ID: 997516741

View in Genome Browser
Species Human (GRCh38)
Location 5:134495400-134495422
Sequence CTTATTCCTGAGCTTTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997516741_997516745 -3 Left 997516741 5:134495400-134495422 CCTCACCAAAGCTCAGGAATAAG No data
Right 997516745 5:134495420-134495442 AAGCCCATGGAAGCCAGTCTGGG No data
997516741_997516749 1 Left 997516741 5:134495400-134495422 CCTCACCAAAGCTCAGGAATAAG No data
Right 997516749 5:134495424-134495446 CCATGGAAGCCAGTCTGGGGAGG No data
997516741_997516744 -4 Left 997516741 5:134495400-134495422 CCTCACCAAAGCTCAGGAATAAG No data
Right 997516744 5:134495419-134495441 TAAGCCCATGGAAGCCAGTCTGG No data
997516741_997516746 -2 Left 997516741 5:134495400-134495422 CCTCACCAAAGCTCAGGAATAAG No data
Right 997516746 5:134495421-134495443 AGCCCATGGAAGCCAGTCTGGGG No data
997516741_997516752 30 Left 997516741 5:134495400-134495422 CCTCACCAAAGCTCAGGAATAAG No data
Right 997516752 5:134495453-134495475 CTGCAAACAACCTGATCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997516741 Original CRISPR CTTATTCCTGAGCTTTGGTG AGG (reversed) Intergenic
No off target data available for this crispr