ID: 997479855

View in Genome Browser
Species Human (GRCh38)
Location 5:134176878-134176900
Sequence GGCTCTCGTCAGCCTCCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997479855_997479859 -5 Left 997479855 5:134176878-134176900 CCGGCGGGAGGCTGACGAGAGCC 0: 1
1: 0
2: 2
3: 8
4: 111
Right 997479859 5:134176896-134176918 GAGCCGGGAGGCGTTAGCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997479855 Original CRISPR GGCTCTCGTCAGCCTCCCGC CGG (reversed) Exonic
900099842 1:957173-957195 GGCTCTGGTCATTCTCCTGCAGG + Exonic
915322693 1:155064244-155064266 GGCGATCCCCAGCCTCCCGCAGG + Intronic
916751035 1:167722536-167722558 GGCTCACCGCAGCCGCCCGCCGG - Intronic
922752533 1:228077257-228077279 TGCCCTGGTCAGCCTCCTGCTGG + Intergenic
924645269 1:245871849-245871871 GACTCTAGTCAGCCTCCTGTTGG - Intronic
1063632787 10:7749709-7749731 GGCTCACTTCAGCCTCAAGCTGG + Intergenic
1064376603 10:14802023-14802045 GACTCTCCTGAGCCTCTCGCTGG - Intergenic
1067051629 10:43024883-43024905 GGCTCTGGGCAGGCTCCCGGGGG - Intergenic
1067837556 10:49651010-49651032 GGCTCTCCTCAGCCTCTGGAGGG - Intronic
1071292110 10:84195555-84195577 GGCTCTGTTCAGCCTCCCAGAGG + Exonic
1072583151 10:96757723-96757745 TGCCCGCCTCAGCCTCCCGCTGG - Intergenic
1076503784 10:130958143-130958165 GGCCCCCATCAGCCCCCCGCTGG + Intergenic
1077637656 11:3854937-3854959 GGCCCTCGTGGGCCTCCCCCGGG + Intronic
1078000216 11:7488309-7488331 TGCACTCGTCAGCCTCTCGAAGG - Exonic
1078315931 11:10293729-10293751 GGGTCTCGCGACCCTCCCGCTGG - Intronic
1084179332 11:67438674-67438696 GGCTCTGGCCAGGCTGCCGCTGG + Exonic
1084195047 11:67519838-67519860 GGATCTCGTCCACCTCCCGCTGG + Exonic
1084723763 11:70926964-70926986 GTCTCTCTTCTGCCTCCTGCTGG + Intronic
1085347331 11:75776666-75776688 GGCTCCCGTAAGCCTCACACAGG - Intronic
1085485735 11:76861220-76861242 CGCTCCTCTCAGCCTCCCGCTGG - Intronic
1086322402 11:85664596-85664618 GGCGATCGCCAGCCTCCCGGGGG - Exonic
1091290506 11:134436906-134436928 GGCTGGCGTCACCCTCCCTCTGG - Intergenic
1092225975 12:6748687-6748709 GGCTCAGTTCAGGCTCCCGCAGG - Intronic
1092719936 12:11431693-11431715 GCCTCTCTTCTGCCACCCGCTGG + Intronic
1093264681 12:16989080-16989102 AACTCTAGTCAGCCTCCGGCCGG + Intergenic
1096552182 12:52380364-52380386 GGCTCTCCTCGCCCTCCAGCAGG + Exonic
1096983730 12:55743376-55743398 GGCCCTCGGCCGCCTCCCCCCGG - Exonic
1100892963 12:99146589-99146611 AGCTCTCGTCAGACTCCTGAAGG + Intronic
1104942089 12:132399917-132399939 GGCGCACGTCTCCCTCCCGCTGG - Intergenic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105541416 13:21320262-21320284 GGCGCTAGGCTGCCTCCCGCAGG + Intergenic
1106576347 13:30979126-30979148 GGATTCTGTCAGCCTCCCGCTGG + Intergenic
1110971908 13:81774503-81774525 GGCTCACTTCAGCCTCCTCCTGG + Intergenic
1114494145 14:23121033-23121055 GGCTCTCGGCAGGCTCCTGCGGG + Intergenic
1114553925 14:23550892-23550914 GGGTCTCGGCGGCCCCCCGCCGG - Intronic
1122635869 14:103129418-103129440 GGCTCCCATCAGCTCCCCGCTGG - Intronic
1125760902 15:42094756-42094778 GGGACTCGTCTGCCTCCCCCTGG - Intergenic
1127165691 15:56243549-56243571 GGCGCCCCTCAGCCCCCCGCTGG + Intergenic
1128343947 15:66842282-66842304 TGCCCTCCCCAGCCTCCCGCGGG - Intergenic
1128535275 15:68485757-68485779 GGCTCTTGGCAGCCTGCAGCTGG + Intergenic
1132556318 16:574281-574303 GGCTCTCCTCGGGCTCCTGCCGG - Exonic
1133048933 16:3105848-3105870 GGCTATCCTCACGCTCCCGCAGG - Intergenic
1139721514 16:68859746-68859768 GGCTCTGGAAAGCCTCCCCCAGG - Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1143758673 17:9085272-9085294 GGCTATCCTCAGCTTCCCGATGG + Intronic
1147162495 17:38576369-38576391 AGCTCTGGTCACCCTCCTGCTGG + Intronic
1147442342 17:40454791-40454813 GGCTCTGGTGTGCCTCCTGCTGG + Intronic
1152237967 17:79148285-79148307 GCCTCTCGGCTGCCTCCTGCAGG + Intronic
1152419420 17:80184076-80184098 GGCTGTGGTCAGCCTCCAGCTGG - Exonic
1152623761 17:81379218-81379240 GGAACTCGTCAGCCTCCTGCTGG + Intergenic
1152684725 17:81688392-81688414 GGTTCCCGTCAGCCTCCAACAGG - Intronic
1153336518 18:3931163-3931185 GGCTCCCTTCAGCTTCTCGCCGG + Intronic
1154294291 18:13136009-13136031 GGCCCTAGTCAGCCTTCCCCAGG - Intergenic
1156133619 18:34008268-34008290 GGCTTTCCTGAGCCTCCAGCTGG + Intronic
1159438674 18:68449612-68449634 GGCTCTCCTCAGACTCCATCTGG + Intergenic
1160583463 18:79900407-79900429 GGCCCTTGTCACCCTCCCGGAGG - Intergenic
1161532800 19:4800336-4800358 GGCTCTCGACACCTTCCAGCAGG - Exonic
1161672688 19:5622971-5622993 GCGTCTCGTCAGCCTCCCGCCGG - Exonic
1165230550 19:34383852-34383874 GGCTCTCACCAGGCTCCCTCAGG + Intronic
1165721516 19:38082516-38082538 GGCCCTCGTCGGCCTCCCCCGGG - Exonic
1168667655 19:58216889-58216911 GGCCCTGGTCAGCCTCCCCAGGG - Intergenic
927553360 2:24017095-24017117 GGCACTCGCCAGCCTTGCGCGGG + Intronic
927961463 2:27242853-27242875 GGCTCTCCTCACCCTCCAGGAGG + Exonic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
931509543 2:62975650-62975672 GGCTCAAGTCATCCTCCCACTGG - Intronic
938303057 2:130229624-130229646 GGCTCTGGTCATTCTCCTGCAGG - Intergenic
938453613 2:131444598-131444620 GGCTCTGGTCATTCTCCTGCAGG + Intergenic
939163060 2:138611738-138611760 GGCCCTCCTCAGCCTCCCAAAGG + Intergenic
947616092 2:231557714-231557736 GGCTCTCATCTGCGTCCAGCAGG + Intergenic
949046042 2:241873118-241873140 GGCGCTCGTCTTCCTCCCGGCGG - Exonic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1174347849 20:49944311-49944333 GGCCCACCTCAGCCTCCCTCAGG + Intronic
1181534150 22:23533102-23533124 TGCCCTCGGCAGCCTCCCCCTGG - Intergenic
1185224912 22:49646950-49646972 GGCTCTCGTCTCCCTGCCCCGGG - Intronic
954677824 3:52325377-52325399 GGCTCTGGGCAGCCTCCTGATGG - Intronic
956719343 3:72104149-72104171 GTCTCTGGTCAGTCTCCAGCTGG - Intergenic
961098830 3:124180984-124181006 TGCTCACCTCAGCCTCCCGAAGG - Intronic
962815551 3:138994632-138994654 GGATCTCCTCAGACTCCCTCAGG + Intergenic
964344457 3:155742495-155742517 GCCTCTCCCCAGCCTCCCCCAGG + Intronic
967738744 3:192982342-192982364 TGCCCTCATCAGCCTCCCGTTGG + Intergenic
968523517 4:1045192-1045214 GGCTCTGGTCATCCTCACCCTGG + Intergenic
969872943 4:10116208-10116230 GGTGTTCGCCAGCCTCCCGCAGG - Exonic
981301074 4:143185813-143185835 GGATCTCTTTAGCCTCCTGCAGG + Exonic
985573696 5:664007-664029 GGCTCTGCTCAGCCCCCTGCTGG + Exonic
986165411 5:5268301-5268323 GCCTCACGTCAGCCTCCTTCAGG + Intronic
988690177 5:33564083-33564105 GGCTGTGGACAGCCTCCCACAGG + Intronic
992272596 5:75080888-75080910 GGCTTTCATCAGCCTACCTCAGG - Intronic
992712130 5:79469740-79469762 CTCTCACCTCAGCCTCCCGCTGG + Intronic
997479855 5:134176878-134176900 GGCTCTCGTCAGCCTCCCGCCGG - Exonic
998419258 5:141968997-141969019 GCCTCTCGGGCGCCTCCCGCAGG - Intronic
1001568510 5:172715468-172715490 GGCTCTGGCCAGCATCCCCCTGG + Intergenic
1004579001 6:16929251-16929273 CGCTCTCCTCAGCCTCCCAGAGG + Intergenic
1006373527 6:33659444-33659466 GGGTCTTGTCACCCTTCCGCAGG + Exonic
1011882041 6:92040794-92040816 GGCTATAGTCAGCATCCAGCAGG - Intergenic
1023093528 7:36638313-36638335 GGCTGTTGACAGCCTCCTGCTGG - Intronic
1023631921 7:42173595-42173617 GGCTCTCATCAGACTCTGGCAGG - Intronic
1025912232 7:65838446-65838468 GCCTCTCATCAGCCTCCCAAGGG + Intergenic
1025983073 7:66423917-66423939 AGCTCTCGTCAGCCTCCTGCTGG - Intergenic
1026892786 7:73992183-73992205 GCCTCTCACCAGCCTCCAGCGGG - Intergenic
1026919818 7:74147020-74147042 TGCTCACCTCAGCCTCCCACAGG + Intergenic
1029117773 7:98246165-98246187 GGCCCTCGTCCTCCTGCCGCAGG - Exonic
1031406815 7:121396221-121396243 GGCTCCCGTCGGCCTCCGGCAGG - Exonic
1033540113 7:142348871-142348893 TGCTCTCTTCAGCCTCCCAAAGG + Intergenic
1038134732 8:24773032-24773054 GAGTCTCCTCAGCCTCCCTCTGG + Intergenic
1038406422 8:27325853-27325875 GGAGCTCGCCAGCCTTCCGCGGG + Intronic
1043303323 8:78762348-78762370 GGCCTTCTTCAGCTTCCCGCGGG - Intronic
1043750673 8:83929690-83929712 GTCTCTCTTTAGCCTCCCTCTGG + Intergenic
1049537030 8:143187262-143187284 GGCACTCGTCAGATCCCCGCAGG + Intergenic
1049543082 8:143217356-143217378 GGCTCTCCTAGGACTCCCGCTGG - Intergenic
1049618173 8:143585511-143585533 GGCTTTCCACAGCCTCACGCTGG - Intronic
1057600236 9:96450792-96450814 AGCTCTCGCCAGCCTCGTGCGGG + Intronic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1059592547 9:115677792-115677814 GGCTCTCCTCAGCCTGCAGAAGG - Intergenic
1061510508 9:131058188-131058210 GGCTCACTGCAGCCTCCTGCTGG + Intronic
1062406475 9:136399235-136399257 GGCCCCAGTCAGCCTCCAGCAGG - Intergenic
1062569407 9:137178219-137178241 GCCACTGGTCAGCCTGCCGCAGG + Intronic
1187802123 X:23075635-23075657 GGCTCCCGTCGGCCTCCGGCAGG + Intergenic
1195903091 X:109818678-109818700 GTCTCTCATCAGCCACCAGCTGG + Intergenic
1200150190 X:153947473-153947495 GGCTCCCGTGAGCCTCGGGCAGG + Intergenic
1200286725 X:154830019-154830041 CCCTCTCCTCAGCCTCCTGCAGG - Intronic