ID: 997519334

View in Genome Browser
Species Human (GRCh38)
Location 5:134512593-134512615
Sequence CCCAGGATTAGGGTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997519334_997519347 17 Left 997519334 5:134512593-134512615 CCCAGAGAGACCCTAATCCTGGG No data
Right 997519347 5:134512633-134512655 CAGGCCCCAGGCCACACAGAGGG No data
997519334_997519344 5 Left 997519334 5:134512593-134512615 CCCAGAGAGACCCTAATCCTGGG No data
Right 997519344 5:134512621-134512643 GAGAGAGCCAAACAGGCCCCAGG No data
997519334_997519341 -2 Left 997519334 5:134512593-134512615 CCCAGAGAGACCCTAATCCTGGG No data
Right 997519341 5:134512614-134512636 GGGCCCAGAGAGAGCCAAACAGG No data
997519334_997519352 28 Left 997519334 5:134512593-134512615 CCCAGAGAGACCCTAATCCTGGG No data
Right 997519352 5:134512644-134512666 CCACACAGAGGGCAGCCCTGAGG No data
997519334_997519346 16 Left 997519334 5:134512593-134512615 CCCAGAGAGACCCTAATCCTGGG No data
Right 997519346 5:134512632-134512654 ACAGGCCCCAGGCCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997519334 Original CRISPR CCCAGGATTAGGGTCTCTCT GGG (reversed) Intergenic