ID: 997527849

View in Genome Browser
Species Human (GRCh38)
Location 5:134564841-134564863
Sequence CAGAGTTCTCAGCACTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997527849_997527852 4 Left 997527849 5:134564841-134564863 CCATTGGAGTGCTGAGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 157
Right 997527852 5:134564868-134564890 TCCCTGAAAGCAAGTGTCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 154
997527849_997527854 5 Left 997527849 5:134564841-134564863 CCATTGGAGTGCTGAGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 157
Right 997527854 5:134564869-134564891 CCCTGAAAGCAAGTGTCTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 175
997527849_997527851 3 Left 997527849 5:134564841-134564863 CCATTGGAGTGCTGAGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 157
Right 997527851 5:134564867-134564889 TTCCCTGAAAGCAAGTGTCTTGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997527849 Original CRISPR CAGAGTTCTCAGCACTCCAA TGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901772578 1:11537809-11537831 CACAATACTCAGCACACCAAAGG - Intergenic
904800637 1:33090495-33090517 CAGAGATCACCCCACTCCAAAGG - Intronic
906831073 1:49032617-49032639 CAGATATCTCAGCATTGCAATGG - Intronic
907312770 1:53548539-53548561 CAGGGTTCTCATCACAGCAAAGG - Intronic
907328648 1:53657339-53657361 CAGAGGACTCAGATCTCCAAGGG + Intronic
909096998 1:71300136-71300158 CAGGGTGCTCAGCACTAAAAGGG + Intergenic
911103331 1:94110885-94110907 CCGAGATCTCACCACTCCAGGGG + Intronic
911230936 1:95360849-95360871 CAGAGGTCACAGCATTCCTATGG + Intergenic
912564519 1:110576849-110576871 CCCAGTTCTCAGCCCTCTAATGG + Intergenic
912803522 1:112737132-112737154 CAGAATTCTGAGCAGTACAAAGG + Intergenic
916095589 1:161347086-161347108 CAGAGTTGACAGCACTCTGAGGG + Intronic
917602841 1:176594922-176594944 CACAGTTCTCAGCATTCAAGTGG + Exonic
921304578 1:213782936-213782958 CAGAGTTCTCAGGCCTCCTCTGG + Intergenic
922414698 1:225410459-225410481 CAGAGACCTTAGCACTACAAAGG + Intronic
924057644 1:240139684-240139706 CAGCGCTCTCAGCGCTCCACTGG - Intronic
1063143891 10:3278812-3278834 AAGAGTGCTCAGAACTTCAAGGG - Intergenic
1063665304 10:8057160-8057182 GAGAGTTCTCTGAACACCAAGGG - Intronic
1064629731 10:17297363-17297385 CAGAGCCCTCAGCATGCCAAGGG + Intergenic
1065173985 10:23059723-23059745 TACAGGTCTCAGCACTCCCAAGG + Intergenic
1065918936 10:30374214-30374236 CAGAGTCCATACCACTCCAAAGG - Intronic
1067414979 10:46095986-46096008 CACAGTTCTCAGAACTCCATGGG + Intergenic
1067435025 10:46270566-46270588 CACAGTTCTCAGAACTCCATGGG + Intergenic
1067438729 10:46296431-46296453 CACAGTTCTCAGAACTCCATGGG - Intronic
1067566956 10:47346338-47346360 CAGAGTTCTCCAGACTCCAGGGG - Intergenic
1072936343 10:99717146-99717168 CAGAGGGCTCAGCTGTCCAACGG - Intronic
1074909419 10:117894204-117894226 CAGAGTTCTAACTACCCCAAGGG + Intergenic
1075896294 10:125997968-125997990 TAGCGTTCTCAGCCCTCCAAGGG - Intronic
1080408733 11:32003433-32003455 ATGAGTTCTCAGCACGCCACAGG + Intronic
1081598159 11:44473519-44473541 CCCAGTTCTCCTCACTCCAACGG + Intergenic
1081645288 11:44786018-44786040 CACAGTGCTCAGCACTTCACAGG - Intronic
1083661589 11:64254017-64254039 CAGAGCTCTCAGCACTTCTGGGG + Intronic
1084726395 11:70945246-70945268 CAGAGTCCACAGCAGTGCAAAGG + Intronic
1085728860 11:78979231-78979253 CTTAGTTCTCAGCCCTCCCAAGG + Intronic
1085746156 11:79116013-79116035 CAAATTTATCAGCACCCCAATGG + Intronic
1092009506 12:5097856-5097878 CAGGGTTCTCACCTCTCCTAGGG - Intergenic
1098072781 12:66693999-66694021 CAGATTTCTTAGCACTCTCAGGG + Intronic
1098968837 12:76826337-76826359 CAGAGTGCTCAATACTCCAAAGG - Intronic
1101577095 12:106007653-106007675 CAGAGTTAAAAGCACTCCACTGG + Intergenic
1102959018 12:117080060-117080082 CAGAGTTCTCATCTCTAGAATGG - Intronic
1103860798 12:124011837-124011859 CTGAGTTGTCAACATTCCAAGGG - Exonic
1104098338 12:125582178-125582200 CAGTTTTCTCAGCTCTCCCAAGG - Intronic
1105068747 12:133221073-133221095 TACAGTTTTCAGCAATCCAAAGG + Intronic
1107118956 13:36777576-36777598 AAGAGTTCTCACCACTCTCAAGG + Intergenic
1107143276 13:37028635-37028657 CACTGTTCTCAGCACTCTACAGG + Intronic
1107575856 13:41721439-41721461 CAAACTCCTCAGCTCTCCAAAGG + Exonic
1109309675 13:60677861-60677883 CAGAGTTCTCAGGACATCACGGG + Intergenic
1111159597 13:84377145-84377167 CAGAGTTCTGAGCACTCAAAGGG - Intergenic
1112332048 13:98484302-98484324 CAGAGTTCCCAGCTCTCTTAGGG - Intronic
1113481016 13:110621195-110621217 CAGACTTCTGAGCACCCCAGCGG + Intronic
1117016837 14:51526756-51526778 CACAGTGCTCAGCACACCACAGG + Intronic
1117632059 14:57704179-57704201 CTAACTTCTCAGGACTCCAAAGG + Intronic
1122325426 14:100878653-100878675 CAGAGTTCTCAGCTCCCACATGG - Intergenic
1124688626 15:31803514-31803536 CAGTGTTCTCAGCAAGACAAGGG - Intronic
1126681594 15:51207451-51207473 CAGTTTTCTCATCAATCCAATGG - Intergenic
1128107560 15:65055785-65055807 CAGAGTTCTCAGGGCTCCTGGGG + Intronic
1129392395 15:75226874-75226896 CTGAGTTCTGGGCACTTCAAGGG - Intergenic
1130515125 15:84620694-84620716 GAAAGTGCTCAGCACTCCGATGG + Exonic
1130536171 15:84786558-84786580 CAGAGGACTCAGCCCCCCAAAGG + Intronic
1130834466 15:87635595-87635617 AACAGTTCTCACCCCTCCAATGG + Intergenic
1134384904 16:13762798-13762820 GAGACTTCTCTGCACTCAAAAGG + Intergenic
1135993952 16:27234468-27234490 CAGAAGTTTCAGAACTCCAAAGG + Intronic
1139087083 16:63599875-63599897 CAGAGGTCTCATAACTCCTAAGG - Intergenic
1139514279 16:67444185-67444207 CAGAGCTCTCGGGACTCCAAGGG + Intronic
1141765977 16:86060331-86060353 CTGAGGTCTCAGCCCTCCAGAGG + Intergenic
1142562332 17:817765-817787 TTGAGTTCTCAGCACTCCTAGGG - Intronic
1143405868 17:6676922-6676944 CAGAGTCCTCAGCAGCCAAAGGG + Intergenic
1146254927 17:31386374-31386396 CAGGGTCCTCAGCACTCCACAGG + Intergenic
1147573823 17:41587421-41587443 CAGACTTCTCAGCACAGCATGGG - Intergenic
1147773658 17:42885236-42885258 CAGATTCCTCAGCTCACCAATGG - Intergenic
1152696383 17:81799275-81799297 CAAATTGCTCAGCACTCCTATGG + Intergenic
1155370874 18:25099033-25099055 CTGAGTTCTCAACACTCTTATGG - Intronic
1157289563 18:46400032-46400054 CAGAGTGCCCAGCACCCCAGGGG - Intronic
1160130602 18:76221922-76221944 CTGAGTTCTGAGCCCTCCCAAGG + Intergenic
1160747042 19:716698-716720 CAGGGGTTTCAGCACTCCATGGG + Intronic
1162164324 19:8742223-8742245 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162165396 19:8749691-8749713 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162166461 19:8757147-8757169 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162167527 19:8764603-8764625 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162168466 19:8770901-8770923 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162169536 19:8778351-8778373 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1162170216 19:8783665-8783687 CAGAGTTGTCAAAACTCCAATGG - Intergenic
1165348086 19:35261607-35261629 CATAGGTCTTAGCACCCCAAAGG - Intronic
1166836924 19:45673032-45673054 CAGAGGTCTGAACAGTCCAAGGG - Intronic
926885277 2:17591977-17591999 TAGAGTTCTGAGCAGTCCCATGG - Intronic
927112102 2:19870737-19870759 CAGCGATCTCTGCACTCCTATGG + Intergenic
927423826 2:22959069-22959091 CAGAACTCTCAGAACCCCAAAGG + Intergenic
927613660 2:24566920-24566942 CAGACTTCTCTGCACTCTTAGGG - Intronic
927916336 2:26938965-26938987 CAGAGATCTCTGCAGGCCAAGGG - Intronic
928658320 2:33475816-33475838 CCAAGTTCCCAGCACACCAAAGG + Intronic
929383397 2:41379163-41379185 AAGAGTTAGCAGCACTCTAAGGG - Intergenic
931968562 2:67560751-67560773 CTGAGTTATAAGCCCTCCAAAGG + Intergenic
935399483 2:102644931-102644953 CACAGTGCTCAGCTCTGCAAAGG + Intronic
935563558 2:104583688-104583710 GAGAGTTCTCTACACTTCAAAGG + Intergenic
936828177 2:116606885-116606907 CTGTGTTCTGAGCATTCCAAAGG - Intergenic
938609684 2:132934818-132934840 CAGAGTTCTCCACACTCAAATGG - Intronic
943188693 2:184648030-184648052 CAGAATTCTCAGCAGAACAAAGG + Intronic
944497483 2:200323242-200323264 GAGAGTCCTCAGCTCTCAAATGG + Intronic
944890290 2:204110264-204110286 CAGAGTTCATAGCACACAAAGGG + Intergenic
946090588 2:217219266-217219288 CAGAGCTGTCTGCTCTCCAATGG + Intergenic
948944185 2:241211162-241211184 AAGAGTTCTCACCCCTCCACAGG + Intronic
1169035364 20:2446441-2446463 CAGAGTTCACTGCTCTCCAAGGG - Intergenic
1170932153 20:20778917-20778939 CAGAGTACTCAGCACGCCAAGGG - Intergenic
1174851876 20:54003494-54003516 CACAGTTCTCAGCACTCAGTTGG + Intronic
1175977090 20:62716429-62716451 CAGAGTTCCCAGCGCCCCTATGG - Intronic
1177172603 21:17670693-17670715 CAAAGTACTCAACACGCCAAGGG - Intergenic
1178948951 21:36970191-36970213 CAGAATTCTCATCAGTCAAATGG + Intronic
1179042366 21:37815465-37815487 CAGAGCCATCACCACTCCAATGG - Intronic
1179298298 21:40082730-40082752 AACATTTATCAGCACTCCAATGG - Intronic
1180027426 21:45175810-45175832 GAGGGCTCTCAGCTCTCCAATGG + Exonic
1180244250 21:46536207-46536229 CAAAGGCCACAGCACTCCAAAGG - Intronic
1182159309 22:28105688-28105710 CAGACTTCCCAGCTCTCCATAGG + Exonic
1182933050 22:34193211-34193233 CAGAAATCTCATCACACCAATGG + Intergenic
949840705 3:8316657-8316679 GGGAGTTGTCAGAACTCCAAAGG + Intergenic
953474490 3:43194150-43194172 CAGATTTCTCAGCAGTTCCAGGG - Intergenic
954004856 3:47582653-47582675 CAGAGTTTTCTGCAGTCCAGAGG - Intergenic
956019188 3:64915459-64915481 CAGTGTTCTCATCAGTGCAATGG + Intergenic
956732823 3:72212407-72212429 CTGTGTACTCAGCACTCCAAGGG - Intergenic
963662512 3:148144907-148144929 CAGAGTCCTCGGCATTCCAGAGG + Intergenic
964838595 3:160968884-160968906 CAGAGTTCTCAGACCAGCAAGGG + Intronic
965258040 3:166442623-166442645 CAGTGTTCTCAGCATTCATATGG + Intergenic
966303045 3:178499900-178499922 CATAGATGTCAGCACTTCAAGGG + Intronic
966310760 3:178591168-178591190 CATAGATCTGAGGACTCCAATGG + Intronic
966536081 3:181035701-181035723 GAGAGTTCTTAGCACCCCATTGG + Intergenic
973607225 4:52599895-52599917 CAGAGTTTACAGCAATGCAAAGG - Intronic
979673014 4:123381466-123381488 AAGTGATCTCAGCACTCCCATGG - Intergenic
980352702 4:131701687-131701709 CCAAGTTCTCTGCACGCCAAAGG - Intergenic
981688049 4:147476905-147476927 TTGATTTCTCAGCTCTCCAATGG + Intergenic
981767395 4:148266634-148266656 CAGAGTTCACAGCACTCTGATGG - Intronic
981972420 4:150680281-150680303 CACAGTTATCAGAGCTCCAAGGG + Intronic
982673194 4:158347006-158347028 CAGGGTGGTCAGCTCTCCAAAGG - Intronic
984492383 4:180451218-180451240 GAGAGTTCTTAGGACTTCAATGG + Intergenic
984849814 4:184143856-184143878 CAGTGTTTTCAGCACTTCACTGG - Intronic
985696507 5:1344038-1344060 CAGAGTTGTCTGCTCTCCACTGG + Intronic
985979691 5:3452204-3452226 CTGTGTTCTCAGCACTCTACCGG + Intergenic
986406092 5:7426482-7426504 CAGCTATCTAAGCACTCCAAGGG + Intronic
986932355 5:12842013-12842035 CAGTTTTCACAGCACTTCAAAGG - Intergenic
987112513 5:14701036-14701058 CAGAGATCTCAGCCCTCCATAGG + Intergenic
990312150 5:54550390-54550412 CAAATTTCTCAGCTATCCAAAGG + Intergenic
992002692 5:72451167-72451189 CAGAGTCCTCACCACTCCAGCGG - Intronic
992215447 5:74520455-74520477 CAGACTGCTCAGCATACCAAAGG + Intergenic
992258158 5:74942817-74942839 TAGAGTGCTCAGCATTACAAGGG + Intergenic
997527849 5:134564841-134564863 CAGAGTTCTCAGCACTCCAATGG - Intronic
997792036 5:136770034-136770056 CAGATTTCTGGGCACTCCAGAGG + Intergenic
997862000 5:137426820-137426842 CAGAGATGTCAGCACTCTCAGGG - Intronic
999424815 5:151477984-151478006 CAGACTTCACAGCTCTCCAGAGG + Intronic
1007323582 6:41043811-41043833 CAGACTTCTCTGCACTCCCATGG + Intronic
1007733243 6:43964759-43964781 CTGAGTTCTCTGCTCTGCAAAGG - Intergenic
1011328488 6:86176996-86177018 CAGAGTTTTCAGTATTCCAGGGG + Intergenic
1013270724 6:108543411-108543433 CAGAGTGCTCAGGCCTCGAATGG + Intergenic
1014542716 6:122696595-122696617 CAGAGTTCTCAGCCCCTCAGAGG + Intronic
1016733955 6:147455772-147455794 CAGAGTTCTCATCACTAATAAGG - Intergenic
1017163634 6:151389566-151389588 CAGAATTATCAGAACTCCAGGGG - Intronic
1017903969 6:158743060-158743082 CAGAGTTTTCAGCAGTCTAACGG - Intronic
1018758581 6:166870947-166870969 CACAGTTCTCAGCACACCGCGGG - Intronic
1018964857 6:168476821-168476843 AAGAGTTATCAACACTTCAAGGG + Intronic
1020474567 7:8580636-8580658 CAGAATTCTAAGCTCTCCAGAGG - Intronic
1020865836 7:13561169-13561191 CAGAGTTCCCAGGACTCAAATGG + Intergenic
1021155317 7:17202977-17202999 TAGTTTTCTCAGCACACCAAAGG - Intergenic
1027966734 7:85020283-85020305 CAAAGTTGTCAGCATTTCAAAGG - Exonic
1032419135 7:131764052-131764074 CAGAGTTTTCAGAGCTGCAAGGG - Intergenic
1032809803 7:135401155-135401177 CAGAGTCCTCACAACTCCACTGG + Intronic
1033815545 7:145068577-145068599 CAAAGTACTCAGCATACCAAAGG - Intergenic
1033915593 7:146321402-146321424 GTGAGTTCTCTCCACTCCAAAGG - Intronic
1034065227 7:148129881-148129903 CAGGGTTCTCAGTTCTCCTAAGG + Intronic
1035121303 7:156570180-156570202 CAGAGTCCTCAGGCCTTCAAAGG + Intergenic
1035562716 8:618298-618320 CAGAGTACTGAGCACTCAGAGGG - Intronic
1035685369 8:1520074-1520096 CAGCGTGCCCAGCACTCCAGGGG - Intronic
1035903409 8:3481812-3481834 CAGAGCTGTAATCACTCCAAAGG - Intronic
1037814823 8:22106640-22106662 CACAGCTCTGAGCCCTCCAAGGG - Intergenic
1046761711 8:118028219-118028241 CAGAGCTCCCAACACTCCACTGG + Intronic
1047989899 8:130275143-130275165 CAAAGCTCTGAGCACTCCGAAGG + Intronic
1050880203 9:10689784-10689806 CAAAGTTCCCAGCACTCTAGAGG + Intergenic
1055212100 9:73808582-73808604 CAGAGTTCTCTGTATCCCAAAGG - Intergenic
1055240867 9:74184064-74184086 AAGACTGCCCAGCACTCCAAGGG + Intergenic
1058327354 9:103715347-103715369 AAGTTTTGTCAGCACTCCAATGG + Intergenic
1061928099 9:133816764-133816786 CAGAGATCCAAGCAATCCAATGG - Intronic
1203406438 Un_KI270538v1:21179-21201 TAGACTTCAAAGCACTCCAAAGG - Intergenic
1186732572 X:12425892-12425914 CACAATTCTCATCACTCTAATGG - Intronic
1188446386 X:30257097-30257119 CAGAGTTCTTGGCACACCAGAGG + Intergenic
1190254787 X:48754289-48754311 CAGAGGTGTGAACACTCCAAGGG - Intergenic
1197571455 X:128155895-128155917 AAGAGTTGTCAAAACTCCAATGG - Intergenic
1197845435 X:130797176-130797198 AAGAGTTCTAGGCACTCCAGAGG + Intronic
1198041688 X:132859357-132859379 CAGAATTATCAACACTCTAATGG + Intronic
1198525318 X:137494481-137494503 CAGAGGCCTCAGCACCCCAAAGG + Intergenic