ID: 997532018

View in Genome Browser
Species Human (GRCh38)
Location 5:134587234-134587256
Sequence CACCCATCCAACCCGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997532018_997532027 13 Left 997532018 5:134587234-134587256 CCCAGTCCCGGGTTGGATGGGTG No data
Right 997532027 5:134587270-134587292 AGACCCTGCCAAAGAAAGGAAGG No data
997532018_997532024 9 Left 997532018 5:134587234-134587256 CCCAGTCCCGGGTTGGATGGGTG No data
Right 997532024 5:134587266-134587288 ACCCAGACCCTGCCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997532018 Original CRISPR CACCCATCCAACCCGGGACT GGG (reversed) Intergenic
No off target data available for this crispr