ID: 997500567

View in Genome Browser
Species Human (GRCh38)
Location 5:134370562-134370584
Sequence CCCCACCATAGGCAAGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997500558_997500567 9 Left 997500558 5:134370530-134370552 CCCCCACATTCCTTAAAAATACA 0: 1
1: 0
2: 1
3: 37
4: 388
Right 997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 149
997500560_997500567 7 Left 997500560 5:134370532-134370554 CCCACATTCCTTAAAAATACAAT 0: 1
1: 0
2: 4
3: 51
4: 524
Right 997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 149
997500561_997500567 6 Left 997500561 5:134370533-134370555 CCACATTCCTTAAAAATACAATG 0: 1
1: 0
2: 5
3: 35
4: 432
Right 997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 149
997500563_997500567 -1 Left 997500563 5:134370540-134370562 CCTTAAAAATACAATGGTACTCC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 149
997500559_997500567 8 Left 997500559 5:134370531-134370553 CCCCACATTCCTTAAAAATACAA 0: 1
1: 0
2: 4
3: 85
4: 1386
Right 997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997500567 Original CRISPR CCCCACCATAGGCAAGTCCC CGG Intronic
901004123 1:6163441-6163463 CCCCACCCTCGGCCAGCCCCTGG - Intronic
903438921 1:23372405-23372427 CCTCACCCCAGGCCAGTCCCTGG - Intergenic
905670792 1:39788905-39788927 CCCCCCCATTGGTCAGTCCCGGG - Intergenic
915200231 1:154221380-154221402 CCCTACCTCAGGCAAGGCCCAGG - Intronic
917825848 1:178819502-178819524 CCCCACCATAGATTAGGCCCTGG + Intronic
921445522 1:215242464-215242486 CCCAACCATAGGCAATTTCAAGG - Intergenic
922147997 1:222968028-222968050 CTTCAACACAGGCAAGTCCCAGG - Intronic
924624364 1:245687234-245687256 CCCCACATTAGCCCAGTCCCGGG + Exonic
1065084997 10:22165170-22165192 CACCACCCAAGTCAAGTCCCAGG - Intergenic
1074145554 10:110714235-110714257 ACCCAGCATGGGCAAGACCCAGG - Intronic
1078660361 11:13280904-13280926 TCTCACCATGGGCAAGTGCCTGG + Intronic
1079118115 11:17653568-17653590 ACCCAGCTTAGCCAAGTCCCGGG - Intergenic
1079870459 11:25792568-25792590 CCCCACCCTACCCTAGTCCCTGG + Intergenic
1082008973 11:47437855-47437877 CCTCACCATAGCCAAGGCCTTGG - Exonic
1086170444 11:83829900-83829922 CCCCACCATACGACAGGCCCCGG + Intronic
1087094167 11:94304637-94304659 CCCCATCGTAGGCAAGATCCGGG - Intergenic
1089497182 11:118913735-118913757 CCCCAACAGAGGCAAGGGCCAGG + Intronic
1092077568 12:5686106-5686128 CTCCCCCAGGGGCAAGTCCCGGG + Intronic
1104892723 12:132148194-132148216 CCTCACCAGAGGAAACTCCCAGG + Intronic
1105357266 13:19669902-19669924 GCCCACCACAGGAATGTCCCTGG + Intronic
1106568322 13:30906000-30906022 GCCCACCATAGGCAGGGCCTGGG + Intergenic
1113864027 13:113509340-113509362 CCCCAACATAGGCAGCTCCAGGG - Intronic
1122578793 14:102758319-102758341 GTCCAGAATAGGCAAGTCCCTGG - Intergenic
1122820098 14:104338549-104338571 CATCAGCAGAGGCAAGTCCCGGG - Intergenic
1122995572 14:105262040-105262062 ACCCACCAAGGGCAAGGCCCTGG + Intronic
1123488279 15:20760169-20760191 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1123544777 15:21329242-21329264 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1126787247 15:52187169-52187191 CCCCACCATGGGCCAGGCTCTGG - Intronic
1128766011 15:70251614-70251636 CCTCACCATATGCAAAGCCCTGG - Intergenic
1129109202 15:73327921-73327943 CCCCACCAAAGGACAGTGCCTGG + Intronic
1129451646 15:75654511-75654533 GCCCACCAGCTGCAAGTCCCAGG - Intronic
1131077151 15:89502526-89502548 GCCCACCTCAGGCAAGGCCCAGG + Intergenic
1132206798 15:99992009-99992031 CCCCACCCTACGACAGTCCCTGG - Intronic
1132433096 15:101776129-101776151 CCCCACCTTAGATAAGTCACTGG - Intergenic
1202953122 15_KI270727v1_random:56513-56535 CCCCAACCAAGGCAAGCCCCTGG - Intergenic
1132775556 16:1591783-1591805 CCACACCCTAGCCAAGTACCTGG + Intronic
1133478315 16:6145191-6145213 CTCCACCCTAGGAAAGGCCCTGG + Intronic
1134592225 16:15463805-15463827 TCCCAACATTGGAAAGTCCCAGG - Intronic
1134788409 16:16965590-16965612 CCCCACCACAGGGAATTACCCGG + Intergenic
1135649102 16:24189832-24189854 CCCCATCATCAGCAAGTCCTGGG + Intronic
1136771275 16:32843684-32843706 CCCCACCCTCGCCAAGGCCCGGG - Intergenic
1137036053 16:35570917-35570939 GCCCACTGTAGGCAAGGCCCAGG + Intergenic
1141046840 16:80723093-80723115 ACCCACCACAGGCACCTCCCTGG + Intronic
1141843925 16:86594068-86594090 CACCACCATGGACAAGACCCAGG + Intergenic
1143540007 17:7563138-7563160 CCCCAGCTTACTCAAGTCCCAGG + Exonic
1143619276 17:8071934-8071956 GGCCACCATAAGCAAGGCCCAGG + Intergenic
1144238187 17:13283412-13283434 ATCCAGCCTAGGCAAGTCCCTGG - Intergenic
1144599722 17:16601068-16601090 ACCCATCTTTGGCAAGTCCCAGG + Intergenic
1145281172 17:21468100-21468122 CCCCACCGAGGGCAATTCCCAGG + Intergenic
1146707038 17:35008369-35008391 CCCAACCACAGGCTAATCCCAGG + Exonic
1147508425 17:41044140-41044162 GCCTACCATATGCAAGTCACAGG - Intergenic
1147562399 17:41517135-41517157 CACCACCATCGACAACTCCCGGG - Exonic
1149570034 17:57665772-57665794 CCCCACCCCAGGAAAGTGCCTGG - Intronic
1152327664 17:79650968-79650990 CCCCACCTCAGGCGAGTCCCGGG - Intergenic
1154145920 18:11866141-11866163 CCACATCATAACCAAGTCCCTGG + Intronic
1156213483 18:34973407-34973429 CCACACCATTGCCAGGTCCCTGG + Intergenic
1157037277 18:43990011-43990033 CCCCACCATATGAAAGGCCCTGG - Intergenic
1161684508 19:5696243-5696265 CCCCACCTTGGACAAGTCCACGG + Exonic
1162132628 19:8536584-8536606 CCCCACCAGAGTCAAGCACCAGG - Exonic
1162496893 19:11028420-11028442 CCCCAACAAAGGCAGGTCCCAGG + Intronic
1163292141 19:16385811-16385833 CCACAACATAGGCCAGTACCTGG + Intronic
1163988174 19:20972044-20972066 CCCCACTATGGGCAGGTCCCAGG - Intergenic
1164088751 19:21928957-21928979 CCCCTCTATAAGCAAGGCCCAGG - Intergenic
1164171830 19:22731982-22732004 CCCCTCTATGGGCAAGGCCCAGG - Intergenic
1165350566 19:35272889-35272911 CCCCACCACAGGTAAGTCGTGGG - Intronic
1165854615 19:38871859-38871881 CCCCACCACAGGTGTGTCCCTGG - Exonic
1167818490 19:51904973-51904995 CGCCGCCATAGGCCAGTGCCGGG - Exonic
1168583726 19:57576389-57576411 CCACACCATAGGCATCTCTCTGG + Intronic
925024689 2:598560-598582 TCCCAACACAGGCAAGCCCCGGG + Intergenic
925940801 2:8815927-8815949 CCTCTCCTTAAGCAAGTCCCAGG + Intronic
928245252 2:29621082-29621104 CCCCTCCTTTGGAAAGTCCCAGG - Intronic
932411295 2:71549507-71549529 CCCCCACAAAGGTAAGTCCCTGG + Intronic
932583728 2:73009196-73009218 CCACACCTTAGGAAAGCCCCTGG - Intronic
934276093 2:91573998-91574020 CAGCACCATAGGCAGGGCCCGGG - Intergenic
936079386 2:109422068-109422090 CCCTACCAGTGGCAAGTACCCGG + Intronic
936081362 2:109434749-109434771 CCCCCTCACAGGCCAGTCCCTGG + Intronic
939561448 2:143737084-143737106 TCCCACTAGAGGAAAGTCCCAGG - Intronic
940282506 2:152002123-152002145 CTCCACGATCTGCAAGTCCCAGG + Intronic
946106258 2:217372518-217372540 ACACACCATAGGCAGATCCCTGG + Intronic
1173030857 20:39358337-39358359 CCCCACACTTGGAAAGTCCCAGG - Intergenic
1173940345 20:46905630-46905652 CCACACCATAGCCAAGGGCCTGG - Intronic
1174715998 20:52759343-52759365 CCCCACCATATCAATGTCCCAGG + Intergenic
1175244918 20:57576284-57576306 CCCTGCCAGAGGCAAGACCCTGG - Intergenic
1175751656 20:61502396-61502418 CCTCATCAGAGGCCAGTCCCAGG - Intronic
1175766837 20:61598136-61598158 GCCCCCAAGAGGCAAGTCCCCGG - Intronic
1176337854 21:5615612-5615634 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176339262 21:5678685-5678707 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176471516 21:7110838-7110860 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176495077 21:7492616-7492638 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176505565 21:7645771-7645793 GCTCCCCATAGGCAAGACCCAGG + Intergenic
1177204669 21:17997370-17997392 TCCCATCTTTGGCAAGTCCCTGG - Intronic
1181979576 22:26756718-26756740 TCCCACTAAAGGCAAGTCGCGGG + Intergenic
1183720028 22:39557357-39557379 CCCCACCCCAGGCAAGAACCTGG + Intergenic
1184425459 22:44406679-44406701 CCCCATCAAAGGCAATTCCCCGG - Intergenic
1185188954 22:49420824-49420846 CCCCACCATAGGGCCGCCCCGGG - Intronic
950042287 3:9928114-9928136 CCCCTCCATGGGCATGTGCCTGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954872250 3:53776652-53776674 CCCCAAAATAGACCAGTCCCGGG - Exonic
955867515 3:63400753-63400775 ACCCACCACAGGCAAGTACTAGG + Intronic
957842708 3:85692250-85692272 CCTCACCATAGCCCAGTACCAGG + Intronic
963666809 3:148198437-148198459 CCCCACGACAGGCCAGGCCCCGG + Intergenic
965710987 3:171556290-171556312 ACACATCATAGACAAGTCCCAGG + Intergenic
968915684 4:3496187-3496209 CCCCACCATAGGCTCCTCCAGGG + Intronic
968982874 4:3860132-3860154 CCCCTCCCCAGGCAGGTCCCTGG - Intergenic
969464275 4:7345582-7345604 CCTCTCCATAGACAAGTCCTAGG + Intronic
969468117 4:7369797-7369819 CCCCACCATGGGCACGTGGCAGG + Intronic
973182275 4:47283928-47283950 GCCAATCAAAGGCAAGTCCCGGG + Intronic
979992082 4:127387375-127387397 CACCACCATATGCTAGTCACTGG - Intergenic
980736640 4:136898975-136898997 CCCCTCCATAGCCATGTCTCTGG + Intergenic
983430560 4:167644856-167644878 CCCCACCAGAGGACAGGCCCAGG - Intergenic
985038931 4:185869024-185869046 CACCACCAAAGGCAAGTTCTTGG - Intronic
985227440 4:187777899-187777921 TCCCACCATGGGCAAGCGCCAGG + Intergenic
990154764 5:52863455-52863477 CCCCAACCTAGGGAAGGCCCTGG - Intronic
997413676 5:133708768-133708790 CCACATCATAGGCAACTCCCTGG - Intergenic
997500567 5:134370562-134370584 CCCCACCATAGGCAAGTCCCCGG + Intronic
998743414 5:145229820-145229842 CCCCTGCATCGCCAAGTCCCAGG + Intergenic
1002536347 5:179878308-179878330 CCCCACCATCGGCTACTGCCAGG - Exonic
1002879535 6:1238715-1238737 CCCCACCCTAGTCCAGCCCCTGG + Intergenic
1002926199 6:1606989-1607011 CCCCACCATAGAAAAGCACCAGG - Intergenic
1005235499 6:23757401-23757423 CCCCACCCCAGGACAGTCCCTGG + Intergenic
1006436326 6:34027751-34027773 CCCCAGCACAGGGAAATCCCGGG + Intronic
1007263418 6:40579692-40579714 CCCCAACATAATCAAGTCCTGGG + Intronic
1015409529 6:132877235-132877257 TCCCACCACAGGCAAGCTCCAGG - Intergenic
1016434619 6:144023376-144023398 CCTTACCATATGCAAATCCCAGG + Intronic
1021491052 7:21220421-21220443 CCACTCCATCGCCAAGTCCCAGG - Intergenic
1022474902 7:30703488-30703510 CACCACCATAGGGAAGCTCCTGG - Intronic
1023821270 7:43981892-43981914 CCCCATTACAGCCAAGTCCCAGG + Intergenic
1025111116 7:56217129-56217151 CCCCAACATCGGCAATGCCCAGG - Intergenic
1029749537 7:102535314-102535336 CCCCATTACAGCCAAGTCCCAGG + Intergenic
1029767487 7:102634418-102634440 CCCCATTACAGCCAAGTCCCAGG + Intronic
1033878784 7:145856116-145856138 CCACAAGATAAGCAAGTCCCAGG - Intergenic
1034187560 7:149190661-149190683 CTCCACCACTGGCATGTCCCTGG - Intergenic
1034974161 7:155438296-155438318 CCTCACCATAGGCAAGACTCAGG - Intergenic
1036649875 8:10635334-10635356 CCCCACCCCAGGCTAATCCCTGG + Intronic
1037774285 8:21822715-21822737 CCCCAAATTAGGCAAGTACCAGG + Intergenic
1038726305 8:30085239-30085261 CCCCACCAGATGCAGGCCCCTGG + Intergenic
1045783683 8:105897263-105897285 CCCCACCAAATGAATGTCCCAGG - Intergenic
1048798042 8:138170058-138170080 CCCAACCATAGGCAACTGCAAGG + Intronic
1048890843 8:138944852-138944874 CCCCACCATACCCAAATTCCTGG - Intergenic
1049818228 8:144618511-144618533 CCCCACCTCAGGCAGGTCTCTGG - Intergenic
1049931302 9:459551-459573 CCACATCATAGGCAAGTATCAGG - Intronic
1051312311 9:15789755-15789777 CCCCACCCTACGACAGTCCCCGG + Intronic
1057804124 9:98208678-98208700 CCCCACCATCGGCTACTGCCAGG - Exonic
1057853710 9:98585478-98585500 CCCCACCCTACGCCAGTCCCCGG - Intronic
1057872638 9:98729773-98729795 GTCCACAATAGGCAAATCCCTGG - Intergenic
1058794043 9:108480218-108480240 CTGCACCATAGTCAAGTCCAAGG + Intergenic
1059389885 9:113992424-113992446 CCCCACCCCAGCCAGGTCCCTGG - Intronic
1059475864 9:114547145-114547167 CCCCAGGATAGGCAAATCCCAGG - Intergenic
1061433282 9:130544658-130544680 CCCTACCAAAGGGAAGTTCCGGG + Intergenic
1061865857 9:133491472-133491494 ACCCACCAGAGCCCAGTCCCGGG - Intergenic
1062448608 9:136606215-136606237 ACCCGCCAGAGGCAAGGCCCCGG + Intergenic
1189530781 X:41880397-41880419 ACTGACCATAGGCAAGTCTCTGG - Intronic
1192807664 X:74524464-74524486 CCACACCATTGGCCAGACCCAGG - Exonic
1192893995 X:75420791-75420813 CCCCACCCCAGGACAGTCCCTGG - Intronic
1195202894 X:102566666-102566688 CCCCAGCAAAGGCCAGTTCCTGG + Intergenic
1198784664 X:140273989-140274011 CCCCACCCTAGCCAAGGCTCTGG - Intergenic
1200980442 Y:9259055-9259077 CCACAACAAAGGCAAGTCCATGG - Intergenic
1201038578 Y:9807017-9807039 CCACAACAAAGGCAAGTCCAGGG - Intergenic
1202149833 Y:21834764-21834786 CCACAACAAAGGCAAGTCCAAGG - Intergenic