ID: 997525589

View in Genome Browser
Species Human (GRCh38)
Location 5:134551050-134551072
Sequence TTATGCAAACAGCTGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997525589_997525597 1 Left 997525589 5:134551050-134551072 CCGTCCCCCAGCTGTTTGCATAA 0: 1
1: 0
2: 3
3: 16
4: 210
Right 997525597 5:134551074-134551096 GTTTGCATAAGGCCTTTCCTGGG No data
997525589_997525598 2 Left 997525589 5:134551050-134551072 CCGTCCCCCAGCTGTTTGCATAA 0: 1
1: 0
2: 3
3: 16
4: 210
Right 997525598 5:134551075-134551097 TTTGCATAAGGCCTTTCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 164
997525589_997525595 -10 Left 997525589 5:134551050-134551072 CCGTCCCCCAGCTGTTTGCATAA 0: 1
1: 0
2: 3
3: 16
4: 210
Right 997525595 5:134551063-134551085 GTTTGCATAAGGTTTGCATAAGG No data
997525589_997525596 0 Left 997525589 5:134551050-134551072 CCGTCCCCCAGCTGTTTGCATAA 0: 1
1: 0
2: 3
3: 16
4: 210
Right 997525596 5:134551073-134551095 GGTTTGCATAAGGCCTTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 100
997525589_997525599 6 Left 997525589 5:134551050-134551072 CCGTCCCCCAGCTGTTTGCATAA 0: 1
1: 0
2: 3
3: 16
4: 210
Right 997525599 5:134551079-134551101 CATAAGGCCTTTCCTGGGGTTGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997525589 Original CRISPR TTATGCAAACAGCTGGGGGA CGG (reversed) Intronic
900553513 1:3268648-3268670 TAAGGCAGACAGCTGGGGAAGGG - Intronic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
904054764 1:27662812-27662834 TTAAGCAGATGGCTGGGGGAGGG - Intergenic
904073663 1:27823068-27823090 CTATGCAGACAGGTGGGAGAGGG - Exonic
904105824 1:28082341-28082363 TTAATCAAATATCTGGGGGAAGG - Intronic
907182790 1:52585644-52585666 TTATGCAACCAGCTGGCATATGG - Intergenic
907367314 1:53973050-53973072 TAATGCACACATCTGGAGGAGGG + Intergenic
910013745 1:82496213-82496235 TTATGAAAGCAGCTGTGGGTTGG - Intergenic
910135511 1:83963975-83963997 TTATACACACAACTGAGGGAAGG - Intronic
911205412 1:95087209-95087231 TTATTTAACCAGCTGGGGGCTGG - Intergenic
911575809 1:99576762-99576784 GTATGGAAACAGCTAGGGGAAGG - Intergenic
914742144 1:150473535-150473557 TAATACAAACAACTTGGGGAAGG - Exonic
914859255 1:151372730-151372752 TTATACAACCAGCTGGGGGTGGG + Intronic
917631946 1:176898992-176899014 TTCTGCAAACAGAGGTGGGAGGG - Intronic
920275481 1:204801412-204801434 TTGAGCAACCTGCTGGGGGATGG + Intergenic
923027449 1:230217289-230217311 TTAGGCAAAGACCTGAGGGAAGG + Intronic
923424166 1:233852355-233852377 TTATGTAAACTCCTGGTGGAAGG - Intergenic
924434177 1:244024088-244024110 TTATGCAAAGATCTGGAGGGAGG - Intergenic
1068014291 10:51495542-51495564 TTATGAAAACAGCAAGTGGATGG + Intronic
1069210291 10:65749579-65749601 TTGAGAAGACAGCTGGGGGAGGG + Intergenic
1070351358 10:75594904-75594926 ATATGCAAACAGATGAGGCATGG - Intronic
1072102367 10:92240746-92240768 GTATGCAAATAAGTGGGGGAGGG - Intronic
1073636305 10:105202066-105202088 TGATACAAACAGCTGAGAGATGG - Intronic
1074523453 10:114245120-114245142 TGATCCAAACAGCTAGGAGAAGG + Intronic
1074973584 10:118563667-118563689 TGATTCAAACAGCTGGGGCGGGG - Intergenic
1075511328 10:123074820-123074842 CTATGCCAAGTGCTGGGGGACGG - Intergenic
1077378843 11:2218464-2218486 TTAAGCAAAGAGCTGTGGAACGG + Intergenic
1079511543 11:21216482-21216504 TCATGAAAGCAGCTGGGAGAGGG + Intronic
1081604116 11:44516404-44516426 TTATGCATACAGTTGGCGGAGGG - Intergenic
1082683861 11:56214153-56214175 TTGTGCAATTAGCTCGGGGAAGG + Intergenic
1083488913 11:63000615-63000637 AGAGGCAAAGAGCTGGGGGAGGG - Intronic
1084952193 11:72672694-72672716 TCATGCTAACAGGTGGGGGTGGG - Intronic
1088871969 11:113898191-113898213 TTTTGAAAACAGCTGGTGGGAGG + Intergenic
1090409195 11:126495988-126496010 AGATGCAAACAGCTAGGGGCTGG - Intronic
1090512483 11:127390451-127390473 TGCTGCAAAAAGCTGGAGGAAGG + Intergenic
1090919984 11:131198828-131198850 TGATGCAAGCAGCCAGGGGAGGG + Intergenic
1093038003 12:14351508-14351530 TTATGAAAGCAGCTGGGAGGGGG - Intergenic
1094606148 12:31950904-31950926 TTATGCAAACATCTCAGGGTAGG - Intergenic
1095909297 12:47409558-47409580 TCATTCAAAAAGCTGGGGCATGG - Intergenic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098322742 12:69263441-69263463 TCATGTGAAGAGCTGGGGGAGGG + Intronic
1100936204 12:99669899-99669921 TCAGGCAAAAAGCTGGGTGATGG + Intronic
1101250202 12:102926304-102926326 AAATGCAAAGAGCTAGGGGAAGG + Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103173311 12:118841051-118841073 TTATACAAACAGATGTGGGGGGG - Intergenic
1103917078 12:124381274-124381296 TTATGCAGATATCTAGGGGAAGG - Intronic
1103967329 12:124648087-124648109 TTATGGAAACAGTGGGGGGGGGG - Intergenic
1104114252 12:125734265-125734287 TAATGCAATCAGCTGGTGGTGGG + Intergenic
1106160262 13:27195094-27195116 TTATCCACCCAGCTGGGGAATGG - Intergenic
1107612212 13:42126747-42126769 TTATGACAAGAGATGGGGGAAGG - Intronic
1111914891 13:94350710-94350732 TTCTGCACACAGCTGGAAGATGG - Intronic
1114150383 14:20031883-20031905 AAATGCAAGCAGGTGGGGGATGG + Intergenic
1115211382 14:30970456-30970478 TTTAGCTGACAGCTGGGGGAGGG - Intronic
1115797055 14:36949871-36949893 TTCTTCAAAAAGGTGGGGGAAGG + Intronic
1121989407 14:98541117-98541139 GTTTGCCAACAGCTGGTGGAGGG - Intergenic
1122081462 14:99270533-99270555 TTTTGCAAATAGCAGGAGGAGGG + Intronic
1122449604 14:101794567-101794589 TTTTGCAAATATCTGAGGGAGGG + Intronic
1127554899 15:60078258-60078280 AGATGCAGACAGCAGGGGGACGG - Intergenic
1127613707 15:60662156-60662178 ATATGACAACAGTTGGGGGATGG + Intronic
1127871582 15:63078305-63078327 TAATGTAAACTGCTGGGGGCTGG + Intergenic
1128650910 15:69413011-69413033 TTACACAAAAAGGTGGGGGAAGG + Intergenic
1129226716 15:74174497-74174519 TTCTGCAAAGTGCTGGGGGAGGG + Intronic
1129992505 15:79977371-79977393 TGATTCAAACAGCTGGGGTTCGG + Intergenic
1133114698 16:3570677-3570699 TCATGCAGAGAGCTAGGGGAGGG + Intronic
1135325917 16:21525823-21525845 TGATGCCAACAGCTGGGGAGGGG + Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138999479 16:62492180-62492202 TTAAACAAACAGATGGTGGATGG + Intergenic
1139061846 16:63262931-63262953 TTATGGAAGCAGCAGGGGAAGGG + Intergenic
1141701514 16:85644411-85644433 GTATGCCACCAGCTGAGGGACGG + Intronic
1141855020 16:86674794-86674816 TTATGCAGCCACCTGGGGGAAGG - Intergenic
1142038950 16:87880514-87880536 TGATGCCAACAGCTGGGGAGGGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1144228975 17:13180472-13180494 TTATGCTAAAATCTGGGGTATGG + Intergenic
1144383603 17:14727855-14727877 GTAGGCTAACAGTTGGGGGATGG + Intergenic
1146970438 17:37067657-37067679 TTATGCAAACACCCGGGGTGGGG - Intergenic
1147758169 17:42781719-42781741 GTCTGCAAATAGGTGGGGGACGG - Intronic
1150467142 17:65403263-65403285 TCATGGCAACAGCTGGGGGGTGG - Intergenic
1151500053 17:74482607-74482629 TCATGCAGACAGCTGGCGGGAGG - Intronic
1153937659 18:9944337-9944359 TTATACAAACAGGTGGGAAAGGG - Intronic
1158164962 18:54529861-54529883 TTAAGCAAACGGATGGAGGATGG - Intergenic
1162023314 19:7878869-7878891 TTGGGGAAACAGCTGAGGGAAGG + Intergenic
1163414978 19:17180916-17180938 TTATGCAAATCGCTGAGGGGAGG - Exonic
1163704481 19:18804309-18804331 TTGTGCAAACAGGTGGGGTGGGG + Intergenic
1163754436 19:19098127-19098149 TTATCCAAAGAGCTGGGAGCAGG - Intronic
1164815879 19:31203177-31203199 CTATGCAACTAGCTGGTGGAAGG + Intergenic
1165216508 19:34277911-34277933 TTCTGAAAACTGCTGGGGGTGGG - Intronic
1166608028 19:44162826-44162848 TTATACAAATAGCCGGGGCATGG + Intergenic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
926526831 2:13991847-13991869 CTATGAAAGCAGCTGGGGGTCGG - Intergenic
929649973 2:43668918-43668940 TTATGCACAAAGGTGGGGGAAGG + Intronic
929770975 2:44891810-44891832 TCATGAAAGCAGCTGGGGCAGGG - Intergenic
929980111 2:46670256-46670278 TTAAGCAGAGAGTTGGGGGAGGG - Intergenic
931516429 2:63052972-63052994 TCATGCTAACAGCTGGGTGGAGG - Exonic
932207076 2:69892635-69892657 AAATACAAAGAGCTGGGGGATGG - Intergenic
934639408 2:96018490-96018512 ATATGCTAAAAGCTTGGGGATGG - Intergenic
934794244 2:97086895-97086917 ATATGCTAAAAGCTTGGGGATGG + Intronic
935316962 2:101844423-101844445 TTATGTAAACAGCTGTGCCAGGG - Intronic
936475545 2:112836553-112836575 TTTTGCAAAAAGCTGAGAGAGGG + Intronic
936992406 2:118380116-118380138 TGATGGAAAAAGATGGGGGAGGG - Intergenic
939511621 2:143113450-143113472 TTCTGTAGACAGCTGGGGGCAGG - Intronic
939650545 2:144757117-144757139 AAATGCAAACAGGTGGGGGGAGG - Intergenic
939673684 2:145045401-145045423 TTATTGAAACAGGTGGAGGAGGG - Intergenic
941896892 2:170638270-170638292 TTTTGCTAACAGCTGGGCAAAGG + Intronic
942087565 2:172457718-172457740 TTGTGGTAACAGCTGGGGAAAGG + Intronic
943474049 2:188332696-188332718 TTATCCAAGCAGATGTGGGATGG + Intronic
944529978 2:200658050-200658072 GTATTCAAACAACTGGGGGATGG - Intronic
944635682 2:201674033-201674055 TTATTCAAGCAGCTGGGGAGTGG - Intronic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
947941529 2:234060365-234060387 TTCTGCAAACAGCTGTGGACTGG - Exonic
948702833 2:239771227-239771249 TTCTGAAAACTGCTTGGGGAGGG - Intronic
1169839410 20:9918479-9918501 ATATGCAAATAGATGGGGTATGG - Intergenic
1170139384 20:13110628-13110650 TTCAGCAAGCAGCTGGGGGTTGG - Intronic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1173675381 20:44830323-44830345 TTACGCAAACAGATGGTGCATGG - Intergenic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1178747376 21:35266004-35266026 TTAAGCAGGCATCTGGGGGAAGG + Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179161679 21:38904572-38904594 TTTAGCAAACATCTGGTGGAAGG - Intergenic
1180245312 21:46543484-46543506 GCATGCACACACCTGGGGGAGGG - Intronic
1185049670 22:48547390-48547412 GAATGCAAACACCTGGGGAAAGG - Intronic
949710827 3:6869097-6869119 TCATGCAGACATCAGGGGGAAGG + Intronic
952878987 3:37971279-37971301 CTATGCATAGACCTGGGGGAGGG + Intronic
953446460 3:42972964-42972986 TTCTGCTCACAGCAGGGGGAAGG + Intronic
956388917 3:68750929-68750951 GTATGTAAACAGCTTGTGGATGG - Intronic
957408185 3:79799757-79799779 TTATTCACACAGCTGGCAGAAGG + Intergenic
957510019 3:81175837-81175859 TAATGCAAATATCTGGAGGATGG - Intergenic
959903062 3:111681502-111681524 TTATTCCAATAGCTGGGGGAAGG - Intronic
959951120 3:112181523-112181545 TTATGCAAAGTGCTAGGGGCTGG + Intronic
962098634 3:132318136-132318158 TTATGAAAAAAGGTGGGGGGTGG + Intronic
962701616 3:138005876-138005898 TTATTCAAAAAAATGGGGGAAGG + Intronic
963874602 3:150461286-150461308 CTAAACAATCAGCTGGGGGAAGG - Exonic
965366978 3:167813258-167813280 ATAAGCAAACAGCTGGGGGCAGG - Intronic
967904535 3:194489011-194489033 TGGTGCCAACAGCTGAGGGAGGG - Intronic
969051743 4:4378232-4378254 TTATGAAAAAAGCAGGGGAAGGG + Intronic
969503761 4:7570888-7570910 TCATCCAACAAGCTGGGGGAGGG + Intronic
972250382 4:37293652-37293674 TTATGAAACCAGATGGTGGATGG + Intronic
972740727 4:41883683-41883705 TGAAGCAAACAGCTGTGGGACGG + Intergenic
972821671 4:42708800-42708822 TTATGCAAACAGAGAGGGAAAGG - Intergenic
973230119 4:47831246-47831268 ATATGCAAACAGCTGCTGTAAGG + Intronic
975401103 4:73940674-73940696 TTATGCAAACATCTCTGGGGAGG + Intergenic
979066043 4:116133873-116133895 TTAGGCAAACAGCTTGTGCAGGG + Intergenic
979212006 4:118116023-118116045 ATATGCAAACTGCTGTGAGAAGG + Intronic
980729141 4:136804726-136804748 TTATGCAGACAGTTGACGGATGG - Intergenic
980980675 4:139652202-139652224 TTATGAAATTAGCTGGGGGAGGG + Intergenic
982098720 4:151947356-151947378 TTATGAAAGCAGCTGGGGCGGGG + Intergenic
984026375 4:174547897-174547919 TCATGAAAGCAGCTGGGGGAGGG + Intergenic
985124318 4:186676772-186676794 GAATGCACACAGCTGGTGGAAGG + Intronic
985382309 4:189407364-189407386 TTAAGCAAACAGCCAGGTGAAGG + Intergenic
985924228 5:3003309-3003331 TCATGCAAAAAGCTGTGGGTGGG - Intergenic
987313644 5:16703919-16703941 TTCCTCAAACAGCTGGAGGATGG + Intronic
989197176 5:38727021-38727043 TTATGAGAACAGCAAGGGGAAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989707463 5:44353787-44353809 ATATGAAAAAAGCTGGGGGGCGG + Intronic
990941043 5:61203509-61203531 TTAGGTCAACAGCTGAGGGAGGG - Intergenic
992265167 5:75011532-75011554 TAATGCAAACAGCTGGGGGCTGG + Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997525589 5:134551050-134551072 TTATGCAAACAGCTGGGGGACGG - Intronic
998546683 5:143034564-143034586 TTCTTCCCACAGCTGGGGGAAGG + Intronic
1001133322 5:169081669-169081691 TTAAGCAGACAGCTAGAGGAAGG + Intronic
1001714776 5:173806430-173806452 ATATGCAAACAACTGCAGGAAGG - Intergenic
1001824911 5:174736604-174736626 TAATGCAAATAGCTGGGGCTGGG - Intergenic
1002131639 5:177085844-177085866 TTATGTAAATAGCTGTGGAATGG - Intergenic
1003125017 6:3349107-3349129 TTCTGCAAACAGCTGGGTGATGG + Intronic
1003563676 6:7204334-7204356 CTATGCAAACAAATGGGGGATGG - Intronic
1003850493 6:10217605-10217627 TGCTCCAAACAGCTGTGGGAAGG - Intergenic
1004328762 6:14701726-14701748 TGATGGCAACAGCTGGGGGCGGG - Intergenic
1005233210 6:23728870-23728892 TTATGCAAACATCTGTAGGCAGG + Intergenic
1006024765 6:31139748-31139770 TGATGCAAACAGCTCTGGGTGGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006896576 6:37475215-37475237 TTCTGCCTACAGCTGGGGGAAGG - Intronic
1009052483 6:58293071-58293093 TTGAGCAAACTGCTGGGGAAGGG + Intergenic
1009238626 6:61157543-61157565 TTGAGCAAACTGCTGGGGAAGGG - Intergenic
1009444577 6:63726669-63726691 TTATGGATAAAGCTGAGGGAAGG + Exonic
1009874662 6:69490867-69490889 TAATGCAGGCAGTTGGGGGAGGG - Intergenic
1010621096 6:78076184-78076206 TTATATAAGCATCTGGGGGAGGG + Intergenic
1010686924 6:78864142-78864164 TTATGCAAAAAAAAGGGGGAGGG + Intergenic
1011090813 6:83597177-83597199 AGATTCAAACAGCTGGGGGTGGG - Intronic
1013768149 6:113597082-113597104 TTATGCTAACATCTGTGTGAGGG - Intergenic
1018041648 6:159929445-159929467 TTATGCAAACATCAGAGTGAAGG - Intergenic
1018397781 6:163392807-163392829 CCATGGAAACAGCTGGGGGCTGG + Intergenic
1019069430 6:169330840-169330862 TTATGAGAACAGGTGGGGCAAGG + Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022612613 7:31892106-31892128 TTATAAAACCAGCTGGGGAAAGG - Intronic
1023496631 7:40804894-40804916 TTAAGAAAACATTTGGGGGAGGG + Intronic
1024123815 7:46271328-46271350 ATCTGCAAGCAGCTCGGGGAGGG - Intergenic
1026304130 7:69125217-69125239 TTATGTTAAGAGCAGGGGGAAGG + Intergenic
1027826089 7:83118493-83118515 CTATGCTCACTGCTGGGGGATGG - Intronic
1027931324 7:84538578-84538600 TTATGAAAATATCTGGGGGGCGG + Intergenic
1028406862 7:90484895-90484917 TTCTGCATACAGCTGGGCAAGGG + Intronic
1028971090 7:96859446-96859468 AGATGCAAACAGCTGTGGGTGGG + Intergenic
1031909939 7:127505443-127505465 ACATGAAAACAGCTGGGAGAGGG - Intergenic
1032576265 7:133058500-133058522 TTATGCAACCAGCTAGGTTACGG - Intronic
1033452585 7:141474919-141474941 TTTTTCAAATATCTGGGGGAAGG + Exonic
1034149410 7:148902202-148902224 TAATGCAAACAGCTGGGCATAGG + Intergenic
1034165272 7:149020695-149020717 TGATGGTCACAGCTGGGGGACGG - Intronic
1035135711 7:156701042-156701064 TTATGAAAACAGCAAGGGAAAGG + Intronic
1037830278 8:22184230-22184252 TTTTGCAATCGGCTGGGGTATGG + Intronic
1039547066 8:38417962-38417984 TTAGGCAAACCCCTGGGAGAGGG - Exonic
1039597018 8:38799229-38799251 CTAGGCTAACGGCTGGGGGATGG - Intronic
1044596271 8:93961767-93961789 TATTGCAAACAGCTGGGGATGGG + Intergenic
1044924686 8:97200363-97200385 TTAGGCAACCAACTGGGAGAAGG - Intergenic
1045555044 8:103207640-103207662 TTAGGCAAATGGCAGGGGGAGGG + Intronic
1045595965 8:103656955-103656977 TCATGCCTCCAGCTGGGGGAGGG + Intronic
1045891684 8:107165225-107165247 TTATGCTAAAAGATGGAGGATGG - Intergenic
1047245627 8:123141358-123141380 TTATTCAATAAGATGGGGGATGG + Intronic
1048070278 8:131013521-131013543 TTTTGCAAATCACTGGGGGAGGG - Intronic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1056035020 9:82595234-82595256 TTAAGGAAAAGGCTGGGGGAAGG + Intergenic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1058398962 9:104591379-104591401 TTATGCAAAGAGGTAGGGGGAGG - Intergenic
1062028198 9:134350209-134350231 GTATGGAAACCACTGGGGGAGGG + Intronic
1186250871 X:7664764-7664786 TTATGCAAATGGCTTGGGAAAGG + Intergenic
1186911809 X:14175032-14175054 CTATGCACACTGCTGGGGAATGG + Intergenic
1187254172 X:17627070-17627092 TTAAGCAATCAACTTGGGGAAGG - Intronic
1188937368 X:36193044-36193066 TTATGCAAATATATGGGAGATGG - Intergenic
1189942219 X:46136535-46136557 TTATGGAAACAGCAGGGAGAGGG - Intergenic
1192551158 X:72054855-72054877 TTGTGCTAACTGCAGGGGGAGGG - Intergenic
1193046938 X:77063842-77063864 TTTTCCACACAGCTGGGAGAAGG - Intergenic
1194538520 X:95140810-95140832 TTATATAAAAATCTGGGGGAGGG - Intergenic
1194582770 X:95697233-95697255 TTATGCAAATTTCTGGGGGTGGG - Intergenic
1195431185 X:104791236-104791258 TGAGGTAAACAGATGGGGGAGGG - Intronic
1195671804 X:107476315-107476337 TTCTCCAAACAGCTGAGTGAAGG + Intergenic
1196192532 X:112809895-112809917 TTTTGCAAAGAGCTGCGAGATGG + Exonic
1196394093 X:115241011-115241033 TCTTTCAAACAGCTTGGGGAGGG - Intergenic
1197577803 X:128241265-128241287 TTATGCAATTAGCTAGTGGAAGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1201753800 Y:17465327-17465349 AGATGCAGGCAGCTGGGGGAGGG - Intergenic
1201847752 Y:18440658-18440680 AGATGCAGGCAGCTGGGGGAGGG + Intergenic
1202335750 Y:23809266-23809288 AGATGCAGGCAGCTGGGGGAGGG - Intergenic
1202535017 Y:25860801-25860823 AGATGCAGGCAGCTGGGGGAGGG + Intergenic