ID: 997554444

View in Genome Browser
Species Human (GRCh38)
Location 5:134783318-134783340
Sequence CACTGCGCTCACTGTGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997554443_997554444 4 Left 997554443 5:134783291-134783313 CCAGGGTGGAGTGCAGTGGTGCA 0: 228
1: 25223
2: 80163
3: 166714
4: 205634
Right 997554444 5:134783318-134783340 CACTGCGCTCACTGTGACCTCGG 0: 1
1: 0
2: 2
3: 12
4: 219
997554442_997554444 5 Left 997554442 5:134783290-134783312 CCCAGGGTGGAGTGCAGTGGTGC 0: 447
1: 48184
2: 135758
3: 205238
4: 192987
Right 997554444 5:134783318-134783340 CACTGCGCTCACTGTGACCTCGG 0: 1
1: 0
2: 2
3: 12
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997554444 Original CRISPR CACTGCGCTCACTGTGACCT CGG Intronic
900201224 1:1407544-1407566 CGCTGCCCTCACGGTGCCCTCGG - Intergenic
903061393 1:20671129-20671151 CACTGCTGTGACTGTGACTTTGG + Intronic
903634707 1:24803823-24803845 CACTGATTTCACTGGGACCTGGG + Intronic
904025778 1:27502809-27502831 CACTGCACTCACTCCGGCCTGGG - Intergenic
904558545 1:31381604-31381626 CCCTGCCTTCTCTGTGACCTTGG + Intergenic
904998717 1:34651366-34651388 CACTGCACTCTCTGCCACCTAGG - Intergenic
905480701 1:38260004-38260026 CACTGCCCACCATGTGACCTTGG + Intergenic
906696212 1:47825062-47825084 CACAGCCCGCTCTGTGACCTTGG - Intronic
907917268 1:58882558-58882580 GATTACGCTCAGTGTGACCTTGG - Intergenic
908591538 1:65641455-65641477 CACTGCTTTCTCTGTGACTTTGG - Exonic
911700221 1:100944092-100944114 CACTGCCCTCACTCTAGCCTGGG - Intronic
914753556 1:150550835-150550857 CACTGCCCTCCCTGAGACCTAGG - Intronic
915025499 1:152826056-152826078 CCCTGTGCTGCCTGTGACCTCGG + Intergenic
915637190 1:157195301-157195323 CCCAGCGCTCAGGGTGACCTGGG - Intergenic
916946763 1:169736932-169736954 CACTGAGATAACTGTGTCCTGGG + Intronic
918077440 1:181181326-181181348 CACTGCACCCACTGTCTCCTGGG + Intergenic
919919581 1:202160204-202160226 CACCTCGCCCACTGTGACCCTGG - Intronic
919971291 1:202581072-202581094 CAATGCAGTCACTGTCACCTTGG - Exonic
920449934 1:206052507-206052529 CTCTTCCCTCACAGTGACCTGGG - Intronic
922423794 1:225475967-225475989 CACTGCACTCACTGTCAGCCTGG + Intergenic
922696226 1:227732297-227732319 GACCGCCCTCCCTGTGACCTGGG - Exonic
924014236 1:239702647-239702669 CACTGCGCTCACTCCAGCCTGGG - Intronic
1062798889 10:364714-364736 ACCAGCGGTCACTGTGACCTCGG - Intronic
1063797272 10:9526429-9526451 CACTGCACTCTCTTTGAGCTAGG + Intergenic
1067350985 10:45475219-45475241 CACTTTGCTCACTTTGTCCTTGG - Intronic
1068731266 10:60360672-60360694 CACTGGTCTCACTGTCACCCAGG - Intronic
1071188846 10:83077535-83077557 CACTGCTATCACTGGGACATTGG + Intergenic
1071447383 10:85761483-85761505 CACTGCTCTCACAGTGCCCACGG + Intronic
1072048661 10:91682011-91682033 CACGAAGCTCAGTGTGACCTTGG + Intergenic
1073535722 10:104275094-104275116 CACTGCCCTCTCTGGGACTTGGG + Intronic
1074715388 10:116213807-116213829 CACTGGCCTCAGTGTGCCCTTGG - Intronic
1075723290 10:124599428-124599450 CCCTGAGCTCTGTGTGACCTTGG - Intronic
1076379517 10:130015496-130015518 CCCTGCACTGAGTGTGACCTGGG - Intergenic
1076767500 10:132644553-132644575 CACGGCACTCACTGTGAGCCAGG - Intronic
1076783424 10:132736940-132736962 CACGGCGCCCACTGTGCCCACGG - Intronic
1078069038 11:8096325-8096347 CACTGAGCTCACCTTGAACTGGG - Intronic
1080262430 11:30364145-30364167 CTCTTTGCACACTGTGACCTGGG + Intergenic
1081522523 11:43896978-43897000 CACTGTGCTCACTCTAGCCTGGG - Intronic
1082049945 11:47762832-47762854 CACTGCAGTCTCTGTGTCCTGGG - Intronic
1085306091 11:75486906-75486928 CACTGCCCTCCCTGCCACCTAGG - Intronic
1085781760 11:79415585-79415607 CCCAGCACTCACTGTCACCTTGG - Intronic
1085805056 11:79628317-79628339 CACTGCTCTCTATGTGACTTGGG - Intergenic
1088863074 11:113820569-113820591 CACAGCGCACCCTGGGACCTAGG + Intronic
1089130171 11:116206122-116206144 CACTTAGTTCACTGTGACCTTGG - Intergenic
1089567008 11:119377232-119377254 CACTGCTCCCAGTGTGACTTTGG - Intronic
1089585837 11:119508935-119508957 CTCTGAGCTCTCTGAGACCTGGG - Intergenic
1090041826 11:123298771-123298793 CGCTGCGCTCTCAGGGACCTGGG + Intergenic
1090703704 11:129317648-129317670 CACAGAGCTCACTGTGTGCTAGG - Intergenic
1091969962 12:4778943-4778965 CACTGTGGTGACTGTGACCCAGG - Intronic
1093059646 12:14589362-14589384 CCCTGTGCCCACTGTGATCTGGG - Intergenic
1096439962 12:51632919-51632941 CCCACCCCTCACTGTGACCTTGG + Intronic
1096712954 12:53471177-53471199 CTCTGTGCTCCCTGTAACCTGGG - Intronic
1096730333 12:53606285-53606307 CATTGCACTCACTCTAACCTGGG - Intronic
1098586945 12:72165173-72165195 CATTGCTCTCTCTGTGACTTTGG + Intronic
1099886175 12:88534054-88534076 CACTGTGCTCACTATGGGCTTGG + Intronic
1100644155 12:96511392-96511414 CACTGCAATCTCTGTCACCTGGG + Intronic
1100800896 12:98229197-98229219 CACTGTGCTCACTGGGTGCTTGG - Intergenic
1101132631 12:101705128-101705150 CACTTGGCTCACTGCAACCTTGG + Intronic
1101132706 12:101705790-101705812 CACTTGGCTCACTGCAACCTTGG + Intronic
1101736977 12:107470535-107470557 CACTGCCCACACCGTGACCCTGG - Intronic
1102282041 12:111626130-111626152 CACTGCACTCACTCTAGCCTGGG - Intergenic
1105336898 13:19479894-19479916 CACTCAGCTCACTGCAACCTTGG - Intronic
1106550816 13:30769287-30769309 CACTGCTATCCCTGTCACCTGGG + Intergenic
1113874858 13:113587921-113587943 ACCTCAGCTCACTGTGACCTTGG + Intronic
1115150943 14:30284941-30284963 CTCTGTGCTGACTGCGACCTAGG - Intergenic
1117493003 14:56271153-56271175 CACTGTGCACACTGTGATGTCGG - Intronic
1118686883 14:68300270-68300292 CATTGCCCTCACTGTAGCCTTGG + Intronic
1122100637 14:99406889-99406911 CACTGCCCTCACTGCCACCAGGG - Intronic
1122126292 14:99580345-99580367 CACTGCACTCACGGTGACTCTGG - Intronic
1122922356 14:104885270-104885292 CCCTGCTCTCCCTGTGGCCTGGG + Intronic
1202903675 14_GL000194v1_random:56714-56736 CTGTGCTCCCACTGTGACCTGGG + Intergenic
1202855074 14_GL000225v1_random:44701-44723 CGCTGCTCTCTCTGTGCCCTTGG + Intergenic
1123786337 15:23678596-23678618 CACTGACCTCTCTGTGTCCTTGG + Intergenic
1124010566 15:25835460-25835482 CCCTGCCCTCACTGCGACCAGGG - Intronic
1124648251 15:31455728-31455750 CACTGCCATCACTGTGACTGTGG - Intergenic
1128659368 15:69486892-69486914 CACTTCCTTCACTGTGACCTTGG - Intergenic
1130739742 15:86586490-86586512 CATTACGCTCTGTGTGACCTTGG - Intronic
1131677529 15:94685459-94685481 CACTGCACTCACTCTAGCCTGGG + Intergenic
1131697211 15:94890760-94890782 CACTTCTCTCTCTCTGACCTTGG + Intergenic
1132642372 16:983676-983698 CAGGGCGCCCACTGTGCCCTCGG - Intronic
1133884275 16:9810979-9811001 CACTGGGCTCACTCAGACCATGG - Intronic
1136004110 16:27316499-27316521 GACTGCCCTCACTGGTACCTGGG + Intronic
1137056751 16:35749753-35749775 CTCTGCCCTCGCTGTGACCCGGG + Intergenic
1137466624 16:48715628-48715650 CACTGATCCCACTGTGAACTTGG - Intergenic
1138519477 16:57562943-57562965 CACTGCACACACAGTGTCCTTGG - Intronic
1140267332 16:73432033-73432055 CCCTGTGCTCAGGGTGACCTCGG - Intergenic
1141893173 16:86941585-86941607 CACTGTGCTCCCTCTTACCTGGG - Intergenic
1141921519 16:87138767-87138789 CACTGCCCTGCCTGTGCCCTGGG - Intronic
1144453471 17:15400053-15400075 CACTGCACTCACTCTAGCCTGGG + Intergenic
1146455443 17:33005781-33005803 CAATGAGCACACTGTGCCCTGGG + Intergenic
1146839945 17:36144437-36144459 CACTGGGCTCACTGTGAAATGGG - Intergenic
1147969895 17:44213564-44213586 CACTGCGCACTGTGTGACCGTGG - Intronic
1148605162 17:48923563-48923585 CACTCAGCTCACTGCAACCTCGG - Intronic
1150532632 17:66000630-66000652 CACTGCGCCCACTCTCACCGTGG + Intronic
1151649673 17:75458650-75458672 CACTGCACTCACTCTAGCCTGGG + Intronic
1151934947 17:77255773-77255795 CGCTGGGCTCCCTGTGACCAGGG + Intergenic
1154981414 18:21505407-21505429 CACTGCTTTCATTGTGATCTAGG - Exonic
1157466736 18:47953833-47953855 CACTGCTAACAGTGTGACCTTGG - Intergenic
1158706375 18:59795942-59795964 CAGTCCTCTCACTGTGACCTTGG - Intergenic
1160980734 19:1815514-1815536 CACTGCGCTGAGTGTGGCCCTGG + Exonic
1165556894 19:36641960-36641982 CACTGCGCTCACTCTCGCCTGGG - Intronic
1165750241 19:38255188-38255210 ATCTTGGCTCACTGTGACCTTGG + Intronic
1166177402 19:41084226-41084248 CACTGCAATCTCTGTGTCCTGGG - Intergenic
1167103107 19:47416216-47416238 CCCTGCGCTCACTTTGGCATAGG + Intronic
927203676 2:20593714-20593736 CACTCGGCTAACTGTGACCAGGG - Intronic
929414267 2:41731052-41731074 CACTGGGCTAACAGTGAGCTGGG - Intergenic
929555439 2:42922826-42922848 GACTTTGCTCCCTGTGACCTGGG + Intergenic
932593104 2:73078918-73078940 GACTGTGCTCACTGTGGCATTGG - Intronic
936282637 2:111155677-111155699 CTCTTGGCTAACTGTGACCTGGG + Intronic
938026682 2:127955286-127955308 CACTCCGGTCACTGTGTCCATGG - Exonic
940977682 2:159964658-159964680 CACTGAGCTCACTGTGTCATAGG + Intronic
943127391 2:183811607-183811629 CACTGCACTCACTATAGCCTAGG + Intergenic
944082939 2:195810448-195810470 CACTGCACTCACTCCAACCTGGG - Intronic
949041376 2:241851434-241851456 CACTGCCCTCTGTGTGATCTGGG + Intronic
1168926794 20:1588227-1588249 CTCTGAGCTCACTCTGTCCTTGG + Intronic
1169645229 20:7803165-7803187 CACTGGGCTCTCTGTGAAATGGG - Intergenic
1169682027 20:8226376-8226398 CAGTGTGCTCAGTATGACCTGGG - Intronic
1169869003 20:10231403-10231425 CAGTGCTCACCCTGTGACCTTGG - Intronic
1170367741 20:15616177-15616199 CACTGCGCCCTCTGTCTCCTGGG + Intronic
1170455575 20:16529910-16529932 CACTGCACTCACTCCAACCTGGG + Intronic
1170493048 20:16898020-16898042 CATTGCACTCAAGGTGACCTGGG + Intergenic
1171967271 20:31540055-31540077 CACTAGGCTCACTGTGTGCTTGG - Intronic
1173222866 20:41143717-41143739 CTCAGCTCTTACTGTGACCTTGG + Intronic
1173466862 20:43290230-43290252 CTCTGCCTTCACTGTCACCTGGG + Intergenic
1173844730 20:46180798-46180820 ACCTCAGCTCACTGTGACCTCGG + Intronic
1175993267 20:62800131-62800153 TTCTGCGCTGACTGTGACATTGG + Exonic
1176373536 21:6076439-6076461 CACTGCCCACACCATGACCTTGG + Intergenic
1176623038 21:9071483-9071505 CTGTGCTCCCACTGTGACCTGGG + Intergenic
1177154033 21:17483474-17483496 CACTACGGTCTCTGTGTCCTGGG + Intergenic
1179749941 21:43461804-43461826 CACTGCCCACACCATGACCTTGG - Intergenic
1179982979 21:44906014-44906036 CCCTGGCCTCACTGTGGCCTGGG + Intronic
1180963195 22:19771871-19771893 CGGTGCGCCCACTGTGGCCTCGG + Intronic
1181023627 22:20115883-20115905 CATTGTGCCCACTGTGACGTGGG + Intronic
1181497925 22:23298455-23298477 CACCACACTCAGTGTGACCTGGG + Intronic
1182335587 22:29581259-29581281 CTCTGCGCGCTCTGCGACCTTGG + Exonic
1183203523 22:36402466-36402488 CACTGCAACCTCTGTGACCTGGG - Intergenic
1183715740 22:39532549-39532571 CGCTGCGCGCCCTCTGACCTGGG - Intronic
1184503829 22:44889407-44889429 TACTGGCCTCAGTGTGACCTGGG - Intronic
1185186651 22:49404944-49404966 CACTGCGCTTCCTGAGACCGCGG + Intergenic
950903771 3:16519199-16519221 CTGTGCGCTCACTGTGTGCTAGG + Intergenic
953750433 3:45604543-45604565 CACTCCTCTCACTGTGACCTTGG + Intronic
956189440 3:66594949-66594971 CACTGCAATCTCTGTGTCCTGGG + Intergenic
958581047 3:96023881-96023903 CACTGCGCTCACTCCAGCCTGGG - Intergenic
961315742 3:126034189-126034211 CAATCCGCTCAATGTCACCTTGG + Intronic
965594531 3:170397580-170397602 CACTCCGCTCACTCTTACCCAGG - Intergenic
966246333 3:177811942-177811964 CACTGGTTTCACTGTAACCTAGG - Intergenic
967218960 3:187233347-187233369 CACTGCTCTCACTTTAACCATGG + Intronic
968135739 3:196218197-196218219 AACTGCGGACACTGCGACCTGGG + Intronic
969327873 4:6454148-6454170 CACTGGGCTCTGTCTGACCTTGG - Intronic
969340742 4:6539337-6539359 CCCTGCCCACACTGTGACCTTGG + Intronic
969619033 4:8269775-8269797 CCCTGCGCTCCCTGCGCCCTGGG + Exonic
973723501 4:53749291-53749313 CACTCCACTCACAGTGTCCTGGG - Intronic
977918875 4:102622500-102622522 CACTGCTCTTAGTGTGACCAAGG - Intergenic
979161392 4:117466098-117466120 CCATGCAATCACTGTGACCTTGG + Intergenic
982235313 4:153246762-153246784 CACTGGGCTCACCCTGACCAAGG + Intronic
983779153 4:171645935-171645957 CACTGCACTCACTCCAACCTGGG + Intergenic
987295019 5:16542211-16542233 CACTGCTCTCTCTGTCACCACGG + Intronic
989162875 5:38408671-38408693 CAATGTCCTCACTGTGACCGTGG + Intronic
989358715 5:40574676-40574698 TATTGGGCTCACTCTGACCTGGG + Intergenic
990613251 5:57481516-57481538 CAGTACCATCACTGTGACCTAGG + Exonic
991487993 5:67157726-67157748 CACTGGACTCTCAGTGACCTCGG + Intronic
992508116 5:77407607-77407629 CACTGCCCTGATTGTGACTTAGG - Intronic
995877014 5:116800987-116801009 CACCTTGCTCACTGTGATCTAGG - Intergenic
997554444 5:134783318-134783340 CACTGCGCTCACTGTGACCTCGG + Intronic
998247620 5:140522120-140522142 CACTGCAATCCCTGTGTCCTAGG + Intronic
999032145 5:148306053-148306075 CACTGAGGGCACAGTGACCTAGG - Intergenic
999070119 5:148735806-148735828 CACTGCACTCCATGTGTCCTGGG + Intergenic
1002283388 5:178146469-178146491 CACTGACCTCATGGTGACCTCGG - Intronic
1002322815 5:178385558-178385580 CCCTGCTCTCCCTGTGACCCTGG + Intronic
1006531423 6:34658303-34658325 CACTGCACTCACTCTGACCTAGG + Intronic
1007711453 6:43826730-43826752 CACCTCACTCACTCTGACCTTGG - Intergenic
1007740336 6:44005820-44005842 CACTGACACCACTGTGACCTTGG + Exonic
1009910304 6:69918006-69918028 CACTAGGCTCATTGAGACCTTGG - Intronic
1011928752 6:92682926-92682948 CACTGCTCTCTCTTTGACCTTGG - Intergenic
1016376180 6:143422728-143422750 CACTTAGCACTCTGTGACCTTGG + Intergenic
1019100474 6:169625611-169625633 CACTGGGCTCACTGTCAGGTGGG + Intronic
1019440694 7:1044759-1044781 CGCTGCGCTTACTGGGACCCGGG + Intronic
1019776459 7:2914458-2914480 CACTGCAGTCACTCTGGCCTGGG - Intronic
1020104182 7:5413566-5413588 CACTGCACTCACAGTGGTCTGGG - Intronic
1020439491 7:8202006-8202028 CATTGGGCTGACTGTGTCCTGGG - Intronic
1021346790 7:19539101-19539123 CACTGGGCTCACTGTAACAAAGG - Intergenic
1021961034 7:25873168-25873190 CACTGGAATCTCTGTGACCTAGG - Intergenic
1022391133 7:29945438-29945460 TACTGCCCTCTGTGTGACCTTGG + Intronic
1025005625 7:55352408-55352430 CACTGAGCTCCGTGTGAACTGGG - Intergenic
1031821732 7:126510819-126510841 CACTGCCCTCCATGTGACATTGG + Intronic
1033252506 7:139773229-139773251 CACGGTGATCACTGTGACTTAGG - Intronic
1035140422 7:156753771-156753793 CACAGAGCTCACTGTGATCTCGG - Intronic
1035747448 8:1972587-1972609 CACTGCGATCTCTGCGTCCTGGG - Intergenic
1036115742 8:5959106-5959128 TATTGCGCTCTCAGTGACCTAGG - Intergenic
1038599979 8:28930324-28930346 CACTGCTGTCACTTTAACCTGGG + Intronic
1039913341 8:41842080-41842102 CACTGCTCTGACTGTGACCCAGG + Intronic
1041527715 8:58826157-58826179 TACTGCGTTCACTGTGGTCTGGG - Intronic
1042751166 8:72159329-72159351 CACTCCTCACACTGTGCCCTGGG + Intergenic
1043777283 8:84286011-84286033 CTCTGCTGTCACTGTGATCTGGG - Intronic
1044425587 8:92046400-92046422 CACTGCGCTCTATGTAGCCTGGG - Intronic
1057131001 9:92654703-92654725 CACAGAGCTCCCTGTAACCTGGG + Intronic
1057589416 9:96359263-96359285 CACTGCACTCACTCTAGCCTGGG + Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1058902275 9:109452199-109452221 CTCTCAGCTCACTGTAACCTCGG - Intronic
1059376691 9:113887522-113887544 CACAGCCCCCAATGTGACCTGGG - Intronic
1060061016 9:120459706-120459728 CACTACTATCTCTGTGACCTTGG - Intronic
1060279305 9:122205275-122205297 CACTATGGTCACGGTGACCTTGG - Intronic
1061164385 9:128913853-128913875 CACTGCCACCACTGTGACCAAGG - Intronic
1061666541 9:132163446-132163468 CCCCGCGCTCACTGTAGCCTCGG - Intronic
1061811144 9:133163432-133163454 CTCTCCGCTCACTGTGGCCCGGG - Intronic
1061989961 9:134153515-134153537 CCCGGCCCTCACTGTGACCTCGG + Intronic
1062026281 9:134342212-134342234 CCCTGCCCTCACTCTGGCCTGGG - Intronic
1062721866 9:138048791-138048813 CACTGCAGTCTCTGTGTCCTGGG + Intronic
1203563877 Un_KI270744v1:77571-77593 CTGTGCTCCCACTGTGACCTGGG - Intergenic
1185434243 X:29312-29334 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185434410 X:30898-30920 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185434664 X:33396-33418 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185435089 X:37482-37504 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185435344 X:39980-40002 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185435465 X:41199-41221 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185435692 X:43395-43417 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185437101 X:106326-106348 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185437404 X:109375-109397 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185437756 X:112669-112691 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185438059 X:115718-115740 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185438361 X:118646-118668 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185438779 X:122671-122693 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185439080 X:125659-125681 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185439515 X:129986-130008 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185439894 X:133524-133546 AACTGCCCTCAATGAGACCTAGG + Intergenic
1185443374 X:240769-240791 AACTGCCCTCAATGAGACCTAGG - Intergenic
1185978066 X:4744069-4744091 CACTGAACACTCTGTGACCTTGG + Intergenic
1187906359 X:24070253-24070275 ATCTCGGCTCACTGTGACCTGGG - Intronic
1189286730 X:39857126-39857148 CACTCTGCTCACTGACACCTGGG + Intergenic
1197294733 X:124705037-124705059 CACTGCAATCACAGTGACTTTGG - Exonic
1197961148 X:132007299-132007321 CACTCCTCTCACTCTGACCCTGG - Intergenic
1198270767 X:135054011-135054033 CACTGCACTCTCTGTCGCCTGGG + Intergenic
1200844309 Y:7815651-7815673 GACAGTGCTCACTGTGAGCTGGG + Intergenic
1201159555 Y:11156923-11156945 CTGTGCTCCCACTGTGACCTGGG + Intergenic