ID: 997479789

View in Genome Browser
Species Human (GRCh38)
Location 5:134176624-134176646
Sequence CCGTGAGGACGCCCGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997479785_997479789 3 Left 997479785 5:134176598-134176620 CCGGGGTTCGGCTCACTTATGGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
997479783_997479789 4 Left 997479783 5:134176597-134176619 CCCGGGGTTCGGCTCACTTATGG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
997479776_997479789 24 Left 997479776 5:134176577-134176599 CCGGTGCAGAGAAGGCCCAGCCC 0: 1
1: 0
2: 3
3: 35
4: 301
Right 997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
997479781_997479789 9 Left 997479781 5:134176592-134176614 CCCAGCCCGGGGTTCGGCTCACT 0: 1
1: 0
2: 0
3: 10
4: 72
Right 997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
997479782_997479789 8 Left 997479782 5:134176593-134176615 CCAGCCCGGGGTTCGGCTCACTT 0: 1
1: 0
2: 0
3: 1
4: 54
Right 997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997479789 Original CRISPR CCGTGAGGACGCCCGGCCAG AGG Intronic
900099249 1:954101-954123 CCGTGGGGCCTCCCAGCCAGGGG - Intronic
906318652 1:44803670-44803692 CCATCAGGATGCCAGGCCAGAGG + Exonic
921556172 1:216601166-216601188 CCGGGCGGGCGCTCGGCCAGGGG + Intronic
922025248 1:221743117-221743139 GCCCCAGGACGCCCGGCCAGGGG - Intergenic
922753391 1:228081637-228081659 CAGTGAGGACGCCCTGCCCAAGG + Intergenic
1067142326 10:43667925-43667947 GCGGGAGGACGCCCCGCGAGTGG + Intergenic
1069815302 10:71190150-71190172 CCGTGGTGACCACCGGCCAGCGG - Intergenic
1070353074 10:75611908-75611930 CAGGGAGGACACCCAGCCAGGGG - Intronic
1072407418 10:95168467-95168489 CCCTGAGGAGGCCAGGACAGAGG + Intergenic
1076849615 10:133086548-133086570 CCATGGGGACCCCCGGCCTGGGG + Intronic
1077230231 11:1455372-1455394 CAGGGAGGGCGCCCGGGCAGTGG - Intronic
1077268631 11:1664879-1664901 CTGTGAGGAACCCCGGCCAGAGG - Intergenic
1077272144 11:1686424-1686446 CTGTGAGGAACCCCAGCCAGAGG + Intergenic
1078225127 11:9384846-9384868 AAGTAAGGACGCCCGGCTAGCGG + Exonic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1090922093 11:131215526-131215548 TCGTGAGCACGCCTGGCCAAGGG + Intergenic
1103749978 12:123151570-123151592 CCCTCAGGACGCCCGGGCCGCGG + Intergenic
1105704304 13:22960090-22960112 CCGTGGGGACGCCAGTCAAGGGG + Intergenic
1110630004 13:77697570-77697592 CCGTGGGGAAGCCCACCCAGGGG - Intergenic
1112200422 13:97268970-97268992 CCGTGAGGAGGGCCTGCCGGAGG + Intronic
1121302268 14:92881185-92881207 CCCTGAGGACACCAGGCCAGAGG - Intergenic
1122549150 14:102540426-102540448 CCGGCAGGAGGCCCGGCTAGGGG + Intergenic
1123117537 14:105901465-105901487 CCCTGAGGAGGTCCTGCCAGGGG - Intergenic
1124964635 15:34423896-34423918 ACGTGAGGACCCCCAGGCAGTGG - Intronic
1124981252 15:34570122-34570144 ACGTGAGGACCCCCAGGCAGTGG - Intronic
1128265720 15:66265224-66265246 CCGTGAGGGAGCCAGGCAAGCGG - Intergenic
1133078080 16:3295296-3295318 GCGGGAGGAGGACCGGCCAGAGG - Intronic
1136288862 16:29259801-29259823 CCCTGAGAACGCCCTGCCTGGGG + Intergenic
1136377325 16:29873100-29873122 CCGTGAGGACACGAGGCCACAGG + Intronic
1139666946 16:68463955-68463977 CCGTGGGAAAGCCAGGCCAGAGG - Intergenic
1142094589 16:88232708-88232730 CCCTGAGAACGCCCTGCCTGGGG + Intergenic
1142188484 16:88706150-88706172 ACGTGAGCGCGCCCGCCCAGGGG - Exonic
1143913990 17:10275556-10275578 GCGTGAGGAAGCCGGGCCTGGGG + Intergenic
1146263903 17:31438537-31438559 ACAGGAGGACGCCCGGTCAGTGG - Intronic
1147421280 17:40323291-40323313 GCGAGAGGAACCCCGGCCAGAGG - Intronic
1147442005 17:40453121-40453143 CCGGGAGGATGCCCGGCCTGTGG + Exonic
1148021818 17:44558285-44558307 CCTTGAGGACGCGCGGGCAGTGG - Exonic
1151396731 17:73827686-73827708 CCATGAGGTTGCCTGGCCAGCGG - Intergenic
1151419971 17:73990828-73990850 TCAGGAGGAGGCCCGGCCAGGGG - Intergenic
1151757127 17:76081452-76081474 GAGTGAGGATGCACGGCCAGAGG + Intronic
1152222144 17:79074815-79074837 CCGAGCTGACTCCCGGCCAGCGG - Intergenic
1157279170 18:46334435-46334457 CCGCGAGGACGCAGGGCGAGCGG + Intronic
1160717879 19:584604-584626 CCGTCAGGCTGCCCGGGCAGAGG - Intergenic
1161766308 19:6210894-6210916 ACGTGAGGCCTTCCGGCCAGAGG + Intergenic
1162480285 19:10923554-10923576 CCGTGAGGACACCAGGCTGGTGG - Exonic
925230868 2:2232844-2232866 CCATGAGGACGCAGGGCCTGAGG - Intronic
926047527 2:9720733-9720755 CCTTGAGGACCACAGGCCAGGGG + Intergenic
936283942 2:111166356-111166378 CCTGGAGGCCGCCAGGCCAGAGG - Exonic
942446119 2:176080131-176080153 CCGTGAGCCCGCCGGACCAGAGG - Exonic
1172916956 20:38450426-38450448 CCATGAGGAGGCCCCTCCAGGGG - Intergenic
1174420216 20:50394581-50394603 CAGTGAGGACCCCCTGCCTGTGG + Intergenic
1175890452 20:62313628-62313650 CGGTGAGCCCGCCCGGCCTGGGG - Exonic
1176273971 20:64253191-64253213 CTGTGAGGAGGCCAGGGCAGAGG + Intergenic
1178416867 21:32411890-32411912 ACGTTCGGACGCCCAGCCAGTGG - Intergenic
1178931303 21:36820997-36821019 ACGTGAGGGTGCCCGGCAAGAGG + Intronic
1181496018 22:23287963-23287985 CCGTGAGCACACCTGGCCACTGG + Intronic
1181944917 22:26509064-26509086 CTGTGAGGAGGCCAAGCCAGTGG - Intronic
1183577532 22:38701226-38701248 CCCTCAGGCCGCCCCGCCAGGGG - Intronic
1185344942 22:50307049-50307071 CCGCGAGGAGGCCCAGGCAGTGG + Intronic
1185368075 22:50446065-50446087 CTGTGACGAGGCCTGGCCAGGGG - Exonic
951558540 3:23944970-23944992 TGGAGAGGACTCCCGGCCAGAGG + Intronic
961385584 3:126521637-126521659 CCAGGAGGACCCCAGGCCAGAGG + Intergenic
975701992 4:77075716-77075738 CCATGATGACCCCCGGCCTGAGG + Exonic
985807878 5:2060471-2060493 CCGTGAGGACGCTTGGAGAGGGG - Intergenic
986286977 5:6366400-6366422 CCCTGAGGACGCTCTGCCAGAGG - Intergenic
990825540 5:59893785-59893807 CCGAGAGGGGGCCCTGCCAGCGG + Exonic
997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG + Intronic
998951470 5:147396490-147396512 CAATGAGGACGCGCTGCCAGAGG + Intronic
999144041 5:149381008-149381030 CAGCCAGGCCGCCCGGCCAGTGG - Intronic
1019449349 7:1088820-1088842 CAGTGAGGACGTGGGGCCAGTGG + Intronic
1024920233 7:54546583-54546605 CCGTGCGGACGCGCGCCCGGAGG - Intronic
1026984185 7:74544765-74544787 GAGTGAGGACGCGCGGCCCGAGG + Exonic
1028497091 7:91474058-91474080 CCCTGAGGAAGCCCAGCCATTGG + Intergenic
1035297537 7:157875831-157875853 CCCTGGGGACGCCTGGCCTGGGG - Intronic
1035753051 8:2009078-2009100 CCGTGACGACACCCAGCCATCGG + Intergenic
1039595509 8:38787308-38787330 CCGGGAAGACGCCCGTCCTGTGG - Exonic
1041275949 8:56157467-56157489 CCGGGCGGACGCCGGGCCAGGGG - Intergenic
1053306282 9:36986657-36986679 CCCCGAGGACTCCCGGCCGGTGG + Intronic
1061946074 9:133908707-133908729 GCGTGGGGACGCCCTCCCAGCGG - Intronic
1062394020 9:136345476-136345498 CCATGAGGGCGCCCGCCCTGGGG + Intronic
1185788418 X:2909905-2909927 CCGGGAGCACCCCCGGCCAGTGG + Exonic
1185792524 X:2938183-2938205 CCGGGAGCACCCCGGGCCAGCGG + Exonic