ID: 997477660

View in Genome Browser
Species Human (GRCh38)
Location 5:134154950-134154972
Sequence CCTTGTGAAATGCAGGTACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997477660_997477664 13 Left 997477660 5:134154950-134154972 CCCTGTACCTGCATTTCACAAGG 0: 1
1: 0
2: 1
3: 19
4: 211
Right 997477664 5:134154986-134155008 GTTACTTATACTGAAATTCATGG 0: 1
1: 0
2: 3
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997477660 Original CRISPR CCTTGTGAAATGCAGGTACA GGG (reversed) Exonic
902123870 1:14192005-14192027 CCTTGGGAAATGCAGCTGCAAGG + Intergenic
902471945 1:16654366-16654388 CATTGTGAAATACAGGTCCCCGG - Intergenic
902486858 1:16753080-16753102 CATTGTGAAATACAGGTCCCCGG + Intronic
902980635 1:20120322-20120344 CATTGTGAAAGGCAGGTTCCTGG + Intergenic
904674385 1:32189838-32189860 CCTAGAAAAATGCAGGCACATGG - Intronic
905459729 1:38114714-38114736 CCTTTTGAGATGCAGGCACTGGG + Intergenic
905744869 1:40406715-40406737 CCCTGTGAAAGTCAGGAACAGGG - Exonic
905838098 1:41147476-41147498 TTTTGTGAAATGCAGGTACTTGG + Intronic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
909654592 1:78016703-78016725 CCTTCTGAAATGCTGCTATAGGG + Exonic
910181851 1:84493055-84493077 TCTTGCACAATGCAGGTACATGG + Intronic
912981009 1:114372611-114372633 CATTGTGACATTCAGTTACAGGG + Intergenic
917338396 1:173948968-173948990 CCTTTTGAAAGCCAAGTACAAGG + Intronic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
921435735 1:215118817-215118839 AATTCTGAACTGCAGGTACAAGG - Intronic
922677834 1:227563657-227563679 CCCTGTGACCTGCAGGTACTGGG + Exonic
923377355 1:233377899-233377921 CATTGTGAACTGCACATACAAGG - Intronic
1063341241 10:5265608-5265630 CCTTGTGACATTGAGTTACAGGG - Intergenic
1064883588 10:20084568-20084590 CCTTGTGGAAGGCAGGTAGAAGG + Intronic
1066240924 10:33533973-33533995 CCTTATGACATGCAGGTGAAAGG - Intergenic
1068070571 10:52189528-52189550 TATTGTGAAATGCACATACAAGG + Intronic
1074021736 10:109591579-109591601 CCTTCTGAAATACAGGTAGCAGG - Intergenic
1074483404 10:113849681-113849703 CCTTTTGAAAGTCAGGTAGAAGG - Exonic
1074744720 10:116520838-116520860 CATTGTGAAATGCAACAACATGG - Intergenic
1075895651 10:125992290-125992312 CTTTGTCAAATTCAGGTAAATGG + Intronic
1076308473 10:129483417-129483439 ACTTGAGAAATGATGGTACAAGG - Intronic
1078367408 11:10718237-10718259 CCTTGTTACATGCAGATGCAGGG - Intergenic
1078791904 11:14551924-14551946 CCTTGTGAAATGCAGAGAAGAGG - Intronic
1079146088 11:17853353-17853375 CCTTGGGAAATACAGGAGCAAGG - Intronic
1081842249 11:46211125-46211147 TTTTGTGAAATGAAGGTAGATGG + Intergenic
1085446033 11:76601523-76601545 CCATGTGAGATGCAGTGACAAGG + Intergenic
1086486056 11:87303246-87303268 CATTGTGAACTGCGCGTACAAGG + Intronic
1086725414 11:90176613-90176635 CCTGATGATATGCAGGTACTTGG + Intronic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1088294817 11:108281366-108281388 CCTTGTGAAATGCTCTTAAATGG - Intronic
1088470125 11:110181621-110181643 CATTGTAAAATGAAGGCACAGGG - Intronic
1088962418 11:114682558-114682580 CCTTGTGACATTGAGCTACAGGG - Intronic
1090367994 11:126223999-126224021 CCTTATTAAAAGCAGTTACAGGG + Intronic
1091293521 11:134456133-134456155 CCTCCTAAAATGCAGGTAGATGG - Intergenic
1091705582 12:2691070-2691092 CTTTGTGAACTGCAGGGACGCGG + Exonic
1093708313 12:22300133-22300155 CCTCGTGAAATTGAGTTACAGGG + Intronic
1095268680 12:40190474-40190496 ACTTGTGAAATTGAGTTACAGGG - Intergenic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1101746984 12:107549968-107549990 CCAGGTGACATGCAGGTGCAAGG - Intronic
1101782354 12:107847039-107847061 CCTTGCGAACTGTAGGTGCAGGG - Intergenic
1106369793 13:29121033-29121055 CCTTGAGAAATTCAGGAAGATGG - Intronic
1107072795 13:36290059-36290081 CCTTGTGCTATGAAGTTACAGGG + Intronic
1110438542 13:75502522-75502544 CCTTGTGTCATGCAGGGACCTGG - Intergenic
1110477066 13:75928511-75928533 TATTGTGAACTGCACGTACAAGG + Intergenic
1112107581 13:96258620-96258642 CCTGGTGAATGGCAGGTAAAAGG - Intronic
1112213052 13:97400645-97400667 CTTGGTGAAATACAGTTACATGG - Intergenic
1114488080 14:23076247-23076269 CCATGTGATAGGCAGGTAGAAGG + Intronic
1116797903 14:49411566-49411588 CCTTGGGACAAACAGGTACATGG + Intergenic
1118871128 14:69743179-69743201 CCTTGTGACATTGAGTTACAGGG - Intronic
1121600196 14:95197715-95197737 CCGAGTGAAATGCAGGAGCACGG + Intronic
1122031166 14:98913741-98913763 CCTTGTGGCATGCTGGTGCAAGG - Intergenic
1124225866 15:27894318-27894340 CCCTGTGATCTGCAGGTACTGGG + Intronic
1125171376 15:36769943-36769965 CCTTATGAAATGAACCTACAGGG + Intronic
1127475304 15:59327286-59327308 CCTTTTAAAAAGCAGGTATATGG - Intronic
1128683564 15:69668008-69668030 CATGTTGACATGCAGGTACAGGG + Intergenic
1130022993 15:80246824-80246846 CATTGTAAAATGCAGATTCAGGG - Intergenic
1130101561 15:80898513-80898535 CTTTGGGACATGCAGGTAGAGGG + Intronic
1130710081 15:86271390-86271412 CCTTGTGAAAGGGAGGTAGAGGG - Intronic
1130895473 15:88167063-88167085 CCTTGTTCAATGCAGGTAACAGG - Intronic
1131432805 15:92400265-92400287 AATTGTGAAATGCATGTCCATGG - Intronic
1131723462 15:95196817-95196839 CATTATGAAAGGCAGGTAGAAGG + Intergenic
1137723097 16:50639295-50639317 GCATGTGAAATGCAGATACCAGG + Exonic
1138783872 16:59822330-59822352 CATCTTGAAATTCAGGTACATGG - Intergenic
1141340548 16:83199963-83199985 CCTAGAGAAATGAAGGCACAGGG + Intronic
1141376379 16:83534516-83534538 CTATGTGAAATGAATGTACATGG + Intronic
1142992379 17:3739985-3740007 CCCTGAGAAGTGCAGTTACAGGG + Intronic
1143316104 17:6034681-6034703 CCTCTTAAAATGCAGGTCCAGGG - Intronic
1143786733 17:9261105-9261127 CCTAGTGAAAGGCAGGTTCCTGG + Intronic
1145032129 17:19512336-19512358 CCCTTTGGAATTCAGGTACAAGG + Intronic
1145226801 17:21136363-21136385 CCTTGTGACATTGAGTTACAGGG - Intronic
1145273258 17:21415706-21415728 CCCTGTGTGATGCAGGTGCACGG + Exonic
1145311448 17:21703150-21703172 CCCTGTGTGATGCAGGTGCACGG + Exonic
1146649847 17:34599899-34599921 CCTTATAAAATGCAGGTCCCTGG - Intronic
1148218521 17:45846954-45846976 CCTTGTGAACTGGAGGCACTGGG + Exonic
1148951314 17:51315094-51315116 CCTTGTGACATTGAGTTACAGGG + Intergenic
1152354228 17:79798890-79798912 CCTTGTGAAGTTTAGGAACAAGG - Intronic
1153446674 18:5180411-5180433 CCCTGTCTAAGGCAGGTACATGG + Intronic
1155055579 18:22179430-22179452 ACATGTGAAATGCAGGTGAATGG - Intronic
1155320355 18:24612781-24612803 CATTGTGAAAGGGAGGGACATGG + Intergenic
1156263765 18:35467861-35467883 CCTGGGGAAATGCGGGTATAGGG + Intronic
1156945398 18:42823400-42823422 GCTTGTGGAATGCAGATGCATGG - Intronic
1156957933 18:42991533-42991555 CCCTGTGACCTGCATGTACAGGG + Intronic
1158574979 18:58629147-58629169 CCTGGTGAAATGCAGCCCCAGGG + Intergenic
1158838860 18:61361476-61361498 CCTTTTGAAATACATGTATAAGG + Intronic
1159761855 18:72436593-72436615 TCATGTGTAATGCAAGTACATGG + Intergenic
1160060431 18:75524741-75524763 CATTGGGAAATCCAGGTACAGGG - Intergenic
1160568286 18:79799958-79799980 CCTGGTGAAAAGCAGGTGCTTGG + Intergenic
1162057616 19:8074142-8074164 CCTAGTGAAAGGCAGGTCCTTGG + Intronic
1165140414 19:33696448-33696470 TCTTGTGAACTGCATATACAAGG + Intronic
1168438423 19:56341562-56341584 CCTTGTGACATTGAGTTACAGGG - Intronic
1202704343 1_KI270713v1_random:11160-11182 CATTGTGAAATACAGGTCCCCGG - Intergenic
925961332 2:9019634-9019656 CCTTGTAGAATGCTGGCACAGGG - Intergenic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
927644422 2:24867901-24867923 GCTTGTGAAATGAAGTTAAAAGG + Intronic
929535168 2:42778272-42778294 CCTTGTGACATTAAGTTACAGGG + Intronic
929569241 2:43009682-43009704 TATTGTGAAATGCACATACAAGG + Intergenic
933615437 2:84478415-84478437 CTTTCTGAAATGCACCTACAGGG + Intergenic
933718701 2:85382497-85382519 CCTTGTGACATTGAGTTACAGGG - Intronic
935164913 2:100562100-100562122 ACTTGTAAAATGCAGGTATTGGG - Intergenic
936453288 2:112650030-112650052 TATTGTGAAATACAGGTTCATGG - Intronic
937846510 2:126584691-126584713 GCATGTGCACTGCAGGTACAAGG - Intergenic
939427935 2:142064914-142064936 CATTGTTACATGGAGGTACATGG - Intronic
940190936 2:151039234-151039256 CCTTATGAGAGGCAGGTGCAGGG + Intronic
942439880 2:176021386-176021408 CCTTGTGCAAAACAGTTACATGG - Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
943904043 2:193475209-193475231 CCTTGTAAAAGGCAGGAGCATGG + Intergenic
946276595 2:218636371-218636393 CCTTGTTGCATGCAGGTCCAAGG - Exonic
949044854 2:241867733-241867755 CCTTATGAAATGCAGGGAGCTGG - Intergenic
1168882050 20:1215461-1215483 CACTGTGACATGAAGGTACAGGG - Intergenic
1171412231 20:24955344-24955366 CCTGGGGAAATGCAGGTTCCAGG + Intronic
1174649733 20:52114464-52114486 CCTTGTTAAATGCAGATTCAGGG + Intronic
1175562567 20:59943233-59943255 CCTTGTGAATAGCAGGTAAAGGG - Intronic
1178016504 21:28352265-28352287 CCTTAGGAAATGGAGGTCCAAGG + Intergenic
1179660730 21:42873187-42873209 CCTTGTGATTAGCAGGAACAAGG - Intronic
1181332940 22:22108330-22108352 ACCTGTGAAAAGCAGGGACAGGG + Intergenic
1182461110 22:30484747-30484769 CCTTGTTAAATGCACGCTCAAGG - Intergenic
949743276 3:7261161-7261183 CCCTGTGACCTGCAGGTACTGGG - Intronic
950531167 3:13553064-13553086 CACTGTGATATGAAGGTACAGGG + Intronic
952605299 3:35140492-35140514 GTTGGTGAAATGCAGGTAAAAGG + Intergenic
953200427 3:40773335-40773357 ACTTGTTAATAGCAGGTACAGGG - Intergenic
953794676 3:45975419-45975441 GCTTGTGAAACACAGATACAGGG + Intronic
953964549 3:47293508-47293530 CCATTTGAAGTGCAGCTACAGGG - Intronic
953980821 3:47412184-47412206 CATTGTGCACTGCAGGTAGAGGG + Exonic
954042657 3:47901027-47901049 CATAGTGAAGTGCAGGTGCATGG - Intronic
955083395 3:55678665-55678687 CCTGCTGATATGCAGGAACATGG + Intronic
955416055 3:58692022-58692044 CCTTGTGACATTGAGTTACAGGG - Intergenic
955486614 3:59440411-59440433 CCTTGTGAAATGGAGATGCCTGG - Intergenic
956661969 3:71607992-71608014 CATTATGGAATGCAGGGACAGGG - Intergenic
959612897 3:108314740-108314762 CCTTGTGAAATGGAGGTTCAAGG - Intronic
959980543 3:112511584-112511606 CCTTGTGACATTGAGTTACAGGG - Intergenic
961104760 3:124231515-124231537 CTTTGAGAGATGCAGGTCCAGGG - Intronic
962285575 3:134083414-134083436 CCTAATGAAATCCACGTACATGG + Intronic
965477987 3:169181599-169181621 CCTTGGGAAAAGCAGGTAAATGG - Intronic
965553533 3:169996402-169996424 CCTAGTAAAATTCTGGTACATGG - Exonic
966877806 3:184333363-184333385 CTTTGTGAAATGCCGGCACAGGG + Intronic
967042041 3:185702781-185702803 ACTTGTGAACTGCAGGTGGAGGG - Intronic
967174061 3:186846637-186846659 TCCTGTGAAATGCAAGGACAGGG - Intronic
969439873 4:7210697-7210719 CCCTGTAAAATGCAGGTGTATGG + Intronic
969998758 4:11342632-11342654 CATTGTGAAATGCAGGCCCTAGG + Intergenic
970351854 4:15209502-15209524 CCATGTGAAATGCAGGAAGAGGG - Intergenic
972686484 4:41358618-41358640 CATTGTGAAAGGCACGAACAAGG - Intergenic
974967783 4:68784015-68784037 CCTGGGTAATTGCAGGTACAGGG + Intergenic
976617823 4:87096112-87096134 CTTTGTGAAATGAAGGGAAAAGG + Intronic
976944228 4:90744741-90744763 TATTGTGAACTGCACGTACAAGG + Intronic
977720382 4:100232920-100232942 CCTTGTGACATTGAGTTACAGGG - Intergenic
977796763 4:101174972-101174994 CTTTGTGAAATCCATGTTCAGGG + Intronic
978013586 4:103718266-103718288 CTTTGTGAAAGGCAGTTGCATGG - Intronic
978980859 4:114943957-114943979 CTTTGGGAAATGCAAGCACAAGG + Intronic
980071668 4:128249420-128249442 ACTTGTGAAATTGAGTTACAGGG - Intergenic
980193632 4:129559195-129559217 CCTTGTGAAATGCAGCATGAGGG - Intergenic
980672023 4:136022102-136022124 TCTTATGAAAGGTAGGTACAGGG - Intergenic
982475655 4:155847299-155847321 CCTTGTGACATTAAGTTACAGGG + Intronic
983112224 4:163766385-163766407 CCTTTAGAAATGTAGGTAAAAGG - Intronic
984965504 4:185136455-185136477 CACTGTGAAATGTAGGTATATGG - Intergenic
988773965 5:34459493-34459515 CCTTGTGACATTGAGTTACAGGG - Intergenic
992608181 5:78483143-78483165 CCTTGTGCATTCCAGGTAGAAGG + Intergenic
993597193 5:89872050-89872072 TTTTGTGAAATGTAGGTAGAAGG + Intergenic
994133694 5:96261155-96261177 CCTGCTTAAATGCAGCTACAAGG - Intergenic
994856717 5:105131078-105131100 CCTTGTGATATTTGGGTACAAGG - Intergenic
994867985 5:105302947-105302969 CCTTATGAAATACAGGTAGAGGG - Intergenic
995067271 5:107876409-107876431 CCTTGTGAAAAGCAGTTGGATGG - Intronic
996331844 5:122338279-122338301 CCTTTTGAAATGCAGATAGAGGG + Intronic
997039215 5:130232380-130232402 TTTTCTGAAATGCAGTTACAAGG + Intergenic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
997871520 5:137509657-137509679 TCTTGTGAAATGAAGGGACAGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1002916076 6:1528924-1528946 CCTTGTGAAAGGGAGCTTCAGGG + Intergenic
1003301054 6:4883231-4883253 CCTTGGGAAATTCTGGGACAGGG + Intronic
1005371058 6:25133592-25133614 CCTTGTGACATTGAGTTACAGGG + Intergenic
1006412633 6:33883878-33883900 TATTGTGAAATGCATGTTCAAGG + Intergenic
1007225747 6:40312791-40312813 CCTTGTGACATGCAGGGAGATGG - Intergenic
1007980000 6:46143331-46143353 CTTTGTGAAATGCAGGTCCGTGG - Exonic
1008033167 6:46719588-46719610 CCCTGTGAATTGGAGGGACATGG + Intronic
1008541662 6:52551412-52551434 CTTTGTGAAAGGGAGGTAAATGG - Intronic
1008610267 6:53179012-53179034 CCCTGTGTAATGTAGCTACAGGG - Intergenic
1008690364 6:53971996-53972018 CCCTGGGAAGAGCAGGTACAGGG + Intronic
1008950816 6:57156863-57156885 TATTGTGAACTGCACGTACAAGG - Intronic
1009538471 6:64922783-64922805 CCTTGTGACCTGCAGGTACTGGG - Intronic
1011053192 6:83176907-83176929 CCCTGTGAAAGGCAGGCAAATGG + Intronic
1012943912 6:105446361-105446383 CCTTTTGAAAGACACGTACAAGG - Intergenic
1013235752 6:108196705-108196727 GGTTGTGAAATGCAGGTGCCAGG - Intergenic
1016270602 6:142284712-142284734 CTTTGTGAAACTCAGGTAGAAGG - Intergenic
1016429942 6:143973056-143973078 TCTTGTGAAAACCAGGCACAGGG - Intronic
1017019685 6:150130332-150130354 CCTTGAGTCAGGCAGGTACAGGG - Intergenic
1017441234 6:154466256-154466278 CCTTAGGATATACAGGTACATGG - Intronic
1019337104 7:490731-490753 CCTTCTGAAATGCAGCTGTAGGG + Intergenic
1019993189 7:4706712-4706734 CCTCGTGAAAGACACGTACAGGG + Intronic
1020340747 7:7107786-7107808 CCTTGTGACATTGAGTTACAGGG + Intergenic
1022918526 7:34987329-34987351 ACTTGTGAAATGCAGTAAAAGGG - Intronic
1024014793 7:45303555-45303577 CCTTGTGACCTACAGGTACTGGG + Intergenic
1024507200 7:50171944-50171966 CTTTGAGAACTGCAGGTACAGGG + Intergenic
1028268287 7:88756098-88756120 CCTTGTGACATGCAGATAGGAGG + Intergenic
1028439887 7:90847846-90847868 CCAGGAGAAATGCAGGTTCAAGG + Intronic
1032659045 7:133963114-133963136 CCTGGTGAAGTGCGGGGACAGGG - Intronic
1032961217 7:137036766-137036788 ACATGTGCAATGCAGGAACAGGG + Intergenic
1033936779 7:146595264-146595286 CCTTGTAAAATTCAGTTTCAAGG - Intronic
1035901131 8:3459529-3459551 ACATGATAAATGCAGGTACATGG + Intronic
1036636840 8:10556849-10556871 CCTGGTGAAGTGGAGGTAAAAGG + Intergenic
1038510381 8:28128673-28128695 ACTTGTGAAATGGAGGTAATAGG + Intronic
1039498430 8:37998587-37998609 CCTTGTGCAGTGCAGGCACTGGG + Intergenic
1041400026 8:57432960-57432982 CCTAGAGAAATGCAGGAATATGG + Intergenic
1041499621 8:58526366-58526388 CCTTGTCCAATACAGGTATATGG + Intergenic
1041651025 8:60303030-60303052 CCTTGTGACATTGAGTTACAGGG - Intergenic
1042357359 8:67843149-67843171 CCTTGTGACATTGAGTTACAGGG + Intergenic
1042852060 8:73226323-73226345 GCCTGTGAAATGCAGGGAGAGGG - Intergenic
1048919105 8:139211685-139211707 CCATGGGAAATGCAGGTCCCTGG + Intergenic
1050362472 9:4843689-4843711 TCTTGGGAAATGCAGGTAAATGG + Intronic
1050587048 9:7123779-7123801 TCTTGTCAAATTCAGGCACATGG - Intergenic
1058154556 9:101500663-101500685 CCTTTTGAAAAGAAGGTAGATGG + Intronic
1061244188 9:129392764-129392786 ACTTGTGAAATGCAGATTCCTGG - Intergenic
1185506686 X:636999-637021 CCTTTTAAAATGCAGCCACATGG - Intronic
1186457455 X:9721172-9721194 CCTTGTGAAGTACAGGAAAAGGG + Intergenic
1187817148 X:23244582-23244604 CCTTGTGACATTGAGTTACAGGG + Intergenic
1187850325 X:23585346-23585368 ACCCTTGAAATGCAGGTACAAGG + Intergenic
1188457548 X:30384110-30384132 CCTTGTGGGATGAAGCTACAAGG + Intergenic
1189704613 X:43747537-43747559 CCTTGAGTAAGGCAGGTTCAAGG + Intergenic
1190399148 X:50014285-50014307 ACTTGTGAAAGGGAGGTAGAGGG - Intronic
1191740319 X:64430473-64430495 CCTTGTGACATTGAGTTACAGGG + Intergenic
1193434537 X:81455957-81455979 GCTTTTGAAATTCAGGTAAATGG + Intergenic
1193501475 X:82280615-82280637 CCTTGTGACATTGAGTTACAGGG + Intergenic
1193847899 X:86497486-86497508 CCTTGGGAAGAGCAGGTACAGGG + Intronic
1194405672 X:93493679-93493701 CCTTGTGACCTGCAGGTATTGGG + Intergenic
1195150495 X:102064176-102064198 CCTTGTGACATTGAGTTACAGGG + Intergenic
1196611721 X:117722551-117722573 GCTTATGAAATGGAGGTACCAGG + Intergenic
1200875820 Y:8153823-8153845 CCTCATGATATGCAGGTAAAAGG - Intergenic
1201941685 Y:19466977-19466999 CCTTGAGAAAAGCAGGTAGGTGG + Intergenic