953162933 3:40438388-40438410 TTTCTCATAGGGGAGCCACTAGG + Intergenic
955839096 3:63092642-63092664 TTACACCTGGCACACCCACTTGG + Intergenic
959468617 3:106721077-106721099 TTAGACATGGGACAGGAACTTGG - Intergenic
960990407 3:123306647-123306669 TGTAAAATGGGGCAGCCACTGGG + Intronic
961630917 3:128297708-128297730 TTTAGCATGGGAGAGCCAGTGGG - Intronic
962662329 3:137615889-137615911 CTCCACATAGGACAGTCACTGGG + Intergenic
965386032 3:168047751-168047773 TTACATTTAGGACAGCCACTGGG - Intronic
966548178 3:181174723-181174745 TTTCTCATGTAACAGCCATTGGG - Intergenic
970433266 4:16008351-16008373 TTTCTAATGGGACAACCAGTGGG + Intronic
971611600 4:28732342-28732364 TTTGGCATGGCTCAGCCACTTGG - Intergenic
973003576 4:44982613-44982635 TTTCACATGAGACACTCACATGG + Intergenic
973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG + Intergenic
973987772 4:56372217-56372239 TTTCACCTGGGACAGTCTCATGG + Intronic
975210753 4:71697239-71697261 GCTCACATGGGACAGCCAGAAGG - Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
982594935 4:157369519-157369541 TTTCAGATGGGATAGCCTCAGGG + Intergenic
982938007 4:161509589-161509611 TTTCACAGGGTACAGTGACTTGG + Intronic
983753711 4:171307276-171307298 TTTAAAATGGTATAGCCACTTGG - Intergenic
984640205 4:182156846-182156868 TTTCCCAGGACACAGCCACTTGG - Intronic
985811595 5:2094216-2094238 TTTCACATGGGAGAGCGTCCTGG + Intergenic
987305278 5:16631795-16631817 GGTCACTTGGGACAGACACTTGG + Intergenic
990661477 5:58020304-58020326 TTTCACATGGCACACACAGTAGG - Intergenic
994549301 5:101209874-101209896 TTAAAAATGGTACAGCCACTTGG + Intergenic
995301855 5:110594237-110594259 TTTCTCATGGTACAGTCCCTCGG - Intronic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
998910301 5:146952520-146952542 TTTCAGATGGGACAGTCAATTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999425850 5:151487365-151487387 TTTCAGATGTGAGAGCCAGTGGG + Intronic
1001893123 5:175355981-175356003 TTTCACTTGGGACCTCCAATAGG - Intergenic
1003980608 6:11386553-11386575 TTTCACATGAAACAGCAACTTGG + Intergenic
1004987584 6:21100111-21100133 TTTCACAGGGGACAGAGAGTGGG - Intronic
1006147812 6:31969708-31969730 TTTTACATGGGGCATTCACTGGG - Exonic
1007041620 6:38727366-38727388 TTACACTTGGTTCAGCCACTGGG + Intronic
1012316857 6:97791440-97791462 TGTCATGTGGGACAGCCACCCGG + Intergenic
1012923469 6:105244337-105244359 TTTCCCATGGCCCAGGCACTGGG - Intergenic
1016220732 6:141667554-141667576 TTTAACATGCCTCAGCCACTTGG + Intergenic
1017708451 6:157146106-157146128 ACTGACTTGGGACAGCCACTGGG - Intronic
1017722779 6:157255570-157255592 TTTCATGTGGGGCAGCCACGGGG - Intergenic
1018305978 6:162455663-162455685 TTTCAAATCAGACAGCCAATAGG - Intronic
1023029341 7:36079129-36079151 TTTCACATGGTACAGGCCCCAGG + Exonic
1023648488 7:42344159-42344181 TTGCACATGAGAAACCCACTGGG + Intergenic
1025858314 7:65303714-65303736 TTGCACATGGAATAGCCCCTGGG - Intergenic
1026032125 7:66803440-66803462 TTGCACATCGGCCAGCAACTTGG - Intronic
1031103372 7:117509751-117509773 AGTCACATTGGACAGCAACTGGG - Intronic
1032429086 7:131846340-131846362 ATTCCCATGGTACATCCACTAGG + Intergenic
1033679694 7:143582516-143582538 TTTAGCATGCCACAGCCACTTGG + Intergenic
1033692141 7:143746927-143746949 TTTAGCATGCCACAGCCACTTGG - Intergenic
1034302994 7:150032453-150032475 GGTCACATGGCCCAGCCACTTGG - Intergenic
1034803053 7:154064815-154064837 GGTCACATGGCCCAGCCACTTGG + Intronic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1037732520 8:21539727-21539749 TGTGAAATGGTACAGCCACTTGG - Intergenic
1040531041 8:48266518-48266540 TTTCACATGGGACTCACCCTGGG + Intergenic
1045014451 8:97987712-97987734 TTTACCATGGGACAGGCACTAGG - Intronic
1049586900 8:143436489-143436511 TGACACACGGCACAGCCACTCGG - Intergenic
1049627790 8:143633814-143633836 GTCCACATGGGCCAGGCACTGGG + Intergenic
1052202170 9:25796456-25796478 TTTCACAGGGGATGGTCACTGGG - Intergenic
1052614681 9:30822322-30822344 TTTAAGATGGCACAACCACTTGG - Intergenic
1055880593 9:80997678-80997700 TTTAAAATGGTACAACCACTTGG + Intergenic
1056082144 9:83106549-83106571 TGTTACATGGGTCATCCACTTGG - Intergenic
1058459441 9:105169438-105169460 TTTCATATGTGCCAGGCACTGGG + Intergenic
1059597914 9:115743400-115743422 ATTCAAAGGGGACAGCTACTTGG + Intergenic
1059739605 9:117136806-117136828 TTGAACGTGGGACAGGCACTGGG + Intronic
1060193857 9:121610348-121610370 CTTCCCATGGACCAGCCACTCGG + Intronic
1060824277 9:126679008-126679030 TATCAGCTGGGTCAGCCACTTGG + Intronic
1062549364 9:137078823-137078845 TGTCACATGGTACACCAACTGGG + Intronic
1186834642 X:13425438-13425460 TTTAACATGGTACAGCCCCATGG - Intergenic
1187950058 X:24462766-24462788 TTTCACTTTTGAAAGCCACTGGG + Intergenic
1190323662 X:49193383-49193405 CTTCACATCTGACAGCCCCTTGG + Exonic
1190826413 X:54022162-54022184 CTCCTAATGGGACAGCCACTGGG + Intronic
1195486366 X:105411864-105411886 TTTCACATGGAACATCCTCCAGG + Intronic
1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG + Intergenic
1198302632 X:135346249-135346271 TTTCACATAGGAGATCCTCTTGG + Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic