ID: 997524547

View in Genome Browser
Species Human (GRCh38)
Location 5:134543970-134543992
Sequence GGAGGTGTGAAGGACAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997524542_997524547 -10 Left 997524542 5:134543957-134543979 CCCCGGACTTGCCGGAGGTGTGA 0: 1
1: 0
2: 0
3: 3
4: 42
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225
997524541_997524547 -7 Left 997524541 5:134543954-134543976 CCACCCCGGACTTGCCGGAGGTG 0: 1
1: 0
2: 1
3: 7
4: 52
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225
997524535_997524547 26 Left 997524535 5:134543921-134543943 CCACAGGGGCTGGGGAATTAACA 0: 1
1: 0
2: 1
3: 38
4: 410
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225
997524540_997524547 -6 Left 997524540 5:134543953-134543975 CCCACCCCGGACTTGCCGGAGGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225
997524534_997524547 27 Left 997524534 5:134543920-134543942 CCCACAGGGGCTGGGGAATTAAC 0: 1
1: 0
2: 0
3: 13
4: 109
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225
997524538_997524547 -5 Left 997524538 5:134543952-134543974 CCCCACCCCGGACTTGCCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997524547 Original CRISPR GGAGGTGTGAAGGACAGTTC TGG Intronic
900325840 1:2108277-2108299 GGAGGTGAGCAGGACAGAACAGG - Intronic
901803665 1:11724322-11724344 GGAGGAGTGCAGGAGGGTTCAGG - Exonic
902128280 1:14236264-14236286 GGAGGTGTGAAGGTTCTTTCAGG + Intergenic
902583916 1:17426399-17426421 GGAGGTGGGAAGGACATTCTAGG - Intronic
902858175 1:19224560-19224582 GGAGGTGGGAAGGAGGGATCAGG - Intronic
903543572 1:24110144-24110166 GGAGGTGTGAAAGCCATTCCAGG - Intronic
905318454 1:37098452-37098474 GAGGGGGTGGAGGACAGTTCAGG - Intergenic
905879182 1:41452407-41452429 GTTGGTGAGCAGGACAGTTCGGG - Intergenic
907455430 1:54572452-54572474 GGGGCTGTGAAGGACAGACCCGG - Intronic
908324082 1:63006368-63006390 GGAGGTGAGTTGGACAGTTCTGG - Intergenic
908758526 1:67490945-67490967 GGAGGTGGGGAGGAGATTTCTGG + Intergenic
911733643 1:101314519-101314541 TGAGCTGTGGAGGACAGTGCTGG - Intergenic
915750465 1:158204716-158204738 GGAGCCATGAAGGAGAGTTCTGG - Intergenic
917967378 1:180187140-180187162 GGAGGTGGGAAGGAGGGATCAGG - Intronic
918344291 1:183592817-183592839 GGGATTGTGAAGGAAAGTTCTGG - Intronic
918441127 1:184568046-184568068 GGAGGTGTGCAGGAGTGTGCTGG - Intronic
919192143 1:194235227-194235249 AGAGATGTGAAGGACAATCCAGG - Intergenic
920699788 1:208209211-208209233 GGAGGTGAGAAGAACTGGTCTGG - Intronic
922011444 1:221592730-221592752 GGAGCCCTCAAGGACAGTTCAGG - Intergenic
922067570 1:222158771-222158793 GGAGGCAAAAAGGACAGTTCAGG + Intergenic
923520980 1:234734743-234734765 GGAGGGGTGAGGGGCAGCTCAGG + Intergenic
924324395 1:242881581-242881603 TGAGGTGTGAAAAACAGCTCTGG + Intergenic
1062846190 10:707687-707709 TGGGGTGTGAAGGGCAATTCTGG - Intergenic
1063177592 10:3566190-3566212 AGAGGTTAGAAGGACAGTTGTGG - Intergenic
1063697191 10:8348252-8348274 GGAGGTGTCAAGGACACTCCAGG + Intergenic
1064265482 10:13821900-13821922 GGAGGTGTGGCGGGCACTTCGGG - Intronic
1064885479 10:20106674-20106696 AGAGAGGTGAAGGAGAGTTCTGG - Intronic
1065372042 10:24997312-24997334 AGAGTTCTGGAGGACAGTTCTGG - Intronic
1065773625 10:29100160-29100182 GCAGGTGTGAACCACAGTGCTGG + Intergenic
1066757685 10:38727280-38727302 GGAGGGGTGAGGGATAGTACTGG + Intergenic
1067063002 10:43087674-43087696 GCAGGTGTGAAGGAAAATCCTGG - Intronic
1067146921 10:43700985-43701007 GGAGCTTTGGAGGACAGTCCTGG + Intergenic
1067431866 10:46250549-46250571 GTAGGTGTCAAGGAGTGTTCTGG - Intergenic
1070599707 10:77857161-77857183 GGAGGTGTGAAAGCCAGGTTGGG - Intronic
1072899134 10:99391999-99392021 GGAGGTCTGAAGATTAGTTCAGG + Exonic
1073477364 10:103763050-103763072 GGTGGTGTAATGGTCAGTTCAGG - Intronic
1075743418 10:124709897-124709919 GGAGAAGGGAATGACAGTTCCGG + Intronic
1076023067 10:127090057-127090079 GGAGGTGTGGGCGGCAGTTCTGG + Intronic
1077074593 11:694644-694666 GCAGGTGTGAGGGACAGGTGTGG + Intronic
1077701320 11:4444709-4444731 GGAGGTAGAAAGGACAGGTCAGG + Intergenic
1081031393 11:38088651-38088673 TGAGGTGGGAAGGACACTTAAGG + Intergenic
1081578556 11:44334959-44334981 GGGTGTGTGAAGGACCATTCGGG - Intergenic
1083199592 11:61112225-61112247 GGAGGTGGGAATGAGAGGTCAGG + Intronic
1083605161 11:63974347-63974369 GGAGGAGTCAAGAACAGTTTAGG + Intergenic
1090797857 11:130150733-130150755 GGAGCTGAGAAGGAGAGTTCTGG - Intergenic
1091020240 11:132092947-132092969 TGAGGTGGGAAGGCCAGTTAGGG - Intronic
1093521194 12:20051988-20052010 GGAGGTGTGAAAGAGAGTGGGGG + Intergenic
1094459079 12:30673860-30673882 AGAGGATGGAAGGACAGTTCTGG - Intronic
1094501038 12:31020940-31020962 GGAGGTTTGAGGGACAGGCCTGG + Intergenic
1095508598 12:42924990-42925012 AAAGGTGTGAAGGACAATACAGG + Intergenic
1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG + Intergenic
1096869279 12:54583348-54583370 GCAGATGTGAGGGACAGATCAGG - Intronic
1098202860 12:68075504-68075526 GGAGGTGGGGAGGACAGTCTGGG - Intergenic
1099419486 12:82438216-82438238 TGAGGTCTGAAAGACAGTACTGG - Intronic
1101190127 12:102324113-102324135 GGCAGTGGGAAGGACATTTCAGG + Intergenic
1102352089 12:112200462-112200484 GGAGGTGTGAAGAAAAGTCGGGG - Intronic
1103794933 12:123496815-123496837 GCAGCTGTGATGGACAGCTCTGG + Intronic
1104236970 12:126948277-126948299 GGGGGTCTGAATGTCAGTTCCGG - Intergenic
1104268464 12:127260361-127260383 TGAGGTGTGAAGGCCAGTACTGG + Intergenic
1107629281 13:42326960-42326982 GGAGGTGAGAAGGGCAGGTGGGG + Intergenic
1109404673 13:61881199-61881221 AGAGCTCTGAAGGACAGTTGTGG + Intergenic
1109703127 13:66053122-66053144 GGAGGTGTGAAGGAAAATGTAGG - Intergenic
1111656852 13:91164665-91164687 GGAAGTGAGAAGGACAGATGAGG - Intergenic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1117470462 14:56039412-56039434 AGAGGTGGGAAGGACAGTCTTGG - Intergenic
1121246358 14:92463792-92463814 GGAGGAGGGAAGGGCAGTTATGG - Intronic
1122163324 14:99802399-99802421 GCAGGTGGGAAGGGCAGTCCAGG + Intronic
1124722848 15:32125758-32125780 GCAGGTGTGGAGTACAGCTCAGG + Intronic
1129517000 15:76163013-76163035 GGAGGGGTGGAGAACTGTTCAGG - Intronic
1131005013 15:88970960-88970982 GGAGGTGTGAGGGAGAGGTGTGG - Intergenic
1131972292 15:97904569-97904591 TGAGGTTTGAAGGACTGGTCAGG + Intergenic
1133098078 16:3461096-3461118 GGAGGCTGGCAGGACAGTTCAGG + Intronic
1136463947 16:30429361-30429383 CGAGATGTTAAGGGCAGTTCAGG - Intronic
1136685203 16:31989969-31989991 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1136785814 16:32933504-32933526 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1136883955 16:33920300-33920322 GGAGGCGGGGAGGAAAGTTCTGG - Intergenic
1137731001 16:50690386-50690408 GGAGGAGTGAAGGGGACTTCTGG - Intergenic
1138162811 16:54771880-54771902 TGAGGGGTGATGGACATTTCAGG - Intergenic
1139113542 16:63921540-63921562 GGAAATGTGAAGGAAATTTCGGG - Intergenic
1139768594 16:69253983-69254005 GGAGGAGTGAAGGAAATTTCTGG + Intronic
1140212951 16:72985168-72985190 GAAGGTGACAAGGACAGTTTAGG - Intronic
1140712112 16:77688324-77688346 GGAGGGATGAAGGACAGTTTAGG - Intergenic
1141179594 16:81743488-81743510 GAAGGAGTGAGGGACATTTCCGG + Intronic
1203088048 16_KI270728v1_random:1195166-1195188 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1142695491 17:1630410-1630432 GAAAATGTGGAGGACAGTTCTGG - Intergenic
1142904698 17:3034072-3034094 GGAAGTGTGCAGCGCAGTTCTGG - Exonic
1143409808 17:6702113-6702135 GGAGGTGGAAAGGACAGGTCTGG - Intronic
1144146686 17:12405615-12405637 CGAGGTGTGCAGGTCACTTCAGG + Intergenic
1144346382 17:14353525-14353547 GGAGGGGTGGAGGACGGCTCTGG + Intergenic
1145740312 17:27268514-27268536 GGGGGAGTGAGGGACAGTTGGGG + Intergenic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1147146146 17:38485650-38485672 GGAGGCGGGGAGGAAAGTTCTGG + Intronic
1147506112 17:41019157-41019179 GGAGGTGGGTAGGATGGTTCAGG + Intronic
1148818782 17:50348315-50348337 AGAGGTGGGCAGGAGAGTTCAGG + Intronic
1150017961 17:61578535-61578557 AGAGGTGTTAAGGAGAGTTATGG + Intergenic
1152014585 17:77742018-77742040 GGAGGAGTGCAGGATAGTTTTGG + Intergenic
1152241318 17:79162817-79162839 GGAGGGGTAGAGGACAGCTCAGG + Intronic
1154300456 18:13186812-13186834 GGAGGTGAGAATGACTGATCTGG - Intergenic
1157790334 18:50525428-50525450 GAAGGTGTGATGGACAGAGCAGG + Intergenic
1158978751 18:62737905-62737927 GGAGGGGGGAAGGGCAGTTCAGG + Intronic
1160331445 18:77995790-77995812 TGGGGAGAGAAGGACAGTTCTGG + Intergenic
1160695572 19:482774-482796 GTAGGTGGGCAGGACAGTGCAGG - Intergenic
1161451847 19:4350657-4350679 GGATGTGGGAAGGGCAGATCTGG + Intronic
1162260869 19:9532860-9532882 AGAAGAGTCAAGGACAGTTCAGG - Exonic
1162490298 19:10987515-10987537 GCAGGTGTGAAGGACACCCCTGG + Intronic
1164366138 19:27583989-27584011 GGAGGTTGGAAAGACACTTCAGG + Intergenic
1164712213 19:30365309-30365331 GGAGGGGAGAAGGAAAGTTTGGG - Intronic
1166123974 19:40702779-40702801 GGAGCTGTGAGGGACAGCGCGGG - Intronic
1166874977 19:45891421-45891443 GGGGGTGAGAAGGATAGTTCTGG - Intronic
1168721514 19:58557294-58557316 GGAGGTGTGGAGCACAGCCCAGG - Intronic
925355435 2:3237955-3237977 CAAGGGGTGAAGGACATTTCTGG + Intronic
925425322 2:3744455-3744477 TGAGGTGTGAAGGACTGCCCTGG + Intronic
925613053 2:5719230-5719252 TGAGGTGTGAGAGACAGTTCTGG - Intergenic
927162539 2:20281271-20281293 GGAGGTGTGAAGGTTAGTTTTGG + Intronic
927448043 2:23183105-23183127 GGAGGTATGAAGGGCCTTTCTGG - Intergenic
928129245 2:28637751-28637773 GGAGGTGAGAAGGGCAATCCAGG - Intronic
932568091 2:72922020-72922042 AGAGGTGTGAAGGGCAGTGTGGG - Intronic
932638900 2:73421435-73421457 AGAGGGGTGAAGGACTGTTACGG + Intronic
934136142 2:88998022-88998044 GGAGGTGGGAAGGGGATTTCAGG + Intergenic
934173946 2:89563021-89563043 AGAAGTGGGAAGGACATTTCAGG + Intergenic
934284261 2:91637370-91637392 AGAAGTGGGAAGGACATTTCAGG + Intergenic
938681396 2:133694563-133694585 GGAGGTATAAGGGACACTTCCGG - Intergenic
940900537 2:159122616-159122638 ATAGGTTTGGAGGACAGTTCAGG - Intronic
941207155 2:162588169-162588191 AGAGGTGTGAAGGTCAGTAGTGG - Intronic
943794921 2:191980307-191980329 GAAGGTGTGAAGGGCAGGCCAGG + Intronic
945098208 2:206239369-206239391 GGAGGGGGGAAGGATAATTCAGG + Intergenic
945137113 2:206641304-206641326 GGAGGTCTGAAGAGGAGTTCTGG - Intergenic
945382288 2:209155326-209155348 GTGGGTGTGAAGGACATTTGGGG - Intergenic
1172770977 20:37382457-37382479 GGAGGGTTGAAGGATATTTCAGG + Intronic
1172778139 20:37420021-37420043 GGGGGTGTGGAGGGGAGTTCAGG - Intergenic
1172956077 20:38760203-38760225 GGAGGAGGGAAGGACATTTTAGG + Intronic
1176077921 20:63256998-63257020 TGAGGTGTGAAGGACAGTGACGG + Intronic
1179451121 21:41469095-41469117 GAAGGTGTGACGGAGGGTTCTGG - Intronic
1181000438 22:19985521-19985543 GGAGGTGAGAAGGACAGAGGGGG + Intronic
1182128212 22:27831724-27831746 GGAGGTGTGCAAGACAATTGGGG - Intergenic
1182338580 22:29601819-29601841 GGAAATGTGAATTACAGTTCCGG - Intergenic
1182556374 22:31131228-31131250 GGAGGTGGGAAGGACAGGATGGG - Intronic
1182923963 22:34105373-34105395 GGAACTCTGAAGAACAGTTCAGG + Intergenic
1183748151 22:39704124-39704146 GGAGGGGAGAAGGACAGTGCTGG + Intergenic
1183934219 22:41252960-41252982 GGAGGTGGGGAGGACAGCACGGG + Exonic
1184431272 22:44442627-44442649 GCAGGTGTGATGGACAGGCCTGG + Intergenic
1184627917 22:45752498-45752520 GCAGGTGTGTGGGACAGTGCAGG + Intronic
949142355 3:650113-650135 GCAGGTGTCAAGGACATTGCAGG - Intergenic
950189581 3:10967236-10967258 GGAGGGGTGAAGGGCATTGCAGG + Intergenic
950528467 3:13538824-13538846 GGAGGTGTGAATGACAAGTTGGG - Intergenic
951136477 3:19108884-19108906 AGATGCGTGAAGAACAGTTCAGG + Intergenic
953780661 3:45867381-45867403 GCAGGAGCCAAGGACAGTTCTGG - Intronic
954590748 3:51779285-51779307 GGAGGTGTGACTAACAGTTGAGG - Intergenic
954612797 3:51955223-51955245 GGAGGGGTGGAGGACAGAGCAGG - Intergenic
955575988 3:60363813-60363835 GAAGGAGGGAAGAACAGTTCAGG + Intronic
956506354 3:69944348-69944370 TGAGGGGAGAAGGACAATTCAGG + Intronic
961333213 3:126155057-126155079 CAAGGTGTGAGGGACAGTGCGGG - Intronic
961408985 3:126704607-126704629 GGAGGAGTGAAGAACTGTACAGG + Intronic
962086629 3:132198341-132198363 GGAAGTGGGAAGGAAGGTTCAGG - Intronic
962573102 3:136731093-136731115 GGAGATGAGAATGACATTTCAGG - Intronic
963635309 3:147787466-147787488 AGATGTGTGAAGGACAGGTAAGG - Intergenic
963859482 3:150293747-150293769 GGAGGTTTGAAGTACAGTAGGGG + Intergenic
964086641 3:152826971-152826993 GTATGTGTGAAGGACAGTAGTGG - Intergenic
964090609 3:152872054-152872076 GGATGTGGGAAGGACAGTCCAGG + Intergenic
966415528 3:179685958-179685980 GGAGTTCTGGAGGACAGTTAAGG - Intronic
966772941 3:183520105-183520127 GAGGCTGTGAAGGAGAGTTCTGG + Intronic
967983420 3:195078752-195078774 GGAGGTGGGGAGGACAGCTCTGG - Intronic
969119859 4:4900138-4900160 GGAGGTGTGGTGGGCAGTTCTGG + Intergenic
969856688 4:10005507-10005529 TGCAGTGTGAAGGACATTTCAGG + Intronic
969857324 4:10010762-10010784 TGAGGTGGGCGGGACAGTTCAGG - Intronic
972250467 4:37294484-37294506 GGAGGTGAGATGGACATTTGGGG - Intronic
975170501 4:71227247-71227269 GAAGGTGTGGTGGACGGTTCAGG + Intronic
976609834 4:87019027-87019049 GTATGTGTGAAGGACTGTTATGG + Intronic
978334219 4:107648483-107648505 TGGGATGTGAAGCACAGTTCTGG - Intronic
979805911 4:124970933-124970955 GGAAGTCTGAAGGACTGTTGGGG + Intergenic
982633619 4:157864721-157864743 AGGGGTGAGAAGGAAAGTTCAGG - Intergenic
984398225 4:179227550-179227572 AGAGGTGTGAAGGACAGCACTGG - Intergenic
984891095 4:184493779-184493801 GAAGTTGTGAAGCAGAGTTCTGG + Intergenic
986420690 5:7578436-7578458 GAAGGTGTGAAAGATATTTCAGG - Intronic
988820975 5:34885294-34885316 GGAGGTGTAAAGAACATTACTGG + Intronic
989153125 5:38319592-38319614 GGAGGTGTGAACAACACTCCCGG + Intronic
989255634 5:39363249-39363271 GGAGGGATGAAGGAAAGGTCTGG + Intronic
990743008 5:58931662-58931684 GGAGATGTGTGGGACAGTTGGGG - Intergenic
994845222 5:104980233-104980255 GATGGTGGGAAGGACAGTTGAGG - Intergenic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
999298453 5:150475303-150475325 GTAGGTGTGAAGGGCCGTCCAGG - Intergenic
1000263277 5:159610762-159610784 GGAGGGGTGCTGAACAGTTCAGG + Intergenic
1001960949 5:175880188-175880210 GGAGGTGTGAGGGAGAGCTGAGG - Exonic
1002049570 5:176562452-176562474 GGCAGTGTGAGGGAGAGTTCTGG + Intronic
1002888558 6:1316016-1316038 AGAGGTGGGAAGGACAGAGCTGG - Intergenic
1006220735 6:32488357-32488379 GGAGGAGTGGAAAACAGTTCTGG - Intergenic
1007582057 6:42965675-42965697 GGAGGAGTGATGGACAGGTAGGG - Exonic
1009057408 6:58353509-58353531 GGATGTATGGAGGCCAGTTCTGG + Intergenic
1009233819 6:61098062-61098084 GGATGTATGTAGGCCAGTTCTGG - Intergenic
1010166909 6:72925724-72925746 GCAGGAGTGAAGGATTGTTCTGG + Intronic
1016922909 6:149313845-149313867 GGAGGTGTGGGGAGCAGTTCTGG + Intronic
1016936833 6:149454153-149454175 GGAGGAGAGAAGGGCAGATCAGG - Intronic
1018669145 6:166165687-166165709 GGAGGTGAGAAGGACAGAGGCGG - Exonic
1019530921 7:1502996-1503018 GGGGGTGTGGAGGAGAGTTTGGG + Exonic
1020082878 7:5296144-5296166 GGAGGTCTGCAGGACAGGGCCGG - Intronic
1020378434 7:7514746-7514768 GGAGGTGGGAAGGGAAGTTGGGG - Intronic
1020976695 7:15015561-15015583 GGAGGAGTGAAGGAAAGGTGAGG - Intergenic
1021407723 7:20292494-20292516 GGAGGTGGGAAGGGAACTTCTGG + Intergenic
1021427543 7:20519677-20519699 GGAGGAGTGAAATACAGCTCTGG + Intergenic
1021636656 7:22700541-22700563 GAAGGTGTGAAGGACCTTTCAGG - Intergenic
1022121033 7:27308260-27308282 GGAGGTGGGAGGGATAGTTTAGG - Intergenic
1022742062 7:33131623-33131645 ACAGGTTTGAAGGTCAGTTCTGG - Intronic
1023347889 7:39290206-39290228 GGAGTTGTGAAGAGCAATTCAGG - Intronic
1024544816 7:50508344-50508366 GGAGGGGTAGGGGACAGTTCAGG + Intronic
1024988355 7:55214645-55214667 GGAGGTTTTAAGGACATTACTGG - Intronic
1025211390 7:57021044-57021066 GGAGGTCTGCAGGACAGGGCCGG + Intergenic
1025660563 7:63555803-63555825 GGAGGTCTGCAGGACAGGGCCGG - Intergenic
1026494302 7:70889102-70889124 GGAGATGGGAAGCACAGTTCAGG + Intergenic
1034315594 7:150128600-150128622 GGAGGAGTGAAGGACAGAAATGG - Intergenic
1034791295 7:153972205-153972227 GGAGGAGTGAAGGACAGAAATGG + Intronic
1035375157 7:158402766-158402788 GGTGGTGTCATGGACAGCTCTGG + Intronic
1035600767 8:895680-895702 GGTGGTGTGAAGGAGGGTTATGG + Intergenic
1035726198 8:1825377-1825399 GGTGGGGTGCAGGACAGTTGAGG - Intronic
1036398021 8:8385511-8385533 GGAGTTGTTAAGAATAGTTCAGG + Intronic
1036962610 8:13261559-13261581 GGAGGTGGGGAGGCCAGTTGAGG + Intronic
1037493697 8:19419315-19419337 GGGGGTGTGAAAGAGAGTCCTGG + Intronic
1037905521 8:22713951-22713973 GCAGGTGTGAAGGAAAGTAGTGG - Intronic
1038092480 8:24269731-24269753 GGAGGTGGGGGGCACAGTTCTGG - Intergenic
1040957049 8:52990058-52990080 GGAGTTGTGACAGACAGGTCCGG + Intergenic
1041634989 8:60132897-60132919 GGGGGTGAGAAGGACATTCCAGG - Intergenic
1042340804 8:67677031-67677053 GGCGTTGTGCAGCACAGTTCGGG - Intronic
1043449386 8:80351094-80351116 GGAGGTGTGGAGGGAAGTTGTGG + Intergenic
1044603878 8:94032429-94032451 GGAGGTGAGAAGAGCAGTCCTGG - Intergenic
1047844698 8:128793437-128793459 GGAAGTGAGAAGGACATTTCAGG - Intergenic
1048257711 8:132917691-132917713 GAAGGGGTGAAGGACATTTACGG + Intronic
1053052682 9:34975026-34975048 GGAGGTGTGGAGAGCAGTTGGGG - Intronic
1053518385 9:38752200-38752222 GCAGGTGGGAAGCACAGTGCAGG - Intergenic
1056557251 9:87700003-87700025 GTAGGAGGGAAGGAAAGTTCTGG - Intronic
1057304336 9:93903647-93903669 GCAGGTTGGAAGGACAGTTGGGG - Intergenic
1057419012 9:94893379-94893401 GGAGGAGTGAAGGAGGGGTCAGG + Intronic
1058191688 9:101924241-101924263 GGAGGCCTGAAGGACAGTCATGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060875052 9:127077217-127077239 GGAGGAGTGAAGGCCAGTTAGGG + Intronic
1062587190 9:137254738-137254760 GGAGCCGTGAAGGAGAGTCCAGG - Intergenic
1187784251 X:22866605-22866627 GAAGGTGTGAGGGACTGTGCCGG + Intergenic
1187987895 X:24834399-24834421 GTTGGTGTGAAAGACAGTTTTGG + Intronic
1189399142 X:40648796-40648818 GGAGTTGTGCAGCACAGTGCTGG + Exonic
1189726064 X:43969339-43969361 GGATGTGGGAAGGACAGACCGGG + Intronic
1192211955 X:69133317-69133339 TGAGGTGTGGAGGACAGGTGGGG - Intergenic
1192521875 X:71809257-71809279 TGAGGTGTGAGGGAGAGTTGGGG - Intergenic
1197870614 X:131059300-131059322 GGGGGAGTGAAGGACAGTGTGGG - Intronic
1198139497 X:133788663-133788685 GGAGATGAGAAGGAGAGTTTTGG - Intronic
1199041637 X:143121311-143121333 GCATGTGAGAAGGACATTTCTGG + Intergenic
1199458986 X:148061784-148061806 AGAGGTGGGAAGGATAGTTAGGG - Intergenic
1199459898 X:148072825-148072847 GGAGGGATGAAGGACAGTAATGG - Intergenic
1199980380 X:152917398-152917420 GGAGGTGTGAGGGCCTGGTCTGG + Intronic
1200214057 X:154359649-154359671 GGAGGAGTGCAGGCCAGGTCAGG + Intronic
1201013489 Y:9573812-9573834 GGGAGTGTGCAGGACAGTGCAGG - Intergenic
1201221938 Y:11780582-11780604 TGAGGTGTGAAAAACAGCTCTGG + Intergenic