ID: 997485228

View in Genome Browser
Species Human (GRCh38)
Location 5:134225691-134225713
Sequence CCTCACGGCCGCCTTTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997485221_997485228 -3 Left 997485221 5:134225671-134225693 CCTCCGCCATGTTGCACCCTCCT 0: 1
1: 0
2: 1
3: 8
4: 155
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121
997485218_997485228 10 Left 997485218 5:134225658-134225680 CCCGGACCGGCGGCCTCCGCCAT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121
997485220_997485228 4 Left 997485220 5:134225664-134225686 CCGGCGGCCTCCGCCATGTTGCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121
997485219_997485228 9 Left 997485219 5:134225659-134225681 CCGGACCGGCGGCCTCCGCCATG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121
997485224_997485228 -9 Left 997485224 5:134225677-134225699 CCATGTTGCACCCTCCTCACGGC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121
997485222_997485228 -6 Left 997485222 5:134225674-134225696 CCGCCATGTTGCACCCTCCTCAC 0: 1
1: 0
2: 2
3: 13
4: 280
Right 997485228 5:134225691-134225713 CCTCACGGCCGCCTTTTCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997485228 Original CRISPR CCTCACGGCCGCCTTTTCCT CGG Intronic