ID: 997522791

View in Genome Browser
Species Human (GRCh38)
Location 5:134534034-134534056
Sequence CTTGACACGCAGACTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997522782_997522791 16 Left 997522782 5:134533995-134534017 CCCGGCCTCCCAAAGTGCTGGGA 0: 2887
1: 4969
2: 4633
3: 3748
4: 5181
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522778_997522791 21 Left 997522778 5:134533990-134534012 CCAGCCCCGGCCTCCCAAAGTGC 0: 569
1: 87189
2: 222980
3: 235610
4: 157819
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522777_997522791 24 Left 997522777 5:134533987-134534009 CCTCCAGCCCCGGCCTCCCAAAG 0: 21
1: 2078
2: 73416
3: 174701
4: 181349
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522780_997522791 17 Left 997522780 5:134533994-134534016 CCCCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522784_997522791 11 Left 997522784 5:134534000-134534022 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522787_997522791 7 Left 997522787 5:134534004-134534026 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522783_997522791 15 Left 997522783 5:134533996-134534018 CCGGCCTCCCAAAGTGCTGGGAT 0: 2878
1: 3400
2: 2456
3: 2522
4: 3989
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107
997522786_997522791 8 Left 997522786 5:134534003-134534025 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997522791 Original CRISPR CTTGACACGCAGACTCTGGA AGG Intronic
903544721 1:24116788-24116810 GTTGACACTCAGACTTGGGAGGG + Intergenic
910434203 1:87188625-87188647 CTTGAAAGGAAGAATCTGGATGG - Intergenic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
914914001 1:151807199-151807221 CTTCACACCCAGCTTCTGGAAGG - Exonic
914977578 1:152380230-152380252 TTTGACCCTCAGAATCTGGAGGG - Intergenic
914993369 1:152517424-152517446 CTTGCCAGGGAGGCTCTGGAGGG + Intronic
919178842 1:194056198-194056220 TTTGACACGCCAACTCTTGAGGG - Intergenic
921791409 1:219294722-219294744 CCTGAGGCACAGACTCTGGATGG + Intergenic
922969948 1:229727840-229727862 GGTGACACGCAGACTCTGTCCGG + Intergenic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
1065201512 10:23317147-23317169 GTTGGCACCCAAACTCTGGAGGG + Exonic
1071968238 10:90874783-90874805 CTTGACATCTAGACTCAGGATGG + Intronic
1075078910 10:119369828-119369850 CTGGACAGGCAGTCGCTGGAAGG - Intronic
1075102768 10:119517880-119517902 GTTCTCACGCAGACTCAGGAGGG - Intronic
1075351132 10:121726055-121726077 CTTGACACCCAACCCCTGGATGG - Intergenic
1079248185 11:18768756-18768778 CTAGACACGCAGGCTGTGGCTGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1085388535 11:76170731-76170753 CTTGACAAGCAGCCTCCGGGGGG + Intergenic
1086158876 11:83698813-83698835 CTTTACAACCACACTCTGGAAGG - Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1115152180 14:30298185-30298207 CTTGAAATGCAGACTCGGGCAGG - Intergenic
1116083436 14:40204716-40204738 CTTGATACCCAAAGTCTGGAGGG + Intergenic
1121951576 14:98175394-98175416 GGTGAGAGGCAGACTCTGGAAGG + Intergenic
1126694665 15:51315730-51315752 CTTGGCACCCAGAATCTGCAGGG - Intronic
1133207572 16:4242452-4242474 CTTGACACGCCTGCACTGGAAGG + Intergenic
1144447495 17:15344541-15344563 GTTGACACTCATATTCTGGAAGG - Intergenic
1146902441 17:36597534-36597556 CTAGGCACGGAGACTCTAGAGGG - Intronic
1147496848 17:40924777-40924799 CTTGAGACCCAGACCCTGGCAGG - Intronic
1147910490 17:43853261-43853283 CTTGCCCCCGAGACTCTGGATGG - Intronic
1151427860 17:74042844-74042866 CTTTCCACGCAGACTCTCGGAGG - Intergenic
1151593126 17:75059819-75059841 CTTCACACGCAGACTTTCCAGGG + Intronic
1152516006 17:80825287-80825309 CTCGCCACGCGGCCTCTGGAGGG - Intronic
1152810233 17:82378381-82378403 CCTGACACGCAGACTCTCGGCGG + Intergenic
1155499304 18:26471069-26471091 CTTGACCCTCTGACTCTGGGAGG + Intronic
1155611154 18:27669230-27669252 CTTTTCACCTAGACTCTGGAGGG - Intergenic
1157643468 18:49242540-49242562 CTTGACACACAGCCTCTAGATGG + Intronic
1160167683 18:76528734-76528756 TTTGTCACGCAGACAATGGAGGG - Intergenic
1161238046 19:3207651-3207673 CTTCACGAGCAGCCTCTGGACGG - Exonic
1161637114 19:5395849-5395871 CTTGACAGGGAAAATCTGGAGGG + Intergenic
1166542915 19:43617410-43617432 CTTGACATCCAGACTTTGAAGGG - Intronic
925300449 2:2807889-2807911 CTTGATTCGCAGCCTTTGGAAGG - Intergenic
925515250 2:4674534-4674556 CTTGGCACCCAAAGTCTGGAAGG - Intergenic
932216394 2:69969072-69969094 CTTGACAGGCAGTTTCTAGAAGG + Intergenic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
934510388 2:94934860-94934882 CTTGCCACTCAAACTCTAGATGG + Intergenic
935194784 2:100806676-100806698 CTTTGCACGAGGACTCTGGAAGG - Intergenic
940429841 2:153576289-153576311 CTGGGCCCGCAGACTGTGGATGG - Intergenic
944355029 2:198777688-198777710 CTTCAGACACAGACTCAGGAGGG + Intergenic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
946301780 2:218828357-218828379 CTGGCCATGCAGACTCCGGATGG + Intronic
948027625 2:234790533-234790555 ATTGAAACACAGACACTGGATGG - Intergenic
1173522517 20:43710308-43710330 CGTGACACTCAGCCTCAGGATGG + Intronic
949097815 3:106812-106834 CTTGACACACAGAATCTGTTGGG + Intergenic
950750189 3:15122369-15122391 CTTGACACTCAGTCACTGGCTGG + Intergenic
957567955 3:81908681-81908703 CTTGTCATGCAGCCTCTGAAAGG + Intergenic
958161269 3:89818908-89818930 CTTGACACCCAAAGTCTGGAGGG + Intergenic
959459743 3:106610625-106610647 CTTGAGACGCAGTCCCTGGGTGG - Intergenic
959900341 3:111654062-111654084 CTTGGCACCCAGACTTAGGAGGG + Intronic
961475701 3:127145105-127145127 AGAGACACACAGACTCTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963849806 3:150199887-150199909 CATGACAAGCAGACTCAGTATGG - Intergenic
964821367 3:160773922-160773944 CTTGAAACCCAGACTCATGAAGG - Intronic
969659161 4:8516306-8516328 CTTGGCACGCAGAGCCTGAAGGG - Intergenic
972284375 4:37634276-37634298 CTTAACAGACAGACACTGGAGGG + Intronic
978580250 4:110224763-110224785 AATGGCACGCAGAGTCTGGAAGG - Intergenic
980876393 4:138666532-138666554 CAAGACACTCAGACTCAGGAAGG - Intergenic
993984522 5:94581930-94581952 CATAACACTCAGACTCTGAAAGG - Intronic
997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG + Intronic
997597126 5:135114516-135114538 ATTCACAGACAGACTCTGGAGGG + Intronic
1002377105 5:178796659-178796681 GATCACACGCAGACTCAGGAGGG - Intergenic
1009327868 6:62376148-62376170 CTTGAAAAGCAGTCCCTGGATGG + Intergenic
1015407328 6:132852627-132852649 CTTGATATGCAGGCCCTGGATGG + Intergenic
1016934723 6:149441177-149441199 CTGCACTCACAGACTCTGGAAGG + Intergenic
1017709093 6:157150203-157150225 TTTGGCACGCAGCCTTTGGAGGG + Intronic
1018494582 6:164337006-164337028 CATGATCCGCAGATTCTGGACGG + Intergenic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1022836176 7:34117510-34117532 CTTGATACGCAGTCTCTCTAGGG + Intronic
1023625450 7:42110999-42111021 CTAGAGATGCAAACTCTGGAAGG + Intronic
1025209622 7:57013298-57013320 CTGGAAACGCCGTCTCTGGAAGG + Intergenic
1025209786 7:57013911-57013933 CTGGGCACGCACACTCTGGCGGG + Intergenic
1025662167 7:63562940-63562962 CTGGGCACGCACACTCTGGCGGG - Intergenic
1025662331 7:63563553-63563575 CTGGAAACGCCGTCTCTGGAAGG - Intergenic
1030991995 7:116312112-116312134 CCTGACACACAGACTCAGGCTGG + Intronic
1038680677 8:29664236-29664258 CTGGATACGAAGACTCAGGATGG - Intergenic
1041970349 8:63734113-63734135 CTGGACACGCAGATTCTAAAGGG + Intergenic
1043734770 8:83729574-83729596 TTTGACCCTCAGACTCTAGAAGG - Intergenic
1048060481 8:130914815-130914837 CTAGACACTCGGATTCTGGAGGG + Intronic
1048430232 8:134363490-134363512 CTTGACACCAAGCATCTGGAGGG + Intergenic
1049246406 8:141565147-141565169 CTGGCCACGCAAACTCTTGAGGG - Intergenic
1049497166 8:142941466-142941488 CTGGAAACGCAGACTCAGGCTGG - Intergenic
1053025600 9:34725988-34726010 CTTGTCCCCCAGACTGTGGATGG + Exonic
1053037128 9:34835050-34835072 CTTGTCCCCCAGACTGTGGATGG + Intergenic
1053655003 9:40209489-40209511 CTTGCCACTCAAACTCTAGACGG - Intergenic
1053905389 9:42838694-42838716 CTTGCCACTCAAACTCTAGACGG - Intergenic
1054367118 9:64355705-64355727 CTTGCCACTCAAACTCTAGACGG - Intergenic
1054529596 9:66166826-66166848 CTTGCCACTCAAACTCTAGACGG + Intergenic
1054674747 9:67845446-67845468 CTTGCCACTCAAACTCTAGACGG - Intergenic
1061378622 9:130240986-130241008 GTTGACACAGAGACTCAGGATGG - Intergenic
1185740044 X:2524372-2524394 CTTGACTGACAGACCCTGGATGG + Intergenic
1186454470 X:9700230-9700252 CTAGACACGCAGACCCCGGGGGG + Intronic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1190998782 X:55637508-55637530 CTTGGCACCCAAATTCTGGAGGG - Intergenic
1197595811 X:128462924-128462946 CTAGAGATGCAGACTCTAGATGG + Intergenic
1198038830 X:132828500-132828522 TTTGACAGGCAGTCTCTGAAGGG - Intronic
1202118584 Y:21500727-21500749 CTTCACACACACACACTGGAAGG - Intergenic
1202121036 Y:21524267-21524289 CTTCACACACACACACTGGAAGG - Intronic
1202123487 Y:21547808-21547830 CTTCACACACACACACTGGAAGG - Intronic
1202155521 Y:21881573-21881595 CTTCACACACACACACTGGAAGG + Intronic
1202157969 Y:21905114-21905136 CTTCACACACACACACTGGAAGG + Intronic