ID: 997523489

View in Genome Browser
Species Human (GRCh38)
Location 5:134538126-134538148
Sequence GTGAGCTGCCCTGCGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997523486_997523489 1 Left 997523486 5:134538102-134538124 CCCAGAGATCTGTGGGGAGTGAG 0: 1
1: 0
2: 1
3: 29
4: 247
Right 997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 131
997523480_997523489 28 Left 997523480 5:134538075-134538097 CCCTCCGAGGTGGGTAGTGATGA 0: 1
1: 0
2: 0
3: 12
4: 65
Right 997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 131
997523487_997523489 0 Left 997523487 5:134538103-134538125 CCAGAGATCTGTGGGGAGTGAGA 0: 1
1: 0
2: 3
3: 17
4: 232
Right 997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 131
997523482_997523489 24 Left 997523482 5:134538079-134538101 CCGAGGTGGGTAGTGATGAGCTT 0: 1
1: 0
2: 1
3: 13
4: 100
Right 997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 131
997523481_997523489 27 Left 997523481 5:134538076-134538098 CCTCCGAGGTGGGTAGTGATGAG 0: 1
1: 0
2: 0
3: 9
4: 80
Right 997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997523489 Original CRISPR GTGAGCTGCCCTGCGGAGAC TGG Intronic
900136411 1:1119109-1119131 GTGAGCTGCCGTGCCCAGCCCGG + Intergenic
901174265 1:7287215-7287237 GTGAGCAGCCAGGGGGAGACAGG + Intronic
902463704 1:16601060-16601082 GTGAGCTGCCCTGCCCTGAGTGG + Intronic
904490978 1:30858857-30858879 GTGGGCAGCCCTTCTGAGACTGG + Intergenic
908055509 1:60281807-60281829 TTGATCTGCCCTGGGGAGAAAGG - Intergenic
912379675 1:109240598-109240620 ATGAGCTGCCCTGCCCAGCCTGG - Intergenic
916609866 1:166381097-166381119 GTGAGCTGCTCTTCTGAGATGGG + Intergenic
917096425 1:171403481-171403503 GTAAGCTTCCCTGCTGAGAAGGG - Intergenic
920372998 1:205491617-205491639 GTGTGCTGTCCTGAGGAGAACGG - Intergenic
920970770 1:210742024-210742046 GTGAGCTGCCAGGCTGAGTCAGG + Intronic
921905023 1:220487084-220487106 GTGAGCAGCCCTTCAGTGACTGG - Intergenic
922754902 1:228090321-228090343 GTCAGAAGCCCTGTGGAGACAGG + Intronic
922852709 1:228747543-228747565 GTCAGCTGCCCTGTGGAGGCCGG - Intergenic
1065342439 10:24721166-24721188 GTGAGCTGCTCTGGGGTGTCAGG - Intronic
1069532522 10:69229749-69229771 GTGAGAGGCTCTGCGGAGACGGG - Intronic
1069942708 10:71965885-71965907 GTGGGCTGGCCTTGGGAGACTGG + Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1072219189 10:93313548-93313570 CTGAGCTGCCCTGAGCAGAGAGG + Intronic
1073066421 10:100762079-100762101 GTGAGCCGCCATGCCGAGCCTGG - Intronic
1073162419 10:101410332-101410354 GTGAGCCACCCTGCGCAGCCAGG - Intronic
1077413309 11:2413440-2413462 GTGAGCTGCCCGGCCAGGACAGG - Intronic
1083144721 11:60749688-60749710 CTGAGCTGCCCTGAGCAGCCAGG - Intergenic
1083858148 11:65404113-65404135 TGGAGTGGCCCTGCGGAGACTGG - Intronic
1084020477 11:66414255-66414277 TTGACCTGCCCTGGGGAGGCTGG - Intergenic
1084557956 11:69886027-69886049 GAGAGCTTCCCAGAGGAGACAGG - Intergenic
1084906504 11:72352353-72352375 GTAAGCTGTGCTGAGGAGACTGG - Intronic
1089791907 11:120951736-120951758 GTGGGCTGCCCACTGGAGACAGG - Intronic
1091664894 12:2411956-2411978 CTGAGCTGTCCTGTGGAGCCAGG + Intronic
1094494923 12:30983151-30983173 GTGAGTTGCAGTGCGGGGACTGG + Intronic
1095952989 12:47791547-47791569 GTAAGCTGGCATGGGGAGACAGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1100394395 12:94171908-94171930 CTGAGCTGCCCTAGGGAGCCTGG - Intronic
1101930513 12:109009973-109009995 GTGAGCTACCCTGCCCAGGCTGG - Intronic
1101998003 12:109538874-109538896 GTGAGGTGCCCTGAGGCCACAGG - Intergenic
1102695815 12:114798539-114798561 GTGAGCTGCCCAGCTGACAAAGG + Intergenic
1104804206 12:131574565-131574587 GTGAGCTACCCCCCCGAGACAGG - Intergenic
1111479772 13:88809718-88809740 GTGAACTGTCCTGGGGAAACTGG + Intergenic
1113853515 13:113431311-113431333 GTGACACGCCATGCGGAGACAGG + Intronic
1118468894 14:66056754-66056776 GAGAGCAGCCCAGCAGAGACCGG + Intergenic
1122870035 14:104634305-104634327 GGCAGCTGCCCTGTGGGGACAGG - Intergenic
1124618001 15:31256498-31256520 GCCAGCTGCCCTGGGGAGCCCGG + Intergenic
1125506329 15:40269835-40269857 GGGACCTGGCCTGTGGAGACAGG + Intronic
1128806168 15:70532774-70532796 GTGTCCTGCCCTACAGAGACTGG - Intergenic
1133192845 16:4147131-4147153 GTGAGCTGCCATGCCGGGCCTGG + Intergenic
1133211572 16:4266092-4266114 GTGGGCTGCCTTGCGGGGAAGGG - Intronic
1133300202 16:4777858-4777880 GTCAGCTGTCCTGGGGAGGCCGG + Exonic
1136071005 16:27787091-27787113 CTGCGCTGCCCTGAGCAGACAGG - Intergenic
1137541131 16:49362554-49362576 CTGAGATGCCCTGCTGAGACAGG + Intergenic
1137715742 16:50597263-50597285 GGGAGCTGCCCTGTGTACACAGG + Intronic
1140457675 16:75114455-75114477 GCGGGCTGCCCTGCAGAGACCGG - Intronic
1141398729 16:83727814-83727836 CTGGGCTGCCCTGCTGTGACTGG - Intronic
1143106431 17:4532742-4532764 GTGGGCTGCCCTGCAGGGACAGG - Intronic
1146642349 17:34550790-34550812 GGGAGCTGCCCTGGGGAATCTGG - Intergenic
1146675197 17:34768461-34768483 GTGAGGTCCCCTGGAGAGACAGG - Intergenic
1150440616 17:65188372-65188394 TTGAGCTGCCCTGTGGAATCAGG - Intronic
1152234179 17:79129990-79130012 AGGGGCTGCCCTGCGGGGACCGG + Intronic
1152841594 17:82572383-82572405 GTGGGCTCCCCGGCTGAGACAGG - Intronic
1154162802 18:11992406-11992428 GCCAGCTGCCCTGCAGTGACTGG + Intronic
1157293330 18:46425180-46425202 GAGAGCTGGCCTGAGGAGGCGGG + Intronic
1160703554 19:518876-518898 GAAGGCGGCCCTGCGGAGACGGG - Exonic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1161327827 19:3671950-3671972 GCGAGCCGCGCTGCGGAGCCGGG + Intronic
1162954267 19:14089833-14089855 TTGCGCTGCCCCGCGGGGACAGG - Exonic
1165160777 19:33814434-33814456 CTGTGCTGCCCTGAGGGGACAGG - Intronic
1167719240 19:51167442-51167464 GTGAGTGGCCCTGGGGAGAGGGG + Intergenic
1202679365 1_KI270711v1_random:38500-38522 GTGAGCTGCCCTGCCCTGAGTGG + Intergenic
925361027 2:3280448-3280470 GTGAGTGGCCCTGGGAAGACTGG + Intronic
926325322 2:11780161-11780183 GTGAGCTGCCGTGCCCAGCCAGG + Intronic
929042560 2:37759640-37759662 GTGAGCTGACCAGCTGAGAAGGG - Intergenic
935801518 2:106701820-106701842 GTCAGCTGCCCTTCAGACACTGG - Intergenic
947860859 2:233356094-233356116 GAGACCTGCCCTGGGGAGGCAGG + Intronic
1168932718 20:1636839-1636861 GTGAGCTCTCCTGGGGAAACAGG - Intronic
1171249996 20:23639628-23639650 GTGAGAAGCCCTGCCTAGACAGG + Intergenic
1172527064 20:35606295-35606317 GTGAGTAGGCCTGGGGAGACAGG - Intergenic
1172599681 20:36175224-36175246 ATGTGCTGCTCTGGGGAGACAGG + Intronic
1172618983 20:36307227-36307249 GTGCGGCGCCCCGCGGAGACAGG + Intronic
1173217950 20:41104288-41104310 GACTGCTGCTCTGCGGAGACTGG + Intronic
1179883278 21:44302271-44302293 GTGAGCTCCCATGCGTGGACAGG + Intronic
1179987423 21:44929425-44929447 GTGAGCTGCGATGCGGAGGTGGG + Intronic
1180142382 21:45900299-45900321 GTGAGCTGCCATGGGGAGTCAGG + Intronic
1180764145 22:18233995-18234017 GTGAACTGCCCTGCTGAGAGTGG + Intergenic
1180771498 22:18390546-18390568 GTGAACTGCCCTGCTGAGAGTGG - Intergenic
1180802879 22:18640161-18640183 GTGAACTGCCCTGCTGAGAGTGG - Intergenic
1181218839 22:21355100-21355122 GTGAACTGCCCTGCTGAGAGTGG + Intergenic
1181366076 22:22377969-22377991 GTGAGCTGCCATGCCCAGCCAGG - Intergenic
1182832255 22:33313614-33313636 GTGGGCTGCCCTGCAGGGAGGGG + Intronic
1183112407 22:35660047-35660069 GTGAGCTACCCTGCCCAGCCGGG + Exonic
1183732763 22:39627904-39627926 GGGAGCAGCCCTGGGGAAACTGG - Intronic
1184294988 22:43517438-43517460 GTGAGGTGCTCTGCTGAGCCTGG + Intergenic
1185101264 22:48842106-48842128 CAGAGCTGCCCTGCGGGGGCTGG + Intronic
1203233336 22_KI270731v1_random:131537-131559 GTGAACTGCCCTGCTGAGAGTGG - Intergenic
1203294745 22_KI270736v1_random:31136-31158 GTGAGCTGACCAGCTGAGAAGGG - Intergenic
950008592 3:9706356-9706378 GGGAGCTTCCCTGTGGAGAGGGG - Intronic
953133375 3:40161937-40161959 GTGAGGTGACCTGGGGACACAGG - Intronic
956609425 3:71107122-71107144 GTGGGCTGTCCTGGGCAGACTGG + Intronic
960348231 3:116561348-116561370 GTGAACTGGCCTGAGAAGACAGG + Intronic
961319227 3:126061430-126061452 GGGAGCGGCCCTGCGGAGGGAGG - Intronic
961513009 3:127414621-127414643 GTGGGAAGCCCTGGGGAGACAGG - Intergenic
967182394 3:186917796-186917818 CTGAGCTGCCCTGCTGAGTCTGG + Intergenic
967827330 3:193888033-193888055 GTGAGCTGTTCTGGGGAGGCGGG - Intergenic
968910618 4:3475476-3475498 GTGTGCTGACCTGGGAAGACAGG + Intronic
969903736 4:10373709-10373731 GTGAGCAGCTCTGCAGTGACAGG + Intergenic
972796922 4:42430451-42430473 GCGAGCTGGCCTTCGGAGACAGG - Intronic
974901253 4:68001284-68001306 GTGAGCTGCCATGCCCAGCCAGG + Intergenic
975163580 4:71151634-71151656 GTGAGCCACCATGCGCAGACAGG - Intergenic
990139933 5:52691341-52691363 GTCAGCTGCCCTCTGCAGACTGG + Intergenic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
999188292 5:149729155-149729177 GTGAGCGGGCCTGCGGAGGCTGG + Intergenic
999248824 5:150169506-150169528 GTCAGATGCCCTGGGAAGACAGG - Intronic
1001400535 5:171443875-171443897 GTGCGGAGCCCTGGGGAGACAGG + Intronic
1002139984 5:177132750-177132772 GTGAGCGGCTCTGGGGAGCCGGG - Intergenic
1002204470 5:177553622-177553644 GTGGGCTGCCTTGCGGAGCAGGG + Intronic
1005124729 6:22433742-22433764 GTGAGCTGCCATGTTGAGAGGGG - Intergenic
1005375784 6:25181155-25181177 GTGAGCGGGTCTGGGGAGACAGG - Intergenic
1006717859 6:36131430-36131452 GGGGGCTGCCCTGGGGAGTCAGG + Intronic
1006791779 6:36706180-36706202 GTGAGCTGCCATGCCCAGGCTGG + Intronic
1006874143 6:37280645-37280667 ATGAGCTGCCCTGTGCAGCCAGG + Intronic
1008771305 6:54982029-54982051 GTAAGCTGCCATGTGGAGAGAGG - Intergenic
1016536712 6:145114655-145114677 GTGATCTGACCTGGTGAGACAGG + Intergenic
1016588389 6:145715716-145715738 GTGAACTGCACTTGGGAGACAGG + Intronic
1019348795 7:543472-543494 GTGAGCTGGCCTCTGGGGACTGG - Intergenic
1019429934 7:994065-994087 GTGAGCAGACCTGTGGAGACTGG - Intergenic
1019443331 7:1058450-1058472 AAAAGCTGCCCTGCGGGGACCGG + Exonic
1023621695 7:42079628-42079650 GTGCGATGCCCTGAGGAGATGGG - Intronic
1026978893 7:74515341-74515363 CTGTGCTGAGCTGCGGAGACTGG - Exonic
1034834918 7:154343332-154343354 GTGAGATGCCCCTTGGAGACAGG - Intronic
1037014298 8:13883318-13883340 GGAAGCTGACCTGTGGAGACTGG - Intergenic
1037524679 8:19713215-19713237 GTGAGCCGCGCTGGGCAGACAGG + Intronic
1038266575 8:26043252-26043274 GGGAGCTGCCCTGCGGCGCTGGG + Intronic
1038495528 8:27999453-27999475 GTGAGCTGTGCTGGGGAGTCTGG - Intergenic
1038899433 8:31825905-31825927 TTGAGCTACATTGCGGAGACAGG + Intronic
1038899740 8:31828986-31829008 TTGAGCTACAATGCGGAGACAGG + Intronic
1040515835 8:48134054-48134076 GTGAGCTGCCGTGCCCAGCCAGG + Intergenic
1041047450 8:53900929-53900951 GTGAACAGCCCTGCCGTGACTGG - Intronic
1043085019 8:75819206-75819228 GTGAGCTGCCATGCCGTGAGAGG - Intergenic
1049729388 8:144168094-144168116 GTCAGGTGCACTGCGGTGACAGG - Intronic
1052376914 9:27728135-27728157 GTCAGCTGCCCTTAGGATACTGG + Intergenic
1056705978 9:88953113-88953135 GAGAGCTGCCCTGAGCAGAGTGG - Intergenic
1061359523 9:130132165-130132187 GTGAGCTGCCCTGGGAATACAGG + Intronic
1062035325 9:134380268-134380290 GTGAGCTGGCGTGCTGAGGCTGG + Intronic
1062106452 9:134757574-134757596 GTGAGGTGGCCTGGGGTGACAGG + Intronic
1062265026 9:135683109-135683131 GTGGGCTGGCCGGCGGGGACAGG - Intergenic
1185462265 X:338887-338909 GTGATCTTCCCTGCGGGGAGGGG + Exonic
1192043803 X:67650874-67650896 ATGAGGTGCTCTGCAGAGACAGG - Intronic
1192098078 X:68234376-68234398 ATGAGGTTCCCTGCTGAGACGGG + Intronic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1199979704 X:152914222-152914244 GTGAGCAGCCCTGGGCAGGCAGG + Intergenic
1199983297 X:152932972-152932994 GTGAGCTGCCCGGGGGAGGCAGG + Intronic
1200207309 X:154326227-154326249 GTGGGCAGACCTGGGGAGACTGG - Intronic