ID: 997505287

View in Genome Browser
Species Human (GRCh38)
Location 5:134412037-134412059
Sequence CAGCCCGTGGCTCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997505279_997505287 19 Left 997505279 5:134411995-134412017 CCTGCGGGGGCACAGAGCGGCTC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 392
997505282_997505287 -10 Left 997505282 5:134412024-134412046 CCTCAGACCGCCGCAGCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 148
Right 997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 392
997505281_997505287 -3 Left 997505281 5:134412017-134412039 CCTGGCTCCTCAGACCGCCGCAG 0: 1
1: 0
2: 2
3: 18
4: 170
Right 997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997505287 Original CRISPR CAGCCCGTGGCTCCTGCCCT GGG Intergenic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
900342993 1:2197448-2197470 AGGCCCGTGCCTCCTACCCTTGG - Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900553144 1:3266552-3266574 CAGGGAGTGGCTCCTGCCCCTGG - Intronic
900699042 1:4032654-4032676 CAGCCCATGGCCCCTGGCCCAGG - Intergenic
901317438 1:8318370-8318392 GGGCCCGAGGCTCCTGCCCTCGG - Intronic
901835481 1:11921398-11921420 CAGCCCCTTGCTCCAGGCCTCGG - Intronic
901934644 1:12619016-12619038 CAGCCAGCGTCTCCTGTCCTTGG + Intergenic
902179211 1:14675170-14675192 CAGCCTGTGGCTCTTGCTCCAGG - Intronic
902405977 1:16183831-16183853 CAGCCCGGGGCTCCAGGCTTGGG - Intergenic
902581014 1:17407591-17407613 CTTACCGTGACTCCTGCCCTTGG - Exonic
902808799 1:18876602-18876624 CAGACCCTGGCTTTTGCCCTTGG - Intronic
902893930 1:19465743-19465765 AAGCCAGTGCCTCCTGTCCTGGG + Intronic
905812008 1:40919751-40919773 CAGGCCATGGCTCCTTCCCCAGG + Intergenic
906721550 1:48009118-48009140 TAGTCCCTGGTTCCTGCCCTTGG + Intergenic
907319808 1:53595094-53595116 CAGCCTCTGCCTCCTGCCCTGGG - Intronic
909608658 1:77531700-77531722 CACCCAGTGGATCCTGCACTGGG + Intronic
915225352 1:154407275-154407297 CAGCCCAAGGCTCCTGCCCCAGG + Intronic
916219944 1:162433576-162433598 CATCCAGTGGATCCTGCACTGGG - Intergenic
919049707 1:192499013-192499035 CACCCAGTGGATCCTGCACTGGG + Intergenic
920194603 1:204218541-204218563 CAGGCCCTGGCACCTTCCCTTGG - Intergenic
921157205 1:212447810-212447832 CGGCCTGTGCCTCCTCCCCTGGG - Intergenic
922211843 1:223492255-223492277 CAGCCTGGAGCTCCTGGCCTGGG + Intergenic
922738356 1:228001895-228001917 CTCCCCGTGGCCCCTGCCCAGGG - Intergenic
922764187 1:228149088-228149110 CGGCTCGTGGCTGCTGCCCCAGG + Intergenic
922775496 1:228212619-228212641 CACCACGTGGCGCCGGCCCTCGG - Exonic
922858895 1:228798570-228798592 CAGCACACAGCTCCTGCCCTTGG + Intergenic
1063652006 10:7947196-7947218 CAGCCCTAGAATCCTGCCCTTGG + Intronic
1065952991 10:30668551-30668573 CAGCCCTTGGCTCCAGCCTACGG - Intergenic
1066598274 10:37076387-37076409 CACCCAGTGGATCCTGCACTGGG - Intergenic
1067344427 10:45427545-45427567 CAGCCCGGGGGTCCTGCGCGCGG + Intronic
1067847932 10:49737912-49737934 CTGCCTGTGACCCCTGCCCTGGG + Intronic
1069566355 10:69465975-69465997 GAGCCTGTGGCCCCTGCCCTGGG - Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1070583884 10:77746530-77746552 CAGGCAGTGACTCATGCCCTGGG + Intergenic
1070599586 10:77856553-77856575 AAGCCTGTGGGTCCTGCCCCTGG + Intronic
1071085276 10:81862621-81862643 CACCCAGTGGATCCTGCACTGGG + Intergenic
1071797007 10:89018590-89018612 CACCCCGTGGATCCTGCACCGGG + Intergenic
1072040326 10:91600645-91600667 CAGGCCAAGGCTCCTGCTCTTGG - Intergenic
1072751659 10:97985035-97985057 CAACTCGTGGCTCCACCCCTTGG + Intronic
1073762774 10:106648758-106648780 CACCCCTGGGCCCCTGCCCTGGG + Intronic
1074720010 10:116256373-116256395 CACCCGGTAGGTCCTGCCCTGGG + Intronic
1075468605 10:122671175-122671197 CAGCCCAAGGATCCTGCCATGGG - Intergenic
1075527472 10:123198756-123198778 CAGTCCCTGGCGCCTTCCCTAGG - Intergenic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1076527664 10:131122559-131122581 CGGACAGAGGCTCCTGCCCTTGG + Intronic
1076532940 10:131157030-131157052 CAGCCCCTGGCTTCTGGGCTAGG + Intronic
1076738466 10:132468958-132468980 CAGCCCCTGCCCCCTGCCCAGGG + Intergenic
1077168389 11:1153847-1153869 CAGCCCGTGGCCCATGCCCAGGG + Intergenic
1077219315 11:1408393-1408415 TCTCCCGTGGCTGCTGCCCTGGG - Intronic
1077600692 11:3572483-3572505 CTGGCCCTGGCTCCTGCCCTGGG + Intergenic
1078091080 11:8265089-8265111 CAGCCCGTTTCTCTTTCCCTGGG - Intronic
1079431031 11:20388167-20388189 CAGCGCCTGGCCTCTGCCCTAGG + Intronic
1080204503 11:29713078-29713100 CACCCAGTGGATCCTGCACTGGG - Intergenic
1081136082 11:39442021-39442043 CAGCTAGTGGATCCTGCACTGGG + Intergenic
1081631997 11:44695615-44695637 CAGCCTGTGGCTCCAGACCGTGG - Intergenic
1082272198 11:50183698-50183720 CACCCAGTGGATCCCGCCCTGGG - Intergenic
1083618902 11:64039359-64039381 CAGGCCCTGGCTGCTGCCCCCGG + Intronic
1083637757 11:64129553-64129575 CAGCACCTGGCTCCATCCCTGGG - Intronic
1084087347 11:66860629-66860651 CAGCCCTTGGCCGCAGCCCTGGG - Intronic
1084256606 11:67947082-67947104 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1084460754 11:69295329-69295351 CAGCGTCTGGCTCCTTCCCTCGG + Exonic
1084531565 11:69730740-69730762 CACCCCTTGACTCCTGCCCCTGG - Intergenic
1084649559 11:70480908-70480930 CAGCCCCAGGCTCCTGTGCTGGG + Intronic
1084816177 11:71648262-71648284 CCGGCCCTGGCTCCTGCCCCAGG - Intergenic
1084978674 11:72816924-72816946 CAGCCCTTGGCTGCTGCCCAGGG + Intronic
1087027283 11:93661923-93661945 CAGGCCGTGGGCCCTGCCCGCGG + Intronic
1088604456 11:111514675-111514697 CAGCCCCTGCCGGCTGCCCTCGG - Intergenic
1089346871 11:117796636-117796658 CAGGCCGTGACTCTTGACCTAGG - Intronic
1090412279 11:126517545-126517567 CAGCCCTGGGGTCCTGGCCTTGG - Intronic
1090998478 11:131888429-131888451 CAGCCCGGATCTCCTGCCTTAGG + Intronic
1091299485 11:134498329-134498351 GAGGCTGTCGCTCCTGCCCTAGG - Intergenic
1091771807 12:3156887-3156909 CAGCCCTTGCCCCCTGCCCTGGG - Intronic
1092426821 12:8381782-8381804 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1093547960 12:20369662-20369684 CAGCCCCTGGCTGCAGCCCTCGG + Exonic
1094622082 12:32089351-32089373 AAGCCCGTCCCTCATGCCCTTGG + Intergenic
1096242169 12:49965348-49965370 CAGCCCCTGGCCCCTACCCCAGG - Exonic
1097213006 12:57386693-57386715 CACCCAGTGGATCCTGCACTGGG - Intronic
1098633902 12:72757464-72757486 CTGCCAGTGGCTCCTGCCAGTGG - Intergenic
1101641231 12:106586870-106586892 CAGACAGTGGCTCCTTCCCCAGG - Intronic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1103911079 12:124352735-124352757 CAGCCGGTGGCCCCTGCTCTTGG + Intronic
1104858020 12:131910846-131910868 CAGTCAGGGGCTCCAGCCCTGGG + Intronic
1105988256 13:25590845-25590867 CTCCCCCTGCCTCCTGCCCTTGG - Intronic
1106639078 13:31564086-31564108 CAGAAGGTAGCTCCTGCCCTTGG + Intergenic
1107291302 13:38857377-38857399 CAGGCAGTGCCTTCTGCCCTTGG + Intronic
1108435424 13:50397013-50397035 CACCCAGTGGATCCTGCACTGGG - Intronic
1109061841 13:57630975-57630997 CAGCCAGGGGCTCCTACCCCGGG - Intergenic
1109745895 13:66622373-66622395 CACCCAGTGGCTCCTGCACCGGG - Intronic
1110318811 13:74136645-74136667 AAGCCCGTGGCTTATGCCATAGG - Intergenic
1111441982 13:88292244-88292266 CACCCAGTGGATCCTGCACTGGG - Intergenic
1113675450 13:112203582-112203604 CAGCTCGTGGGTGCTGCCCGGGG - Intergenic
1113696354 13:112348826-112348848 CAGCCAGTGGCACCTGCCCCAGG - Intergenic
1114415302 14:22538893-22538915 CAGCCCCTGGCTCCCGCCCCTGG + Intergenic
1114675896 14:24440255-24440277 CAGACCTTGGGTGCTGCCCTGGG - Exonic
1115268550 14:31527020-31527042 CACCTAGTGGATCCTGCCCTGGG + Intronic
1117573080 14:57068822-57068844 CAGCCAGGGGCTCCTCCCCTGGG + Intergenic
1118046578 14:61976998-61977020 CAGCCTTTTGCCCCTGCCCTAGG - Intergenic
1118332250 14:64823677-64823699 CAGCCCGGGGCAGCTGCACTGGG + Intronic
1120571958 14:86129677-86129699 GAGCCTGTGCTTCCTGCCCTTGG - Intergenic
1120720689 14:87887327-87887349 CAGCCCCTGCTTCCAGCCCTTGG + Intronic
1121120137 14:91371424-91371446 CAGCACATGGCTCCTCCCATGGG - Intronic
1122132479 14:99612856-99612878 CAGGCCTTGGGTGCTGCCCTAGG + Intergenic
1122216448 14:100208102-100208124 CACCCAGTGGCTCCTGCACTGGG + Intergenic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122388471 14:101364687-101364709 CTCCGCCTGGCTCCTGCCCTGGG + Intergenic
1122549404 14:102541862-102541884 CAGCCCATGGCTCTGGCCCAGGG + Intergenic
1122753075 14:103953757-103953779 CATCCAGTCTCTCCTGCCCTGGG - Intronic
1123168128 14:106346196-106346218 CATACCGTGGCACCTGCCCTGGG - Intergenic
1123170768 14:106370896-106370918 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1123194433 14:106603137-106603159 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1123222389 14:106869470-106869492 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1124036434 15:26057297-26057319 CACCCAGTGGATCCTGCACTGGG - Intergenic
1125723448 15:41856296-41856318 CACTCCGGGGCTCCTGGCCTGGG - Intronic
1126485025 15:49170439-49170461 CAGCACTTGGCTCCTCCCTTGGG + Intronic
1127541712 15:59945430-59945452 CATCCCGGGGCTCCTGCTCTGGG + Intergenic
1127995992 15:64153350-64153372 CAGCCCCTGGCCCCCGCCATCGG - Intronic
1128338800 15:66805449-66805471 AAGCTTGTGGCTCCTTCCCTAGG + Intergenic
1129742392 15:77995776-77995798 CAGCCCGTGGCCCCTGCAAGGGG - Exonic
1129843091 15:78755701-78755723 CAGCCCGTGGCCCCTGCAAGGGG + Intergenic
1130552007 15:84895248-84895270 CACCCACTGGCTCCTGCCCTGGG - Intronic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG + Intronic
1132654917 16:1037733-1037755 CAGCCTCTGCCTCCTGACCTGGG + Intergenic
1132684084 16:1154962-1154984 CAGGCCGTGGCTTCTGCTCCGGG + Intronic
1133166225 16:3949554-3949576 CAGCCCCTTCCTCCCGCCCTTGG + Intergenic
1133212476 16:4271348-4271370 GAGCACGTGGCTCCAGCCCTGGG + Intronic
1133295729 16:4751367-4751389 CAGCCCTGGGCCCCGGCCCTGGG + Exonic
1133542178 16:6766931-6766953 CAGCCCGTGGTACTAGCCCTTGG + Intronic
1133760993 16:8798021-8798043 CACCCCTTGGCGCCTACCCTGGG - Intronic
1134135157 16:11672724-11672746 CTGCCCATGCCTCCTGGCCTGGG + Intronic
1134600715 16:15531515-15531537 CACACTGTGGCTCCTGCTCTGGG - Intronic
1134665395 16:16014882-16014904 CGGCCCACAGCTCCTGCCCTTGG - Intronic
1135280937 16:21153022-21153044 CACCCAGTGGCTCCTGCACCGGG - Intronic
1136523708 16:30814409-30814431 CTGGCCGTGGCTCCTGCCCGTGG - Intergenic
1137368920 16:47886779-47886801 TGGCTCGTGGCTTCTGCCCTGGG - Intergenic
1137590587 16:49690989-49691011 CAGCCCATGGCTCCAGCCTGAGG + Intronic
1139551077 16:67673425-67673447 CAGGCCGAGGCTCCTGCCACAGG + Intergenic
1140528984 16:75648044-75648066 CGGCCCCGGGCTCCTGCACTCGG - Exonic
1141515055 16:84538283-84538305 GGGCCCTTGGCTGCTGCCCTGGG + Intronic
1141596157 16:85098082-85098104 CTTCCAGTGGCTCCTGTCCTTGG - Intergenic
1141610829 16:85180267-85180289 CAGCCAGAGGCACCTGCCCCGGG - Intronic
1141658342 16:85428241-85428263 CGGCCCTGGGCTCCTGACCTGGG + Intergenic
1142178165 16:88654545-88654567 CTGCCCGTGGCTCCCACACTCGG + Intronic
1142968780 17:3597319-3597341 AAACCTGTGGCTCCTGCCCCCGG + Intergenic
1143015250 17:3888185-3888207 CAGCCTGTGGCTTCTGCCTGTGG - Intronic
1143353744 17:6308918-6308940 CAGCCAGAGTCTGCTGCCCTGGG + Intergenic
1143460438 17:7100528-7100550 CACCCCATGGATCCTGCACTGGG + Intergenic
1143954790 17:10659784-10659806 CTTCCTGTGGCTCCTGCCTTCGG - Intergenic
1144837260 17:18163169-18163191 CAGCCCTTGTCTCCTGCCCTGGG - Intronic
1145059705 17:19724847-19724869 CTCCCCGTGGACCCTGCCCTCGG + Intergenic
1146284062 17:31562503-31562525 GAGCCCCTGGCTGCTTCCCTGGG + Intergenic
1146658390 17:34648740-34648762 CAGCTTTTGGGTCCTGCCCTGGG - Intergenic
1148358958 17:46996112-46996134 GTGCCCTTGGCTTCTGCCCTGGG + Intronic
1148388756 17:47254768-47254790 CAGCCCGGGGTTGCTGCCCGTGG + Intronic
1148480369 17:47956082-47956104 CAGCCCTTGTGCCCTGCCCTGGG + Intronic
1148694067 17:49548685-49548707 TGGCCAGTGGCTCCTGCCCTTGG + Intergenic
1148760756 17:49998610-49998632 CAGCCAGTGGCTCTTTCCCTTGG + Intergenic
1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG + Intergenic
1150585353 17:66512583-66512605 CACCCCAGGGCTGCTGCCCTGGG + Intronic
1151557820 17:74855398-74855420 CAGCCAGTGGGTTCTGCCCTAGG + Intronic
1151620151 17:75240341-75240363 CAGCCAGTGGCACCTGCTCCAGG - Exonic
1152365922 17:79856235-79856257 CAGCCCTGGGCACGTGCCCTGGG + Intergenic
1152401897 17:80071391-80071413 CTGCCCGTGGCTTTTGTCCTTGG - Intronic
1152596324 17:81239443-81239465 CCGCCCGCGGCTCCTCACCTCGG - Exonic
1152642842 17:81456376-81456398 CAGCCCTTTGCTCTTGACCTTGG - Exonic
1153545766 18:6203637-6203659 CAGCCAGTCCCTCCTGCCCTAGG + Intronic
1154216620 18:12420683-12420705 CAGCCCGTGCCCCCTGATCTCGG - Intronic
1154394198 18:13971933-13971955 CAGCCCATGGCTCCTCCCTCAGG + Intergenic
1154963205 18:21330204-21330226 CAGCTCGTTGGTGCTGCCCTTGG - Intronic
1155185307 18:23382432-23382454 CACCACGTGGTTCCTGCCATTGG + Intronic
1155271879 18:24149487-24149509 CACCCAGTGGATCCTGCACTGGG + Intronic
1157602536 18:48902759-48902781 GAGCCCATGCCTCCTGCCCATGG + Intergenic
1158332393 18:56376804-56376826 CCACCTGGGGCTCCTGCCCTGGG + Intergenic
1159511285 18:69400909-69400931 CAGCCCGTGGGTGCTGCCGGGGG + Intergenic
1159560468 18:69987272-69987294 CAGCCCCTGGCTTCTCCCTTAGG + Intergenic
1160201843 18:76802259-76802281 CAGCCCCAGCCTCCTACCCTGGG - Intronic
1160941419 19:1622025-1622047 CACCCCCTGCCCCCTGCCCTGGG + Intronic
1161277413 19:3426483-3426505 TAGCCCCCAGCTCCTGCCCTTGG + Intronic
1162491570 19:10995603-10995625 CTGCCTGGGGCTCCTTCCCTGGG - Intronic
1162818503 19:13209616-13209638 CATCCCCTGGCCCCTGCCCCAGG - Intronic
1163018946 19:14472645-14472667 CCGCCCTTGGCTCCGGCCCTCGG + Exonic
1163129031 19:15260562-15260584 CAGCCTGTTTCGCCTGCCCTTGG - Intronic
1163296358 19:16415414-16415436 CAGACCCTGCCTCCTGCCCAGGG + Intronic
1163364881 19:16870272-16870294 CTGGCCGTGGCACCTGTCCTGGG + Intronic
1163426043 19:17241568-17241590 CTCCCCTTGGCCCCTGCCCTTGG + Intronic
1163692953 19:18746967-18746989 CAGCCGGGGCTTCCTGCCCTGGG + Intronic
1164975187 19:32567743-32567765 CGGACCATGGCGCCTGCCCTCGG - Intergenic
1165055671 19:33174806-33174828 CAGCTCATGTCTCCTGCCATGGG - Intronic
1165306614 19:35006627-35006649 CAGGACATGGCCCCTGCCCTTGG - Intronic
1165360247 19:35332052-35332074 CGGCCCCTGGCTCCTGCTCCTGG + Exonic
1166303779 19:41926573-41926595 CCTCCCGTGGCTCTGGCCCTGGG + Intronic
1166836659 19:45671348-45671370 CTGCCCGTGCGTCCTGCCCCTGG + Exonic
1166888407 19:45974881-45974903 CAGCCTGCAGCACCTGCCCTGGG + Intergenic
1167358592 19:49018256-49018278 CGGGCCGTGGCTCCAGACCTGGG + Intergenic
1167631702 19:50629766-50629788 CAGCCCGCTGCTCCGGACCTTGG + Exonic
1167693870 19:51002813-51002835 CAGCCTGTGGCTCCGCCCCAAGG - Exonic
1168200694 19:54813329-54813351 CTGCCTCTGGCTCCTGCCTTGGG - Intronic
1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG + Exonic
925027845 2:623696-623718 CAGCCCATGGCTGGTGACCTCGG - Intergenic
925123288 2:1436494-1436516 GAGCCCCTGGTTCCTGTCCTTGG + Intronic
925341160 2:3137501-3137523 GTGGGCGTGGCTCCTGCCCTTGG - Intergenic
926200487 2:10792826-10792848 CAGCACGTGGCTCCTGGGCCTGG + Intronic
927454779 2:23240117-23240139 CAGACCGTGGCTACTGCTCGAGG - Intergenic
927641808 2:24850137-24850159 GAGCCCCTGGCCCCTGCCCAGGG + Intronic
928106430 2:28473056-28473078 CACCCAGTGGATCCTGCACTGGG - Intronic
928180005 2:29062294-29062316 CAGGGCGAGGCTCCTGCCATAGG - Exonic
930335310 2:50038340-50038362 AAGCCTGTGGCTCCTATCCTGGG + Intronic
935946313 2:108289703-108289725 CAGCACATGGTTCCTGCCCTTGG - Intronic
937047132 2:118857750-118857772 CAGCCCACAGCTCCCGCCCTGGG - Intergenic
939267427 2:139891722-139891744 CTGCCAGTGGCTTCTGCCTTGGG - Intergenic
939509548 2:143089533-143089555 CACCCAGTGGATCCTGCACTGGG + Intergenic
940015656 2:149101520-149101542 CAGCTCTTGGCTGGTGCCCTTGG - Intronic
940859103 2:158753931-158753953 CAGCCCTTTTCTCCTCCCCTTGG + Intergenic
942148474 2:173050551-173050573 CAGACCCTGGCTCCTGACCGGGG - Intronic
942450455 2:176105570-176105592 CAGCCAGCGCCGCCTGCCCTGGG + Intronic
943106085 2:183546614-183546636 CACCCAGTGGATCCTGCACTGGG + Intergenic
944490378 2:200252836-200252858 CAGCCAGTGCCTCCTAGCCTAGG + Intergenic
944665488 2:201955768-201955790 CAGTTCCTGGCTACTGCCCTTGG - Intergenic
946185566 2:217978747-217978769 CAGCCCGCGGCCCCTTACCTTGG + Intronic
946309209 2:218873406-218873428 CAGCCCGTGGCATTTGCACTCGG - Exonic
947524913 2:230871930-230871952 CAGCACAGGGGTCCTGCCCTGGG - Intronic
948527410 2:238580237-238580259 CAGGGCGTGGGTCCTGCCCAAGG + Intergenic
948663535 2:239520981-239521003 CAGCCCATGGGTCCAGGCCTGGG + Intergenic
948901380 2:240958421-240958443 CAGCCTGTGCCCCCTGCTCTTGG - Intronic
949037602 2:241824365-241824387 CAGCCCGGGGCTTCGGCCCCCGG + Intergenic
1168736637 20:145699-145721 CAGCCTCTGTCTCCTGCTCTAGG + Exonic
1169029483 20:2396602-2396624 CTGCCCGTAGTTCCAGCCCTGGG - Exonic
1169278764 20:4249919-4249941 CAGGCTGTGGCTACAGCCCTCGG + Intergenic
1171275700 20:23855219-23855241 GAACTGGTGGCTCCTGCCCTGGG - Intergenic
1171451163 20:25237130-25237152 CAACCTGTGGCTACTGCTCTTGG - Intergenic
1172055402 20:32151019-32151041 CAGCCTGGGATTCCTGCCCTTGG - Intronic
1172813311 20:37667105-37667127 CAGTCCGGGGCTCTTTCCCTCGG + Intergenic
1174037278 20:47676004-47676026 CAGTCCGTGGCTCATGCCTGAGG - Intronic
1174169095 20:48605135-48605157 CAGCCCGTGCCTCCCTCCCCAGG - Intergenic
1174529531 20:51199921-51199943 CAGCCCTGGGTTCCTGCACTCGG - Intergenic
1174690919 20:52503760-52503782 CATCCCGCGGCAGCTGCCCTGGG + Intergenic
1175254227 20:57629213-57629235 CACCCAGTGGATCCTGCCCCGGG - Intergenic
1175948619 20:62570403-62570425 CTGGTCCTGGCTCCTGCCCTGGG + Intronic
1175972120 20:62691975-62691997 TAGCCCCTGAGTCCTGCCCTGGG - Intergenic
1176050313 20:63115855-63115877 CAGCCCCTGGCTGCTGCCTCTGG - Intergenic
1176218349 20:63958611-63958633 CAGCCTGTGGCTCCCTCCCTGGG - Exonic
1176271967 20:64239990-64240012 CTGCCTCTGGGTCCTGCCCTAGG + Intronic
1176423197 21:6532653-6532675 CGGGCAGTGGCTTCTGCCCTGGG + Intergenic
1178928406 21:36794882-36794904 CAGCCCTTGCCTCCTGCTTTTGG - Intronic
1179698690 21:43140969-43140991 CGGGCAGTGGCTTCTGCCCTGGG + Intergenic
1179925814 21:44533545-44533567 CACCCCATGGCTCCTGACCCTGG + Intronic
1179988723 21:44934813-44934835 CAGCCCATAGCTCCAGCCCCAGG + Exonic
1180066555 21:45415416-45415438 CAGCTCCTGGCTGCTGCCCTGGG - Intronic
1180227364 21:46402755-46402777 CAGCCCTGGGGTGCTGCCCTAGG - Intronic
1180823283 22:18846702-18846724 CTCCCCGTTGCTCCTGCCCGTGG + Intronic
1181048820 22:20229106-20229128 CAGCCTGTGTCCCCTGGCCTGGG - Intergenic
1181123709 22:20689801-20689823 CTCCCCGTTGCTCCTGCCCGTGG + Intergenic
1181189460 22:21127844-21127866 CTCCCCGTTGCTCCTGCCCGTGG - Exonic
1181209740 22:21282651-21282673 CTCCCCGTTGCTCCTGCCCGTGG + Intergenic
1181636007 22:24175219-24175241 CTGCCTGAGGCTCCTGCCCCAGG - Intronic
1181649639 22:24251775-24251797 CTCCCCGTTGCTCCTGCCCGTGG + Intergenic
1181707733 22:24658971-24658993 CTCCCCGTTGCTCCTGCCCGTGG - Intergenic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1182239802 22:28906760-28906782 AAGCCAGTGGTTTCTGCCCTGGG - Intronic
1182345393 22:29660212-29660234 CAGCCCGCGGCGGGTGCCCTGGG - Intronic
1182374670 22:29837994-29838016 GAACCCGTGGCTCCTGACCCTGG + Intronic
1183402295 22:37611633-37611655 CAGCATGTGGCGCCTGCCCTGGG - Intronic
1184677988 22:46053893-46053915 GGGCCCCTGGCTCCTGGCCTCGG - Exonic
1184679243 22:46061572-46061594 CAGCCCGCGACTCCTGACCCCGG + Intronic
1184684424 22:46089740-46089762 CTGCCCCTGCCTCCTGCCCGAGG + Intronic
1184848294 22:47102422-47102444 CAGCCCTGGGCACCTGGCCTTGG - Intronic
1184868239 22:47215996-47216018 TAGCCTGTGGCTGCAGCCCTTGG + Intergenic
1185026159 22:48414471-48414493 ATGCTCTTGGCTCCTGCCCTGGG + Intergenic
1185062613 22:48614932-48614954 CAGCCAGTGGCTTCTGGCCCCGG - Intronic
1185199571 22:49493456-49493478 CAGGCCTGGGCTGCTGCCCTGGG + Intronic
1203217206 22_KI270731v1_random:12782-12804 CTCCCCGTTGCTCCTGCCCGTGG - Intergenic
1203273424 22_KI270734v1_random:72608-72630 CTCCCCGTTGCTCCTGCCCGTGG + Intergenic
950345264 3:12287710-12287732 AAGCCGGTGGCTCCCGCCGTGGG + Intronic
950486024 3:13274395-13274417 CAGGCCCTGTCTTCTGCCCTTGG + Intergenic
952955872 3:38556831-38556853 CAGTGCCTGGCTCCGGCCCTGGG + Intronic
953673993 3:44986052-44986074 CAACCAGTGGATCCTGCACTGGG + Intronic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
961282620 3:125775643-125775665 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
961756448 3:129130004-129130026 CAGCCTGTGTCTGCAGCCCTGGG + Exonic
962168633 3:133077388-133077410 CTGCCCCTGGCACCTCCCCTGGG - Intronic
962732830 3:138299276-138299298 CAGCCCCTGGCTCCTGGCTTTGG + Intronic
966505288 3:180693854-180693876 TAGTCCATGGCTCTTGCCCTGGG + Intronic
966853893 3:184181018-184181040 CAGGCCCAGGATCCTGCCCTGGG - Intronic
967557785 3:190878010-190878032 CGGCCGGTTGCGCCTGCCCTCGG - Intronic
967932315 3:194699051-194699073 TGGCCCATGGCTCTTGCCCTAGG - Intergenic
968448193 4:663054-663076 AGGCCCGTGGGACCTGCCCTTGG - Intronic
968469747 4:773953-773975 CACCCAGTGGATCCTGCGCTGGG - Intergenic
968524503 4:1049168-1049190 CAGCCAGCAGCTCCTGCCCAGGG + Intergenic
968532930 4:1104738-1104760 CAGCATGTGGCCCCTTCCCTCGG + Intronic
968576358 4:1368023-1368045 CAGGCCGTGGGTCCAGCCCCCGG + Intronic
968919228 4:3514097-3514119 CAGCCTGTGGCCCTTGCCCGTGG - Intronic
968958984 4:3733332-3733354 CTGCCGGTGGCTGCTGTCCTGGG + Intergenic
969015116 4:4098789-4098811 CTGGCCCTGGCTTCTGCCCTGGG + Intergenic
969220021 4:5753262-5753284 CAGCAGGTGACCCCTGCCCTGGG - Intronic
969656074 4:8499276-8499298 CAGCCTGGGCCCCCTGCCCTGGG + Intergenic
969738818 4:9009495-9009517 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
969798020 4:9541108-9541130 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
970051316 4:11918059-11918081 CACCCAGTGGATCCTGCACTGGG - Intergenic
970182666 4:13415808-13415830 CACCCAGTGGATCCTGCACTGGG - Intronic
970516262 4:16833878-16833900 CAGCCCTTTGCTGCTCCCCTGGG + Intronic
971905113 4:32716160-32716182 CACCCAGTGGCTCCTGCACCGGG + Intergenic
972334532 4:38095599-38095621 CAACACGTAGCTCCTGTCCTGGG + Intronic
973048656 4:45567478-45567500 CACCCAGTGGATCCTGCACTTGG - Intergenic
974402597 4:61425602-61425624 CTGCCAGTGGCTTCTGCCCAGGG + Intronic
975745016 4:77466768-77466790 CACCCAGTGGATCCTGCCCGGGG - Intergenic
975995004 4:80303219-80303241 CACCCAGTGGCTCCCGCACTGGG - Intronic
978406391 4:108383407-108383429 CAGTTGGTGGCTCCTGCCTTGGG - Intergenic
978917902 4:114148515-114148537 CACCCAGTGGATCCTGCACTGGG + Intergenic
982276474 4:153641062-153641084 AAGCCCTGGGCTCCTGCCCCGGG + Intergenic
985173485 4:187176715-187176737 CCGCCCGTGGCTGCCGCCCGTGG + Intergenic
987249345 5:16082460-16082482 CAGCCCAGGGCTCCTCCACTTGG + Intronic
987708756 5:21484341-21484363 CTCCCCGTTGCTCCTGCCCCTGG - Intergenic
988750855 5:34189804-34189826 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
988883673 5:35532053-35532075 CACCCAGTGGATCCTGCACTGGG - Intergenic
989401476 5:41012222-41012244 CTGCCCTTGACTCCTGCCCTTGG + Intronic
990673801 5:58161735-58161757 CAGCCCATGGCAGCAGCCCTGGG + Intergenic
991735995 5:69631728-69631750 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991739123 5:69653016-69653038 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991759075 5:69903415-69903437 CTCCCCGTTGCTCCTGCCCCTGG - Intergenic
991788261 5:70214707-70214729 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991790698 5:70232757-70232779 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991812489 5:70487367-70487389 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991815449 5:70507844-70507866 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991818584 5:70529133-70529155 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991838304 5:70778481-70778503 CTCCCCGTTGCTCCTGCCCCTGG - Intergenic
991880708 5:71215071-71215093 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
991883145 5:71233092-71233114 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
994230041 5:97301574-97301596 CACCCAGTGGATCCTGCACTGGG - Intergenic
994420885 5:99525692-99525714 CTCCCCGTTGCTCCTGCCCCTGG - Intergenic
994486157 5:100388622-100388644 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
994932366 5:106206024-106206046 CACCCAGTGGATCCTGCACTGGG + Intergenic
995566754 5:113438960-113438982 CAGCCAGGGGATCCTGCCCAAGG - Intronic
996117258 5:119632799-119632821 CACCCCTTGGCTCCAGCCTTTGG - Exonic
997195441 5:131975863-131975885 CAAACCTTGGCTCCTGACCTGGG + Intronic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998088862 5:139349529-139349551 GAGCCACTGCCTCCTGCCCTTGG + Intronic
998722599 5:144971659-144971681 CAGCCCGTGAACCCTGACCTCGG - Intergenic
999753501 5:154647523-154647545 CAGCTCCTGTCTCCTGCGCTTGG + Intergenic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1001032516 5:168273022-168273044 CAGCCCATCGCTCCTGTCTTAGG - Intergenic
1002053485 5:176585063-176585085 CAGCCCAGGGCTCCTTCCCGCGG - Intronic
1002540105 5:179900980-179901002 CAGCCCGTGGCACCCGCTCAAGG + Intronic
1002577157 5:180180621-180180643 CAGGACCTGGCTCCTGCCCAAGG + Intronic
1003882000 6:10487722-10487744 CACCCAGTGGATCCTGCACTAGG + Intergenic
1004912699 6:20301678-20301700 CACCCAGTGGATCCTGCACTGGG - Intergenic
1005548930 6:26896109-26896131 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
1006141814 6:31933890-31933912 GAGGACGTGGCCCCTGCCCTGGG + Exonic
1006443021 6:34063718-34063740 CAGCCAGTGGCTGCCTCCCTTGG - Intronic
1006748820 6:36364166-36364188 CACCCAGTGGATCCTGCACTGGG + Intronic
1007074378 6:39057548-39057570 CTGCCCCTGGTACCTGCCCTGGG + Exonic
1007301493 6:40871196-40871218 CAGCCCATGAAACCTGCCCTGGG + Intergenic
1007392912 6:41560931-41560953 CAGCCCGTGGGTCCCCCCTTTGG + Intronic
1007726363 6:43918279-43918301 CAGCCACTGGCTCATGCCTTTGG - Intergenic
1007731658 6:43951228-43951250 GAGCCCATGCCTCCTGCCCTGGG - Intergenic
1007996383 6:46312486-46312508 CAAACCCTGGTTCCTGCCCTGGG - Intronic
1008885751 6:56430444-56430466 CTTACCGTGACTCCTGCCCTTGG - Intergenic
1009019679 6:57937219-57937241 CTCCCCGTTGCTCCTGCCCCTGG + Intergenic
1009113317 6:59222323-59222345 CAGCGAGTGGCACCTTCCCTTGG + Intergenic
1009129527 6:59447798-59447820 CAGCGAGTGGCACCTTCCCTTGG + Intergenic
1014778112 6:125533739-125533761 GAGTGCGTGGCTCCTGCCCTGGG - Intergenic
1016363398 6:143291355-143291377 CACCCCCTGGCTCCTGTCCAGGG - Intronic
1016980841 6:149852478-149852500 CTGCCCGGGGCTCCTGCCCGGGG - Intronic
1017450277 6:154548552-154548574 CTGCCCCAGGCCCCTGCCCTCGG + Intergenic
1017981068 6:159401591-159401613 GAGCCCCTGGCTCCTCCCGTGGG - Intergenic
1019419645 7:945131-945153 CAGCCCGTCCCTTCTGCCTTGGG - Intronic
1019910939 7:4100273-4100295 CCCCCCATGGCCCCTGCCCTAGG - Intronic
1020011797 7:4809283-4809305 CATCACGAGGTTCCTGCCCTCGG + Intronic
1020224722 7:6271804-6271826 CAGCTCGTGTCTCCCACCCTCGG + Intronic
1022092011 7:27113916-27113938 CGGGCCGCGGCTGCTGCCCTCGG - Intronic
1022475238 7:30705740-30705762 CAGCCCATGGCGCCTGCTCCTGG - Intronic
1022617895 7:31951395-31951417 CAGCCACTGGCTCCTGGCTTCGG + Intronic
1023378062 7:39577823-39577845 CACCTCGTGGATCCTGCACTGGG - Intronic
1023874219 7:44278086-44278108 CAGCCAGGGGCGCCTGCCATGGG + Intronic
1023969187 7:44978839-44978861 GAGCCACTGCCTCCTGCCCTGGG + Intronic
1024349842 7:48352496-48352518 CTGTCGGTGGCTCCTGCCCCAGG - Intronic
1026632784 7:72052514-72052536 TAGCCCGTGTCTCCTGCTCCTGG + Intronic
1027579636 7:79977538-79977560 CACCCAGTGGATCCTGCACTGGG + Intergenic
1028301563 7:89206898-89206920 CAGCACTTTGCTCCTGCCATAGG - Intronic
1029073786 7:97920412-97920434 CCGGCCCTGGCTCCTGCCCCGGG + Intergenic
1029566633 7:101342880-101342902 CAGGCCGAGGCTACTGCACTCGG - Intergenic
1030292727 7:107888244-107888266 CACCCAGTGGATCCTGCGCTGGG - Intergenic
1031483475 7:122304160-122304182 GAGCCCGTCACTCCTGCCTTGGG + Exonic
1034137066 7:148780604-148780626 GAGCCCGTGTGGCCTGCCCTGGG - Intronic
1034350339 7:150411120-150411142 GAGCCCTTTGCTCCTGGCCTGGG + Intronic
1034354871 7:150444118-150444140 GAGCCTGTGGCTCCAGCCTTGGG - Intergenic
1034651849 7:152697547-152697569 CACCCAGTGGATCCTGCACTGGG - Intergenic
1035248091 7:157577980-157578002 CGGCTGGTGGGTCCTGCCCTGGG + Intronic
1036243915 8:7100848-7100870 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
1036256885 8:7213204-7213226 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036308935 8:7671803-7671825 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036360603 8:8074309-8074331 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
1036890368 8:12592658-12592680 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036897936 8:12650575-12650597 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1037839198 8:22231985-22232007 CAGCGCGTCGCTGCTGCCCCTGG + Exonic
1037877247 8:22554210-22554232 CCACCCGGAGCTCCTGCCCTGGG + Intronic
1037975061 8:23203354-23203376 CAGCCCATGCCACCTGCCATGGG + Intronic
1038482173 8:27909388-27909410 CAGACCCTGGCTCCTGGGCTGGG + Intronic
1038746799 8:30261845-30261867 CACCCCCTTGCTCCTGCCCTTGG + Intergenic
1038761178 8:30384973-30384995 CAGCCCGCGGCGCCCGCCCGAGG + Exonic
1039482138 8:37882097-37882119 CTGCCTGAAGCTCCTGCCCTGGG - Intronic
1039821968 8:41142436-41142458 CAGCCTCTGGCTCTTGTCCTAGG - Intergenic
1039920563 8:41891387-41891409 CAGCTCGTGTCCCCTGCCCAGGG + Intronic
1040322645 8:46326437-46326459 GAGCCCTGGGCTCCTGCCCAGGG - Intergenic
1040351349 8:46571951-46571973 CACCCAGTGGATCCTGCACTGGG - Intergenic
1045054990 8:98361252-98361274 CAGGCCTTGCCTCCTGCCCACGG + Intergenic
1047577596 8:126174754-126174776 CAGCCCTTGGCTTCTGGACTGGG - Intergenic
1048967532 8:139625311-139625333 CAGCCTGTGGGTGCTGTCCTGGG - Intronic
1049529846 8:143148726-143148748 CAGCCCCTGTCTCCCGCTCTGGG + Intergenic
1051339453 9:16097900-16097922 CACCCCATGCATCCTGCCCTAGG + Intergenic
1054771819 9:69090523-69090545 GAGCCACTGGCTACTGCCCTGGG + Intronic
1055599172 9:77897566-77897588 CAGCACTGGGCTCCTGCCATGGG + Intronic
1057300777 9:93880334-93880356 CACCCAGTGGATCCTGCACTGGG - Intergenic
1057499583 9:95585941-95585963 CAGCCTCTGGCTCCTGCCCTGGG + Intergenic
1057524514 9:95786702-95786724 CAGCCTGAGGCTTCTGCCCTCGG - Intergenic
1057599996 9:96449949-96449971 CAGCCAGTAGCTCCGCCCCTGGG + Intergenic
1057819858 9:98322412-98322434 CTGCCCCAGGCTCTTGCCCTCGG + Intronic
1057972407 9:99570607-99570629 CATCCCGTGTTTCCTGCTCTAGG - Intergenic
1058884634 9:109314080-109314102 TAGCCCGTGGCTGCTGCCTGAGG - Intronic
1060969749 9:127731284-127731306 CATGCCCTGGCTCTTGCCCTGGG - Exonic
1061792213 9:133064745-133064767 CAGACCTTGCTTCCTGCCCTGGG - Exonic
1061906569 9:133702329-133702351 CAGCCCGTCGCCCCTGCCTGGGG - Intronic
1062162566 9:135088197-135088219 CAGCCCGGGGCTCCGGACCGAGG - Intronic
1062377284 9:136267857-136267879 AAGCCCGTTCCTCCCGCCCTGGG - Intergenic
1062407760 9:136404994-136405016 CAGCCGGTGCAGCCTGCCCTTGG - Intronic
1062417170 9:136457418-136457440 CTGCCCCTGGCGCCTGTCCTCGG - Intronic
1062482944 9:136760775-136760797 CAGCCCCTGGCTCCCTCCCCAGG - Intronic
1062520225 9:136954582-136954604 CACCCCGGGTCTCCTGTCCTGGG + Intronic
1185431415 X:13849-13871 CAGACCCCCGCTCCTGCCCTCGG + Intergenic
1185599258 X:1327774-1327796 GAGACCGTGGCCCCTGCCCTGGG + Intergenic
1186295578 X:8144906-8144928 CACCCGGTGGATCCTGCACTGGG + Intergenic
1186480838 X:9895234-9895256 CAGCCCCTGGCTCCTGCCCAAGG - Exonic
1187521806 X:20020752-20020774 CTGCCTGTGGTTCCTGGCCTGGG + Intronic
1189383799 X:40520568-40520590 CATCCCCTGCCTTCTGCCCTTGG - Intergenic
1194025527 X:88746310-88746332 CACCCAGTGGATCCTGCACTAGG + Intergenic
1194782106 X:98036349-98036371 CAGCACTTGTCTCCTGCCATTGG + Intergenic
1194935099 X:99939045-99939067 CTTACCGTGACTCCTGCCCTTGG - Intergenic
1197000212 X:121431464-121431486 CACCCAGTGGATCCTGCCCCAGG + Intergenic
1198468178 X:136921788-136921810 CACCCCGTGGATCCTGCACCGGG - Intergenic
1200259089 X:154602442-154602464 CCGCCACTGGCTCCTGCCCCAGG - Intergenic