ID: 997524614

View in Genome Browser
Species Human (GRCh38)
Location 5:134544318-134544340
Sequence GATGCAGGTGCTACACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997524612_997524614 -10 Left 997524612 5:134544305-134544327 CCTTTGTCAGCAGGATGCAGGTG 0: 1
1: 0
2: 0
3: 34
4: 265
Right 997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 193
997524606_997524614 11 Left 997524606 5:134544284-134544306 CCCTGTCCCTGGGGAGCTTGTCC 0: 1
1: 0
2: 4
3: 32
4: 291
Right 997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 193
997524608_997524614 5 Left 997524608 5:134544290-134544312 CCCTGGGGAGCTTGTCCTTTGTC 0: 1
1: 0
2: 1
3: 16
4: 159
Right 997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 193
997524607_997524614 10 Left 997524607 5:134544285-134544307 CCTGTCCCTGGGGAGCTTGTCCT 0: 1
1: 1
2: 0
3: 27
4: 308
Right 997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 193
997524609_997524614 4 Left 997524609 5:134544291-134544313 CCTGGGGAGCTTGTCCTTTGTCA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997524614 Original CRISPR GATGCAGGTGCTACACAGGA AGG Intronic
901340569 1:8495112-8495134 GATGGAGGCTCTACAGAGGACGG - Exonic
907077749 1:51593671-51593693 TATAGAGGTGCTACAGAGGAAGG - Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912639712 1:111333229-111333251 GATGCTGGTCCTGCACAGCAGGG - Intergenic
912934747 1:113993448-113993470 GATGCTGGTCCTGCACAGCAGGG + Intergenic
912975748 1:114328731-114328753 GATGCAGGTGCCCTACAGGAAGG - Intergenic
915606313 1:156953943-156953965 GATGGAGGTGCTATACTGAAGGG + Intronic
915793512 1:158701786-158701808 AATGCAGTTGTTACAAAGGAGGG - Intergenic
916604838 1:166330882-166330904 GATGGAGGCGCTACCCAGCAGGG - Intergenic
916638499 1:166700267-166700289 GTTGCAGGTCCAACACATGAGGG + Intergenic
921478373 1:215636047-215636069 GATGCAGCGGCCACACAGGCTGG + Intronic
923003847 1:230029403-230029425 ATCGCAGGTGCCACACAGGAAGG + Intergenic
923680306 1:236113404-236113426 GACGTACGTGCGACACAGGAGGG - Intergenic
924273182 1:242356238-242356260 GATTCAGGTGCTACACTGTTAGG + Intronic
1063161325 10:3420919-3420941 GATGCAGGTGGGACGCAGGTAGG + Intergenic
1064155619 10:12901018-12901040 GATACAGGTGCTCCAAAGAAGGG - Intronic
1066530059 10:36327824-36327846 GAGGCAGCTGGTACACAGGCTGG - Intergenic
1067472577 10:46547561-46547583 GATGCAGGGGTTAGACAGGTGGG - Intergenic
1067842258 10:49690400-49690422 GATGCAGATTTTACAGAGGAGGG - Intronic
1069298128 10:66872712-66872734 GATTCAGGTGGTACACGTGAAGG + Intronic
1069846394 10:71374713-71374735 GATCCAGGTTCTACACCAGAAGG - Intergenic
1072296021 10:94010125-94010147 GATGCAAGTGTGACACAGGATGG - Intronic
1072797405 10:98366457-98366479 GATGGAGGTGCTACAAGAGAGGG + Intergenic
1073338574 10:102728605-102728627 AGTGCAGGTGCTACCCAGGAAGG - Intronic
1073405025 10:103290033-103290055 AATGCAGATGCTACACAGTTGGG - Exonic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077560550 11:3257677-3257699 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077560570 11:3257776-3257798 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560579 11:3257820-3257842 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566449 11:3303516-3303538 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1079899262 11:26161024-26161046 GATGCAGGTGCTAGTCAGGATGG - Intergenic
1081641072 11:44754961-44754983 ATGGCAGGTCCTACACAGGAGGG + Intronic
1082889050 11:58118956-58118978 GGTGCAAGTGGTACGCAGGATGG + Exonic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1089015418 11:115161412-115161434 AATGCAGGTGCAGCACAGAAAGG + Intergenic
1090330199 11:125925379-125925401 AATGCAGCTGTGACACAGGATGG - Intergenic
1090908200 11:131095820-131095842 GATGCAGGTGCAACAGGGGAAGG - Intergenic
1093855925 12:24102155-24102177 GCAGCAGGTGCTACACAGGAAGG - Intergenic
1093880111 12:24394489-24394511 GATGCAGGGGCTAGACATCAAGG + Intergenic
1094635038 12:32218048-32218070 GCTGCAGCTGCTACACACAATGG - Intronic
1095563224 12:43590160-43590182 GATGCAGGTGACACGCAGAAGGG + Intergenic
1095972841 12:47915719-47915741 GATGTAGGTGCCAGACATGATGG + Intronic
1103197221 12:119055184-119055206 GATTTATGGGCTACACAGGAGGG + Intronic
1104107963 12:125681057-125681079 GATGCACCTGACACACAGGATGG + Intergenic
1106448971 13:29862680-29862702 GAAGCTGGTACCACACAGGAAGG - Intergenic
1117036907 14:51739524-51739546 GAAGTAGGTGCTTCCCAGGAGGG + Intergenic
1117273389 14:54167762-54167784 GATGAAGGTCCAAAACAGGAAGG + Intergenic
1119131246 14:72174925-72174947 CATTCAGTTGCTGCACAGGAAGG + Intronic
1123564865 15:21534528-21534550 GATGGATGTGTTACCCAGGAGGG - Intergenic
1127182283 15:56434188-56434210 GAAGCAGCTGGAACACAGGAGGG - Exonic
1129227853 15:74180220-74180242 GATGCAGCTGCTACAGACAAAGG - Exonic
1129572307 15:76700731-76700753 GTTCCTGATGCTACACAGGAGGG + Intronic
1129983485 15:79896373-79896395 GATGCAGGTGCTTTAGACGAGGG - Intronic
1132890170 16:2199842-2199864 AATGCAGGAGCTACTCAGGTTGG + Intergenic
1134056216 16:11171272-11171294 GAGGCAGGTGCTGCACACGGAGG - Intronic
1134634072 16:15778917-15778939 GAGGCAGATGGTACAGAGGATGG + Intronic
1135632206 16:24045325-24045347 AAGGCAGATGCTACACAAGATGG - Intronic
1137730679 16:50687372-50687394 GAGACTGGTGATACACAGGACGG + Intergenic
1138646965 16:58432581-58432603 GTTGCATGTGTTACAGAGGACGG + Intergenic
1139171944 16:64641120-64641142 GATGCAGCTGCTACAGAAAACGG - Intergenic
1139628829 16:68214500-68214522 TTTGCATGTGCTACAGAGGAGGG + Intronic
1141144750 16:81521227-81521249 GATGCAGAGGCCACTCAGGAAGG - Intronic
1141453338 16:84120287-84120309 GCTGCAGCAGCTACACAGCACGG + Intergenic
1141679737 16:85537083-85537105 GATGCAGAAGCGAGACAGGAGGG + Intergenic
1142854606 17:2722834-2722856 GATGCAGGACCCACACAGGAGGG + Intergenic
1143388410 17:6545768-6545790 GACACAGGTGCTGCACATGAAGG - Intronic
1143769316 17:9157906-9157928 GATGCAGGAGATAAACAGGAAGG + Intronic
1144079228 17:11747503-11747525 GATGCAGGTGAGTCACAGGCTGG + Intronic
1144721165 17:17470799-17470821 AATGCAGGTGCTAGCCTGGAAGG - Intergenic
1145924821 17:28638597-28638619 GATGGAGGTGCTAAAGATGATGG + Exonic
1151906339 17:77051822-77051844 TGTGCAGATGCTACACAGAAAGG - Intergenic
1152275297 17:79353068-79353090 GATGTATCTGCTGCACAGGAGGG + Intronic
1155276637 18:24194755-24194777 GATGCTAGTTCTACACTGGATGG + Intronic
1155734682 18:29205877-29205899 GATTCAGGTGATACACATGCAGG - Intergenic
1159666256 18:71163821-71163843 GATGCTGGTGCTCCCCAGGTGGG - Intergenic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1163262965 19:16202216-16202238 GAGGCAGGTGGTTCCCAGGATGG + Intronic
1165780309 19:38429548-38429570 GATGCAGGTGCTACAGGAGATGG - Intergenic
1166275746 19:41752661-41752683 GAGGCAGGAGAGACACAGGAAGG - Intronic
928200718 2:29246177-29246199 GATGCTGGTCCTAGACAGGTAGG + Intronic
928478342 2:31654327-31654349 GATGCAGGTTTTACACAGCAGGG - Intergenic
930095216 2:47561472-47561494 GCAGCAGGTGCCACACAGCAGGG + Intronic
930137799 2:47920047-47920069 GATGGCAGTGGTACACAGGAAGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
933047188 2:77553977-77553999 GTTGCAGGGGCTATACAGGCAGG + Intronic
933703535 2:85273284-85273306 ACTGCAGGTGAAACACAGGAGGG - Intronic
937252600 2:120534024-120534046 GATGCAGGGGTTGGACAGGATGG + Intergenic
937321787 2:120965402-120965424 GATGCAGGTGCTGCAGCAGAGGG + Intronic
937393103 2:121509604-121509626 GAGGCAGGTGGAACACACGAGGG + Intronic
938168493 2:129054532-129054554 GATGGCTGTGCTTCACAGGAAGG - Intergenic
938591267 2:132738436-132738458 GATGCTGGTGTTAAACAGTATGG - Intronic
940415627 2:153416853-153416875 GATTCAGGTGCTACAAAAGTTGG - Intergenic
942947301 2:181684213-181684235 GCTGCAGGTCCTGCACAGGCTGG + Intergenic
944214336 2:197239047-197239069 GAAGCAGATGCTACAGAGAATGG - Intronic
945713127 2:213325560-213325582 GATGTAGGTGTGACATAGGATGG + Intronic
946276755 2:218637295-218637317 CTTGCATGTGCTACATAGGAAGG + Intergenic
947926290 2:233925371-233925393 GTTGAAGGGGCTACACAGGCAGG + Intronic
948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG + Intronic
948343955 2:237279651-237279673 GATGCTGATGCTACAAAAGACGG + Intergenic
948461852 2:238133487-238133509 GATGCAGGTCCCACATGGGAGGG + Intergenic
1169252705 20:4072542-4072564 GATGCATGTCTTCCACAGGATGG - Exonic
1172116512 20:32576452-32576474 GCTGCAGCTGCTGTACAGGAAGG + Intronic
1172837982 20:37885203-37885225 GTTGCAGGTCACACACAGGAAGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178362285 21:31958573-31958595 GATGGAGGTGCTACACAGGCTGG + Intronic
1178870390 21:36369373-36369395 GCTTCAGCTTCTACACAGGAGGG - Exonic
1179921806 21:44511688-44511710 GAAGCAGGGGCTCCACTGGAAGG - Intronic
1180104495 21:45609103-45609125 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104507 21:45609160-45609182 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104519 21:45609217-45609239 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104542 21:45609330-45609352 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104554 21:45609388-45609410 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104566 21:45609446-45609468 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104577 21:45609504-45609526 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104588 21:45609562-45609584 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104617 21:45609735-45609757 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104629 21:45609793-45609815 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180104640 21:45609851-45609873 TGAGCAGGTGCTTCACAGGAGGG - Intergenic
1180594435 22:16964081-16964103 GAGGCAGCTGCTTCATAGGATGG - Intronic
1182078419 22:27511203-27511225 GATGTGGGTGTCACACAGGAAGG + Intergenic
1182213552 22:28696978-28697000 CATGAAGGTACTACACAGAAAGG + Exonic
1183027813 22:35079284-35079306 GCTGAAGCTGCTACAAAGGAGGG - Intronic
1184095088 22:42312135-42312157 GGTGCAGGAGCTACAGAAGAAGG + Intronic
1184519751 22:44986403-44986425 GATGCAGGTGGTAATGAGGATGG - Intronic
1184761264 22:46545968-46545990 GATGCTGTTGCTGGACAGGAGGG + Intergenic
949673003 3:6421872-6421894 CATGCAGATGCTACACTGGCCGG - Intergenic
950447433 3:13046473-13046495 GCAGCAGATGCTATACAGGAAGG - Intronic
957513573 3:81222000-81222022 GGTGCAGGTGATAAACAGGGAGG - Intergenic
957903650 3:86531088-86531110 GGTGCAGTTGCTGCTCAGGACGG - Intergenic
959119148 3:102212073-102212095 GGGGCAGCTGCTTCACAGGATGG + Intronic
960861200 3:122154963-122154985 GAAGCAACTGTTACACAGGAAGG + Intergenic
965642359 3:170843342-170843364 GCTGCAGGTGATAGACTGGAGGG - Intronic
966141818 3:176766246-176766268 CATGCAGCTGCTACACAGGGTGG - Intergenic
966931747 3:184679634-184679656 GAGTCAGGTGCTGCACAGAAGGG + Intronic
967955571 3:194875028-194875050 GGTGAAGGTGCCACACTGGATGG + Intergenic
968625053 4:1623284-1623306 GAGGAAGGTGCTGCCCAGGACGG - Intronic
968848729 4:3063119-3063141 GAAGTAAGTGCTACAAAGGAAGG + Intergenic
969408007 4:7007776-7007798 GATGCAGGGGCTGCAAAGCATGG - Intronic
971202600 4:24525166-24525188 GAATCAGGTGTTACACAGAAAGG + Intronic
972070453 4:35013244-35013266 GATGCAGGGGGTACACGTGAAGG + Intergenic
974298783 4:60038455-60038477 GCAGCAGGTGCTACACTGGTAGG + Intergenic
975676785 4:76835250-76835272 GATGAAGGGCCTACACAGAAGGG + Intergenic
975822733 4:78288363-78288385 GATGGAGGTGGTACAGAGGAAGG - Intronic
982281178 4:153684621-153684643 GAAGCAGGGGCTACACGGAAAGG + Intergenic
983991008 4:174119635-174119657 GATTCAGGGGCTACACATGCAGG - Intergenic
985268823 4:188175549-188175571 GAGGCAGGAGGAACACAGGAGGG + Intergenic
985672126 5:1212506-1212528 GCTGCAGGTGCTCCAGAGGGCGG + Intronic
985768751 5:1795969-1795991 GATGCAGGTGCACCACTGGGAGG - Intergenic
986200521 5:5574349-5574371 GCTGCAGGTGGTTCACAGCAGGG - Intergenic
988317226 5:29645896-29645918 GATTCAGGTGCTACATATGCAGG + Intergenic
988713541 5:33802461-33802483 GATGCCACTGCTCCACAGGATGG + Intronic
992058774 5:73020858-73020880 GATACAGGTGCTACACTTAATGG - Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
993609610 5:90038069-90038091 GAGGCAGTTGCTACACTGAATGG + Intergenic
994223321 5:97222072-97222094 CATGCTGGTGCTACATATGAGGG - Intergenic
994598907 5:101876503-101876525 GATCAAGGTGCCAGACAGGAAGG - Intergenic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
999498869 5:152126611-152126633 GATGCAGGTTCGGAACAGGAGGG - Intergenic
999657838 5:153828097-153828119 AATGCAGGTACCAGACAGGAGGG - Intergenic
1000060396 5:157651096-157651118 GATGCAGGTATTAGACAGCAGGG - Exonic
1000065395 5:157689918-157689940 GATGCAGGTATTAGACAGCAGGG - Intergenic
1000380308 5:160622929-160622951 TGTGCAGGTGATACATAGGAAGG - Intronic
1001630839 5:173174221-173174243 TCTGGAGATGCTACACAGGATGG + Intergenic
1002484206 5:179523643-179523665 GAAGCAGGTGTTGCCCAGGAGGG + Intergenic
1002799683 6:510314-510336 CATTCATGTGCTACATAGGAAGG - Intronic
1005773123 6:29097556-29097578 TATCTAGGTGCTCCACAGGAAGG + Intergenic
1006839180 6:37017451-37017473 GATGCAGGTGTAACAAAGGCTGG + Intronic
1007768650 6:44176617-44176639 GATGCAGCTGCTGCACAAGACGG + Exonic
1008201489 6:48596487-48596509 GATTCAGGGGGTACACATGAAGG + Intergenic
1012609607 6:101199708-101199730 GAAGCAGGTGTTACAAAGCAGGG + Intergenic
1015044242 6:128759832-128759854 GATGTTGGTCCTAGACAGGAGGG + Intergenic
1018889425 6:167972602-167972624 GATCCATGTGCTGCACAGCAGGG + Intergenic
1018933637 6:168259086-168259108 GATGCCTTTGCTACCCAGGACGG + Intergenic
1019335643 7:481299-481321 GCTGCAGGAGCTCCAGAGGAAGG + Intergenic
1020178551 7:5903007-5903029 GATGCAGGTAAAACACAGGGAGG - Intronic
1020304374 7:6821996-6822018 GATGCAGGTAAAACACAGGGAGG + Intronic
1020558006 7:9693576-9693598 GGTGCAGGTGCACCAGAGGATGG - Intergenic
1021235983 7:18142919-18142941 GATGCAGCTGTTACAACGGAAGG - Intronic
1022673301 7:32476109-32476131 GCAGTAGGTGCTCCACAGGAGGG - Intergenic
1023036712 7:36137568-36137590 GGGACAGGTGCTACCCAGGAAGG + Intergenic
1029732315 7:102446619-102446641 GATGCAGGTGCTGATGAGGAGGG - Exonic
1031434484 7:121715516-121715538 AATGCAGATGGTAAACAGGAAGG - Intergenic
1031759539 7:125694766-125694788 GAAGCAGCAGCTACCCAGGAAGG + Intergenic
1036561337 8:9902645-9902667 GATCCAGGAGCTGCAGAGGAAGG - Intergenic
1038489833 8:27962808-27962830 GATGTAGGCCCTGCACAGGAGGG - Intronic
1041795726 8:61745844-61745866 GATTCAGGTGGTACACATGCAGG + Intergenic
1042340413 8:67672871-67672893 GATGCAGGCATTACAGAGGAAGG + Intronic
1046833325 8:118771988-118772010 GATGTAGGTGCTTTACTGGAAGG + Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1050080985 9:1915758-1915780 GATGAAGGTGGTGCACAGGGAGG - Intergenic
1050151315 9:2621905-2621927 AATGCAGGCGCTGCAGAGGAGGG - Exonic
1055745222 9:79436894-79436916 GATTCAGGTGGTACACATGAAGG - Intergenic
1057070867 9:92098838-92098860 TATGCAGCTGCTACACAGGGTGG - Intronic
1059067124 9:111097053-111097075 GATGCAGGTGGCACACAACATGG + Intergenic
1060413934 9:123417848-123417870 CATGCATGGGGTACACAGGAAGG + Intronic
1060667340 9:125439736-125439758 GGTGCAGCTGCTACACAGAGTGG - Intronic
1060685844 9:125611156-125611178 AATACAGGTGCTACACATAAGGG + Intronic
1188826589 X:34842419-34842441 GATACATGTGCTAAACATGAAGG - Intergenic
1191628598 X:63296570-63296592 GATACAGGGGCTACACATAAAGG - Intergenic
1192091617 X:68164365-68164387 GATCCATGAGCTACACAGAATGG + Intronic
1192180302 X:68912084-68912106 GCTGAAGGGGCTACACAGGAAGG - Intergenic
1193799860 X:85922053-85922075 AATGCAGTTTTTACACAGGATGG + Intronic
1195412908 X:104588084-104588106 GAGGCAGGTGATACGCAGCATGG - Intronic
1196574546 X:117302711-117302733 GATGCAGGTGCTAGGCTGAAGGG - Intergenic
1197694273 X:129534018-129534040 AATGCAGGTGTCACAAAGGAAGG - Intergenic
1198859683 X:141055886-141055908 CATGCAGCTGCTACCCAGGGTGG + Intergenic
1198903010 X:141531504-141531526 CATGCAGCTGCTACCCAGGGTGG - Intergenic
1200012416 X:153128752-153128774 CATGCAGGTGCTCCTCAAGATGG - Intergenic
1200027183 X:153271167-153271189 CATGCAGGTGCTCCTCAAGACGG + Intergenic
1200037641 X:153343782-153343804 CATGCTGATGCTGCACAGGAAGG - Intronic