ID: 997556549

View in Genome Browser
Species Human (GRCh38)
Location 5:134804213-134804235
Sequence ATAAACCTCCTGACATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997556549 Original CRISPR ATAAACCTCCTGACATCTCA GGG (reversed) Intronic
900728552 1:4235583-4235605 ATAAATCTCATGAGATCTGATGG + Intergenic
900869597 1:5292632-5292654 ATAAATCTCATGAGATCTGATGG - Intergenic
901180152 1:7336214-7336236 GTAGAGCTCCTGGCATCTCAGGG - Intronic
901884656 1:12214606-12214628 ATGACTCTCCTGCCATCTCAGGG + Intergenic
901886103 1:12224342-12224364 ATAAATCTCATGAGATCTGATGG - Intergenic
902235109 1:15052366-15052388 ATAAGTCTCCTGAGATCTGACGG - Intronic
903590202 1:24449651-24449673 ATCTCCCTCCTGCCATCTCAGGG - Intronic
905237724 1:36561611-36561633 ATAAAGCTCCAGACAGCCCAGGG - Intergenic
905469397 1:38180516-38180538 ATAAATCTCATGAGATCTGATGG + Intergenic
905664397 1:39753835-39753857 ATACATCACCTGACATCTAAGGG - Intronic
907507820 1:54934313-54934335 ATAAGTCTCATGAGATCTCATGG - Intergenic
907604667 1:55804744-55804766 ATAAGCCTCATGAGATCTGATGG + Intergenic
907624960 1:56021145-56021167 ATAAATCTCATGAAATCTGATGG - Intergenic
907860522 1:58348183-58348205 ATACACCTCCTAACAACTCTAGG + Intronic
907874542 1:58472960-58472982 ATAAACCCACTGCCTTCTCAGGG + Intronic
908549070 1:65191335-65191357 ATAAACCTCCTTGCATCTTTAGG - Intronic
908932922 1:69339410-69339432 ATAAATCTCATGATATCTAATGG + Intergenic
908949487 1:69542679-69542701 AAAGACAGCCTGACATCTCAAGG + Intergenic
909066171 1:70938717-70938739 ATAAATCTCATGAGATCTGATGG - Intronic
909269053 1:73600121-73600143 ATAAATCTCATGAGATCTGATGG - Intergenic
909274551 1:73667107-73667129 ATAAATCTCGTGAGATCTGATGG + Intergenic
909274913 1:73671081-73671103 ATAAATCTCATGAAATCTAATGG + Intergenic
909291979 1:73894732-73894754 ATAAACCTACTTAAATGTCAAGG - Intergenic
909681408 1:78295450-78295472 ATAAATCTCGTGAGATCTGATGG + Intergenic
909719659 1:78753633-78753655 ATAAGCCTCATGAGATCTGATGG + Intergenic
909759846 1:79272726-79272748 ATAAATCTCATGAGATCTGATGG + Intergenic
909883042 1:80904595-80904617 ATAAGTCTCATGAGATCTCATGG - Intergenic
910715687 1:90226655-90226677 ATAAATCTCATGAGATCTGATGG + Intergenic
911199966 1:95034514-95034536 CTTAACCTCATGACATCTCAGGG + Intronic
911274813 1:95848514-95848536 ATAAGCCTCATGAGATCTGATGG + Intergenic
911275126 1:95850742-95850764 ATAAGTCTCATGACATCTGATGG + Intergenic
911407980 1:97465547-97465569 ATAAATCTCATGAGATCTGATGG + Intronic
911455956 1:98123956-98123978 ATATATCTCATGACATCTGATGG + Intergenic
911535117 1:99090296-99090318 ATAAGCCTCATGAGATCTGATGG + Intergenic
911552085 1:99294708-99294730 AAAAAACTCCTGAAATCTCAAGG + Intronic
911628671 1:100157287-100157309 ATAAGCCTCATGAGATCTGATGG + Intronic
911855213 1:102868251-102868273 ATAAGCCTCATGAGATCTGATGG - Intergenic
911969666 1:104415872-104415894 ATAAATCTCATGAGATCTGATGG - Intergenic
912003040 1:104858349-104858371 ATAAGTCTCATGAGATCTCATGG - Intergenic
914784607 1:150817136-150817158 ATAAACCATCTGACTTCTCAAGG + Exonic
915784779 1:158597634-158597656 ATAAATCTCATGAGATCTAATGG - Intergenic
916477256 1:165182267-165182289 ATAAGTCTCATGACATCTGACGG + Intergenic
917064538 1:171077197-171077219 ATAAATCTCATGAGATCTGATGG + Intergenic
918049340 1:180960639-180960661 ATAAATCTCATGAGATCTGATGG - Intergenic
918580969 1:186128553-186128575 ATAAACATACTGCCTTCTCATGG - Intronic
918711408 1:187736104-187736126 ATAAGCCTCATGAGATCTGATGG - Intergenic
919300236 1:195753293-195753315 ATAAATCTCATGAGATCTGATGG + Intergenic
920254574 1:204645819-204645841 ATAAATCTCATGAGATCTGATGG - Intronic
920597795 1:207290775-207290797 ATAAGTCTCCTGAGATCTGATGG + Intergenic
921936798 1:220803244-220803266 ATAAATCTCATGAGATCTGATGG - Intronic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
924021718 1:239790428-239790450 ATAAATCTCATGAGATCTGATGG + Intronic
924242561 1:242055186-242055208 ATAAGCCTCATGAGATCTGATGG - Intergenic
1062764586 10:51109-51131 ATAAGCCTCATGAGATCTGATGG + Intergenic
1063250494 10:4268647-4268669 ATAAATCTCATGAGATCTGATGG - Intergenic
1064311293 10:14213857-14213879 ATAAGTCTCCTGAGATCTGATGG + Intronic
1065071799 10:22032417-22032439 ATAAATCTCATGAGATCTGACGG + Intergenic
1065226208 10:23546017-23546039 ATAAATCTCATGAGATCTGATGG + Intergenic
1065440671 10:25750446-25750468 ATAAGCCTCATGAGATCTGATGG + Intergenic
1067308801 10:45092966-45092988 ATAAATCTCATGAGATCTGATGG + Intergenic
1067457412 10:46429520-46429542 ATAAACCTCATGAGATGTGATGG - Intergenic
1067629789 10:47955113-47955135 ATAAACCTCATGAGATGTGATGG + Intergenic
1067911310 10:50349680-50349702 ATAAGCCTCATGAGATCTGATGG + Intronic
1068173498 10:53425992-53426014 ATAAGTCTCATGAAATCTCATGG - Intergenic
1069210897 10:65759638-65759660 ATAAATCTCATGAGTTCTCATGG - Intergenic
1069926386 10:71853374-71853396 ATAGAGCTACTGACATCTCAGGG + Intergenic
1070407561 10:76110643-76110665 ATAAGCCTCATGAGATCTGATGG + Intronic
1070533158 10:77355090-77355112 ATAAATCTCATGAGATCTGATGG + Intronic
1070829692 10:79410838-79410860 CTCAACCTCCTGCCATCTCAGGG - Intronic
1072273853 10:93802949-93802971 ATAAACCTCACGAGATCTGATGG + Intergenic
1072769237 10:98124015-98124037 ATAAATCTCATGAGATCTGATGG - Intergenic
1072769499 10:98125905-98125927 ATAAGCCTCATGAGATCTAATGG - Intergenic
1074241992 10:111649055-111649077 ATAAATCTCATGAGATCTGATGG + Intergenic
1074431053 10:113395013-113395035 ATAAGCCTCATGAGATCTGATGG + Intergenic
1074891845 10:117742487-117742509 ATAAGTCTCATGAGATCTCATGG - Intergenic
1075607907 10:123828476-123828498 ATAAGCCTCATGAGATCTGATGG + Intronic
1076025069 10:127105077-127105099 ATAAGCCTCCTGAGATCTGATGG + Intronic
1078405414 11:11066559-11066581 AAAAACCTCCTTCCATCCCATGG - Intergenic
1078408159 11:11089275-11089297 ATAAATCTCATGAGATCTGATGG + Intergenic
1078482072 11:11686485-11686507 ATAAGCCTCATGAGATCTGATGG + Intergenic
1078648462 11:13164563-13164585 ATAAAAGCCCTGACATCTAAAGG - Intergenic
1079182082 11:18202618-18202640 ATAAGCCTCATGAGATCTGATGG - Intronic
1079500121 11:21093753-21093775 ATAAATCTCATGAGATCTGATGG - Intronic
1079585908 11:22126834-22126856 ATAAATCTCATGAGATCTGATGG - Intergenic
1079636721 11:22751432-22751454 ATAAATGTCCTTTCATCTCAAGG + Intronic
1079905467 11:26241074-26241096 ATAAGTCTCATGAGATCTCATGG + Intergenic
1079958244 11:26890194-26890216 ATAAGCCTCATGATATCTGATGG + Intergenic
1080292152 11:30683020-30683042 ATAAATCTCATGAGATCTGATGG + Intergenic
1081054913 11:38397591-38397613 ATAAACCTCACGAGATCTGATGG + Intergenic
1081101544 11:39008079-39008101 ATAAATCTCATGAGATCTGATGG - Intergenic
1081224167 11:40500605-40500627 ATAAGTCTCATGAGATCTCATGG - Intronic
1082080532 11:48009230-48009252 ATAAACATCCTGCCATATCATGG - Intronic
1082692795 11:56326050-56326072 ATAAGTCTCTTGAGATCTCATGG + Intergenic
1082820662 11:57542705-57542727 CTCCACCTCCTGACATCTCAGGG - Exonic
1083542266 11:63520374-63520396 ATAAGTCTCCTGAGATCTGATGG + Intergenic
1084443260 11:69188199-69188221 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1085875883 11:80405521-80405543 GTAAATCTCCCAACATCTCAAGG + Intergenic
1086273239 11:85093668-85093690 ATAAACCTCATGACATCTGATGG - Intronic
1086759073 11:90603992-90604014 ATAAGCCTCATGAGATCTGATGG + Intergenic
1086848539 11:91782231-91782253 ATAAATCTCATGAGATCTGATGG - Intergenic
1088419775 11:109632650-109632672 ATAAACAACATTACATCTCAAGG - Intergenic
1088445756 11:109926036-109926058 ATAAATCTCATGAGATCTGATGG + Intergenic
1088650254 11:111951704-111951726 ATAAACCTCACGATATCTGATGG + Intronic
1089042741 11:115468952-115468974 ATAAATCTCATGACATCTGATGG - Intronic
1089131828 11:116218428-116218450 AAAAACCTTCTGACTTCCCAAGG - Intergenic
1090727515 11:129541054-129541076 ATAAATCTCATGAGATCTGATGG - Intergenic
1091873178 12:3912097-3912119 ATAAAGCACCTGACCTCTCAGGG - Intergenic
1092872545 12:12818841-12818863 ATAAATCTCATGAGATCTGATGG - Intronic
1093014654 12:14144088-14144110 ATAAATCTCATGAGATCTGATGG - Intergenic
1093130863 12:15390458-15390480 ATAAGCCTCATGAGATCTGATGG - Intronic
1093230739 12:16538979-16539001 ATAAATCTCATGAGATCGCATGG - Intronic
1093239808 12:16656398-16656420 ATAAATCTCATGAGATCTGATGG - Intergenic
1093337052 12:17918989-17919011 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1093617532 12:21245287-21245309 TTAAACATCCTTACATCCCAGGG - Intergenic
1093793079 12:23277962-23277984 ATAAATCTCATGAGATCTGATGG + Intergenic
1094265893 12:28559332-28559354 ATAAATCTCTTGAGATCTGATGG - Intronic
1094470101 12:30795504-30795526 AGAATCATCCTCACATCTCAGGG + Intergenic
1094780953 12:33791011-33791033 ATAATTCTCATGACATCTGATGG - Intergenic
1094814372 12:34168818-34168840 ATAAGCCTCATGAGATCTGATGG + Intergenic
1095102554 12:38199771-38199793 ATAAGCCTCATGAGATCTGATGG - Intergenic
1095191047 12:39258470-39258492 ATAAATCTCATGAGATCTGACGG - Intergenic
1095347184 12:41164887-41164909 ATAAATCTCATGAGATCTGATGG + Intergenic
1096402489 12:51318762-51318784 TTAATCCTCCTGACAACTCAAGG - Intronic
1096442088 12:51651569-51651591 ATAAGTCTCCTGAGATCTGATGG - Intronic
1096922956 12:55109267-55109289 ATAAGTCTCATGAGATCTCATGG + Intergenic
1097515281 12:60596871-60596893 ATAAGCCTCATGATATCTGACGG - Intergenic
1097669072 12:62514540-62514562 ATAAATCTCATGAGATCTGATGG - Intronic
1097893842 12:64804842-64804864 ACAAACCTCCCCACATCACAGGG - Intronic
1098163761 12:67672652-67672674 ATAAGCCTCATGAGATCTGATGG - Intergenic
1098578286 12:72069717-72069739 ATAAGCCTCATGAGATCTGATGG - Intronic
1098995138 12:77110564-77110586 ATAAATCTCATGATATCTGATGG + Intergenic
1099104919 12:78485826-78485848 ATAAATCTCAGGACATCTGATGG - Intergenic
1099405794 12:82260503-82260525 ATAAATCTCATGAGATCTGATGG + Intronic
1099507910 12:83501139-83501161 ATAAATCTCATGAGATCTGATGG + Intergenic
1099901879 12:88721178-88721200 AGAAATCACTTGACATCTCACGG + Intergenic
1100107637 12:91196223-91196245 ATAAGCCTCATGAGATCTGATGG - Intergenic
1100924157 12:99524781-99524803 ATAAATCTCATGAGATCTGATGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101517927 12:105454027-105454049 ATAAATCTCATGAGATCTGATGG + Intergenic
1102884646 12:116512388-116512410 ATAAGCCTCATGAGATCTGATGG - Intergenic
1103002908 12:117399343-117399365 ATAAATCTCATGAGATCTGATGG - Intronic
1103226202 12:119290281-119290303 ATAAATCTCATGAGATCTGATGG - Intergenic
1104070739 12:125343193-125343215 ATAAACCACCTTACATATCCTGG - Intronic
1104589385 12:130071984-130072006 ATAAATCTCATGAGATCTGATGG - Intergenic
1105052303 12:133065625-133065647 ATAAATCTCATGAGATCTGATGG - Intergenic
1105811987 13:24003342-24003364 GTAAACCTGCTGTTATCTCATGG - Intronic
1106116925 13:26825772-26825794 ATAAGTCTCATGACATCTGATGG - Intergenic
1106942649 13:34794910-34794932 ATACATCTCATGAGATCTCATGG + Intergenic
1107060205 13:36152131-36152153 ATAAGCCTCATGAGATCTGATGG + Intergenic
1107431239 13:40342359-40342381 ATAAATCTCATGAGATCTGATGG - Intergenic
1108184457 13:47874413-47874435 ATAAGTCTCATGACATCTGATGG - Intergenic
1108270728 13:48756820-48756842 ATAAATCTCATGAGATCTGATGG + Intergenic
1108342287 13:49509678-49509700 ATAAATCTCATGAAATCTGATGG + Intronic
1108419325 13:50232860-50232882 ATAAATCTCATGAGATCTGATGG + Intronic
1108778461 13:53796954-53796976 ATGAATCTCATGACATCTGATGG - Intergenic
1109038333 13:57296262-57296284 TTAAACCTCCTAACATTTTAAGG + Intergenic
1109562054 13:64062572-64062594 ATAATTCTCATGATATCTCATGG - Intergenic
1109614296 13:64809782-64809804 ATAAACCTCATGAGATCTGATGG + Intergenic
1109794324 13:67289732-67289754 ATAAACCTCCTGTCTTCTGCTGG + Intergenic
1110049060 13:70872072-70872094 ATAAGCCTCATGAAATCTCATGG - Intergenic
1110383188 13:74877826-74877848 ATAAATCTCATGAGATCTGATGG + Intergenic
1110644622 13:77868039-77868061 CTAAAACTACTGTCATCTCAAGG + Intergenic
1111065047 13:83079741-83079763 ATAAATCTCATGAGATCTGATGG - Intergenic
1111515328 13:89323695-89323717 ATAAACATTCTGTCATCTCTTGG - Intergenic
1111543858 13:89703891-89703913 ATATATCTCATGAGATCTCATGG - Intergenic
1111685946 13:91500892-91500914 ATAAATCTCATGAGATCTGATGG + Intronic
1111798959 13:92959337-92959359 ATAAATCTCATGAGATCTGATGG - Intergenic
1112062902 13:95759209-95759231 CTCAACCTCCTGCCCTCTCACGG + Intronic
1112100854 13:96187689-96187711 CTAAACATCCTGACATGTCATGG + Intronic
1112953293 13:105029482-105029504 ATAAGTCTCATGACATCTGATGG - Intergenic
1112971836 13:105271089-105271111 ATAAATCTCATGAGATCTGATGG + Intergenic
1113501973 13:110782940-110782962 ATAAGCCTCATGAGATCTGATGG - Intergenic
1113508849 13:110835580-110835602 ATAAACCTGCTGAGATTTCAAGG - Intergenic
1113649248 13:112023863-112023885 ATAAATCTCATGAGATCTGATGG - Intergenic
1114158451 14:20133948-20133970 ATAAATCTCATGAGATCTGATGG + Intergenic
1114921794 14:27341918-27341940 ATAAGCCTCATGAGATCTGATGG + Intergenic
1114975980 14:28099987-28100009 ATAAATCTCATGAGATCTGATGG + Intergenic
1118057128 14:62090925-62090947 ATAAATCTCATGAGATCTGATGG - Intronic
1118116594 14:62784217-62784239 ATAAATCTCATGAGATCTGATGG - Intronic
1118603409 14:67486250-67486272 ATAAATCTCATGAGATCTGATGG + Intronic
1118688720 14:68317457-68317479 ATGACCTTCCTGACATCACACGG - Intronic
1119994786 14:79241502-79241524 ATAAATCTCATGAGATCTGATGG - Intronic
1120390534 14:83902005-83902027 ATAAGTCTCATGAGATCTCATGG - Intergenic
1121128969 14:91428117-91428139 ATAAATCTCATGAGATCTGATGG + Intergenic
1121299974 14:92862512-92862534 ATAAGCCTCATGAGATCTGATGG - Intergenic
1121974487 14:98390254-98390276 AAAAACCTCATGAGATCTGATGG + Intergenic
1121996924 14:98609745-98609767 ACGAACCTGCTGACAGCTCAGGG + Intergenic
1122380076 14:101296742-101296764 ATAAATCTCATGAGATCTAATGG - Intergenic
1123158532 14:106254216-106254238 ATAAGTCTCATGAGATCTCATGG - Intergenic
1124357465 15:29006679-29006701 ATAAATCTCATGAGATCTGATGG - Intronic
1124510739 15:30322269-30322291 ATAAACCCCATGAAATCTCGAGG - Intergenic
1124732149 15:32208266-32208288 ATAAACCCCATGAAATCTCGAGG + Intergenic
1126514321 15:49518627-49518649 ATAAGTCTCCTGAGATCTGAAGG - Intronic
1127826398 15:62707767-62707789 CTTAACCTACTGACATCTAAGGG - Intronic
1128138147 15:65279221-65279243 TTAATCCTCCTAACAACTCAGGG - Intronic
1128246813 15:66138631-66138653 AGAAACCTCCTGAGATTCCAGGG - Intronic
1130376645 15:83335096-83335118 ATAAGCCTCATGAGATCTGATGG + Intergenic
1130671627 15:85917966-85917988 ATAAGCCTCATGAGATCTGATGG + Intergenic
1130720798 15:86384196-86384218 TGAAAGCTCCTGACACCTCAAGG - Intronic
1130749650 15:86697572-86697594 ATCAACCTTCTGACAATTCAGGG + Intronic
1131619741 15:94054970-94054992 ATAAATCTCATGAGATCTGATGG + Intergenic
1133864752 16:9632367-9632389 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1135209765 16:20514888-20514910 ATAAATCTCATGAGATCTGATGG + Intergenic
1135784979 16:25340558-25340580 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1136013557 16:27380743-27380765 ATAAGTCTCATGACATCTGATGG + Intergenic
1137066189 16:35846798-35846820 ATAAACCCACTGACACTTCAAGG + Intergenic
1138140118 16:54560634-54560656 ATAAATCTCATGAGATCTGATGG + Intergenic
1138164119 16:54784343-54784365 ATAGACCTACAGAAATCTCAAGG + Intergenic
1138292521 16:55860102-55860124 ATAAATCTCATGAGATCTGATGG + Intronic
1138742835 16:59330845-59330867 ATAAGCCTCATGAGATCTGATGG - Intergenic
1139122893 16:64042402-64042424 ATAAGTCTCATGACATCTCATGG - Intergenic
1141328486 16:83085256-83085278 ATAAATCTCAAGACATCTGATGG - Intronic
1141781789 16:86167352-86167374 AGAACCCAGCTGACATCTCAGGG + Intergenic
1142110010 16:88326237-88326259 ATAAGCCTCATGAGATCTGATGG + Intergenic
1142440067 16:90092143-90092165 ATAAGCCTCATGAGATCTGATGG - Intergenic
1143980409 17:10864489-10864511 ATAAATCTCATGAGATCTGATGG + Intergenic
1145378298 17:22372043-22372065 ATAAGCCTCATGAGATCTGATGG - Intergenic
1145753531 17:27373027-27373049 ATAAGTCTCATGAGATCTCATGG + Intergenic
1146089001 17:29857338-29857360 ATAAGTCTCCTGAGATCTGATGG - Intronic
1146214563 17:30968949-30968971 CTTGACCTCCTGAGATCTCATGG + Intronic
1147235214 17:39051950-39051972 AGAAACCGCCTGACACCTGAAGG + Intergenic
1147422971 17:40331736-40331758 ACAAACCTCTTGACATTTGATGG + Intronic
1147520670 17:41169342-41169364 ATAAGCCTCATGAGATCTGATGG + Intergenic
1147949201 17:44097591-44097613 ATAACCCTCCGGCCAGCTCAGGG - Intronic
1149064810 17:52466630-52466652 ATAAATCTCATGAGATCTGATGG + Intergenic
1149334533 17:55621861-55621883 ATAAGTCTCATGACATCTGATGG - Intergenic
1149735889 17:58993097-58993119 ATAAGCCTCATGAGATCTGATGG + Intronic
1149896479 17:60432428-60432450 ATAAGTCTCATGAGATCTCATGG - Intergenic
1150191456 17:63244862-63244884 ATAAATCTCTTGATTTCTCATGG + Intronic
1150497242 17:65617365-65617387 ATAAATCTTATGAGATCTCATGG - Intronic
1151051676 17:70985313-70985335 ATAAGTCTCGTGACATCTAATGG - Intergenic
1151105967 17:71617721-71617743 ATAAATCTCATGAGATCTGATGG + Intergenic
1151205752 17:72505538-72505560 ATAAGCCTCATGAGATCTGATGG - Intergenic
1151279722 17:73064463-73064485 TTTAACCTCCAGGCATCTCAAGG - Intronic
1152957486 18:51414-51436 ATAAGCCTCATGAGATCTGATGG + Intronic
1153077440 18:1181016-1181038 ATAAATCTCATGAGATCTGATGG - Intergenic
1153101078 18:1470376-1470398 ATAAGCCTCATGAGATCTGATGG - Intergenic
1153214955 18:2810853-2810875 ATAAGTCTCATGACATCTGATGG - Intergenic
1153376159 18:4381990-4382012 ATAAGTCTCATGAGATCTCACGG - Intronic
1155329079 18:24696333-24696355 ATAAGCCTCATGAGATCTGATGG + Intergenic
1155675504 18:28424725-28424747 ATAAATCTCATGAGATCTAAAGG + Intergenic
1155753172 18:29454987-29455009 ATACATCTCATGACATCTGATGG - Intergenic
1156331152 18:36124666-36124688 TCAAAGCTACTGACATCTCATGG - Exonic
1156640899 18:39096825-39096847 ATACATCTCCTGAGATCTGATGG - Intergenic
1156901784 18:42308865-42308887 ATAAATCTCATGAGATCTGATGG - Intergenic
1158061366 18:53347836-53347858 ATGAGCCTCATGAGATCTCATGG - Intronic
1158644808 18:59236617-59236639 ATAAGTCTCATGAGATCTCATGG - Intergenic
1158789583 18:60761487-60761509 ATAAATCTCATGAGATCTGATGG + Intergenic
1158899626 18:61950540-61950562 ATAACATTCCTGAGATCTCAGGG + Intergenic
1158908269 18:62035063-62035085 ATAAATCTCATGAGATCTGATGG + Intergenic
1159583685 18:70262562-70262584 ATAAGTCTCATGACATCTGATGG + Intergenic
1159776516 18:72608934-72608956 ATAAGTCTCATGACATCTGATGG - Intronic
1159838935 18:73373558-73373580 ATAAGACTCATGACATCTGATGG + Intergenic
1160464572 18:79065550-79065572 ATAAGTCTCATGAAATCTCATGG + Intergenic
1163078575 19:14918647-14918669 ATAAATCTCATGAGATCTGACGG + Intergenic
1164277696 19:23735917-23735939 ATAAGCCTCATGAGATCTGATGG - Intergenic
1165290499 19:34880484-34880506 ATAAATCTCATGCGATCTCATGG + Intergenic
1165761020 19:38321151-38321173 CTAAATCTCCAGACCTCTCAGGG + Intronic
1166629369 19:44391586-44391608 ATAAATCTCATGAGATCTGATGG - Intronic
1167403335 19:49287563-49287585 ATAAATCTCATGAGATCTGATGG + Intergenic
1167577574 19:50325193-50325215 ATAAAGCCCATGACATCTCTAGG - Intronic
1167872964 19:52388990-52389012 ATAAATCTCATGAGATCTTATGG - Intergenic
925066955 2:935456-935478 ATAAATCTCATGAGATCTGATGG - Intergenic
925066988 2:935798-935820 ATAAATCTCATGAGATCTGATGG - Intergenic
925067000 2:935969-935991 ATAAATCTCATGAGATCTGATGG - Intergenic
925067009 2:936083-936105 ATAAATCTCATGAGATCTGATGG - Intergenic
925067030 2:936311-936333 ATAAATCTCATGAGATCTGATGG - Intergenic
925067051 2:936603-936625 ATAAATCTCATGAGATCTGATGG - Intergenic
925067082 2:936943-936965 ATAAATCTCATGAGATCTGATGG - Intergenic
925067095 2:937113-937135 ATAAATCTCATGAGATCTGATGG - Intergenic
925067100 2:937170-937192 ATAAATCTCATGAGATCTGATGG - Intergenic
925234589 2:2266769-2266791 ATAAGTCTCATGAGATCTCACGG + Intronic
925689773 2:6509880-6509902 ATAAATCTCATGAGATCTGATGG + Intergenic
925803765 2:7628371-7628393 ATAAACCTCATGATATCTGATGG - Intergenic
925844467 2:8023092-8023114 ATAAACCTCACGAGATCTGATGG + Intergenic
926109200 2:10171246-10171268 TTAATCCTCCTGACAGCCCAGGG - Intronic
926870627 2:17411645-17411667 ATAAGTCTCATGACATCTGATGG + Intergenic
927437654 2:23084053-23084075 ATAAAACCACTGCCATCTCAGGG - Intergenic
927458501 2:23277618-23277640 AAAGACCTCCTGCCCTCTCATGG - Intergenic
929070955 2:38029977-38029999 GTAAGCCTCATGAGATCTCATGG - Intronic
929864724 2:45708461-45708483 ATAAGCCTCATGAGATCTGATGG + Intronic
930076284 2:47408128-47408150 ATAAGCCTCATGAGATCTGATGG + Intronic
931079572 2:58753753-58753775 ATAAATCTCATGAGATCTGATGG + Intergenic
931152601 2:59591400-59591422 ATAAATCTGCTGATATCCCAAGG + Intergenic
933181155 2:79229383-79229405 ATAAATCTCATGACATCTGATGG + Intronic
933419938 2:82032012-82032034 ATAAACCTCAAGAAATCTGATGG - Intergenic
935577742 2:104728417-104728439 ATAAGTCTCCTGAGATCTGATGG + Intergenic
936847078 2:116849790-116849812 ATTATCCTCCTTACATCTCTAGG + Intergenic
936877123 2:117203510-117203532 ATAATCATCCTGACATATTAAGG + Intergenic
936915593 2:117636434-117636456 ATAAATCTCATGAGATCTGATGG + Intergenic
936977831 2:118237187-118237209 ATAAACTTCCTGAGGTCACATGG + Intergenic
937293102 2:120793820-120793842 AAATGCCTCCTGACACCTCAGGG - Intronic
937588900 2:123590654-123590676 ATAAATCTCATGAGATCTGAAGG - Intergenic
939091932 2:137790246-137790268 ATAAGTCTCCTGAGATCTGATGG - Intergenic
940462141 2:153978547-153978569 ATAAGCCTCATGAGATCTGATGG + Intronic
940502096 2:154505363-154505385 ATAAATCTCATGAGATCTGACGG + Intergenic
941158156 2:162003476-162003498 ATGAACCTCCTTAGATGTCAAGG + Intronic
941211680 2:162647594-162647616 ATAAGTCTCATGAGATCTCATGG + Intronic
942319425 2:174723688-174723710 ATAAGTCTCCTGAGATCTAATGG + Intergenic
942725573 2:179003297-179003319 ATAAACCTCCTGTCAAAGCATGG + Intronic
943242311 2:185400473-185400495 ATAAGTCTCATGAGATCTCATGG - Intergenic
943245852 2:185450484-185450506 ATAAATCTCATGAGATCTGATGG - Intergenic
943307134 2:186276764-186276786 ATAAGCCTCTTGAGATCTTACGG - Intergenic
943495934 2:188620882-188620904 ATAAATCTCATGAGATCTGATGG - Intergenic
943565204 2:189508818-189508840 ATAAGTCTCATGACATCTGATGG + Intergenic
943565479 2:189510770-189510792 ATAAGTCTCATGACATCTGATGG + Intergenic
943914186 2:193607238-193607260 ATAAGCCTCATGATATCTGATGG - Intergenic
943939350 2:193971140-193971162 ATAAGCCTCATGAGATCTGATGG - Intergenic
944252112 2:197588907-197588929 ATAAATCTCATGAGATCTGATGG + Intronic
946108385 2:217392038-217392060 ATAAATCTCATGAGATCTGATGG - Intronic
946757908 2:222965335-222965357 ATAAATCTCATGAGATCTGATGG - Intergenic
946764988 2:223032343-223032365 ATAAATCTCATGAGATCTGATGG + Intergenic
947036264 2:225860676-225860698 ATAAATCTCATGAGATCTGATGG - Intergenic
947093804 2:226543554-226543576 ATAAGCCTCATGAGATCTGATGG + Intergenic
947276413 2:228397012-228397034 ATAAATCTCATGAGATCTGATGG - Intergenic
947832324 2:233150275-233150297 ATAAATCTCATGAGATCTGATGG + Intronic
947889311 2:233603028-233603050 ATAAATCTCATGAGATCTGATGG - Intergenic
948252363 2:236539912-236539934 ATAAATCTCATGAGATCTGATGG - Intergenic
948310683 2:236983613-236983635 ATAAATCTCATGAGATCTGATGG + Intergenic
948540666 2:238689726-238689748 ATAAACCTCCCAACATCCAAAGG + Intergenic
1168766152 20:382483-382505 ATGACACTCCTTACATCTCAAGG - Intronic
1168950085 20:1791906-1791928 ATAAATCTCATGAGATCTGATGG - Intergenic
1169639257 20:7731578-7731600 ATAAATCTCATGAGATCTGATGG - Intergenic
1169776093 20:9254789-9254811 ATAAACATCCCCACATTTCAAGG - Intronic
1169951452 20:11048843-11048865 ATAAACCATCTGAGGTCTCAGGG + Intergenic
1170194172 20:13673728-13673750 ATAAGTCTCATGACATCTAATGG + Intergenic
1170866792 20:20164941-20164963 ATAAGTCTCATGAAATCTCATGG - Intronic
1171018992 20:21568037-21568059 TTACTCCTCCTGACATCTGAAGG - Intergenic
1171571342 20:26254512-26254534 ATAAGCCTCATGAGATCTGATGG + Intergenic
1171775565 20:29364194-29364216 ATAAGCCTCATGAGATCTGATGG + Intergenic
1172426813 20:34861174-34861196 ATCAACTTCGTGACATTTCAGGG + Intronic
1173157453 20:40626345-40626367 ATAATCCTCATGAGATCTGATGG - Intergenic
1174548441 20:51343897-51343919 ATAAGTCTCATGACATCTGATGG + Intergenic
1174554625 20:51384960-51384982 ATAAACCTCATGACATTTTGTGG - Intergenic
1174703151 20:52629644-52629666 ATAAGCCTCATGAGATCTCATGG + Intergenic
1174745374 20:53057048-53057070 ATAAATCTCATGAGATCTGATGG + Intronic
1175309835 20:58004015-58004037 ATTTTCCTCCTGACATCTCTTGG - Intergenic
1175543106 20:59760491-59760513 ATAAGCCTCATGAGATCTGATGG + Intronic
1175634852 20:60572430-60572452 ATTAACCTCCTGAGATGTCAAGG + Intergenic
1176658005 21:9605268-9605290 ATAAATCTCATGAGATCTGATGG + Intergenic
1177581267 21:23024336-23024358 TTAAGGCTCTTGACATCTCAGGG - Intergenic
1177584756 21:23076232-23076254 CTAAACTTCCTGTCAACTCAAGG - Intergenic
1177599362 21:23290033-23290055 ATAAATCTCATGAGATCTGATGG + Intergenic
1177614555 21:23500185-23500207 ATGAGTCTCCTGAGATCTCATGG - Intergenic
1177681958 21:24383177-24383199 ATAAGTCTCATGACATCTGATGG - Intergenic
1178135576 21:29623241-29623263 ATAAGTCTCATGAGATCTCATGG - Intronic
1178261732 21:31106270-31106292 ATAAATCTCATGAGATCTGATGG - Intergenic
1181507120 22:23366815-23366837 ATAAAGCTCATGAGATCTGATGG + Intergenic
1183006494 22:34907098-34907120 ATAAATCTCATGAGATCTGATGG + Intergenic
1185192163 22:49445783-49445805 ATAAGTCTCCTGAGATCTGATGG - Intronic
949936574 3:9120686-9120708 ATAAACCTGATGACAACCCAGGG - Intronic
950179165 3:10899028-10899050 ATAAATCTCATGAGATCTGATGG - Intronic
950393194 3:12712879-12712901 ATAAGCCTCATGAAATCTGATGG - Intergenic
950700545 3:14742842-14742864 ATAAATCTCATGAGATCTGATGG - Intronic
950700838 3:14744757-14744779 ATAAATCTCATGAGATCTGATGG - Intronic
951289845 3:20862490-20862512 ATAAATCTCATGAAATCTGATGG - Intergenic
951737539 3:25884508-25884530 ATAAATCTCATGAGATCTGATGG - Intergenic
952915258 3:38233093-38233115 ATAAACCTCCAGACATCTCCTGG - Intronic
953841546 3:46393838-46393860 ATGAGCCTTCTGATATCTCAGGG + Intergenic
955532012 3:59883479-59883501 ATAAGTCTCCTGAAATCTGATGG - Intronic
955872675 3:63456100-63456122 ATAAATCTCATGATATCTGATGG - Intronic
956551070 3:70460580-70460602 ATAAGTCTCATGAGATCTCATGG + Intergenic
956974677 3:74565947-74565969 ATAAGTCTCATGAGATCTCATGG + Intergenic
957105509 3:75882811-75882833 ATAAATCTCATGAGATCTGATGG - Intergenic
957311896 3:78530814-78530836 ATCAACCTCCTAATATCTCCTGG + Intergenic
957313487 3:78548298-78548320 ATAAGTCTCATGAGATCTCATGG - Intergenic
957403793 3:79750613-79750635 ATGAATCTCCTGAGATCTGATGG + Intronic
957692869 3:83595234-83595256 ATAAATCTCATGAGATCTGATGG + Intergenic
957694449 3:83617156-83617178 ATAATTCTCATGAGATCTCATGG - Intergenic
957704136 3:83756874-83756896 ATAAGTCTCATGACATCTGATGG + Intergenic
958550717 3:95608337-95608359 ATAAGTCTCATGACATCTGATGG - Intergenic
958999397 3:100944871-100944893 TAGAGCCTCCTGACATCTCATGG - Intronic
960021950 3:112964917-112964939 ATAAATCTCATGAGATCTGATGG + Intronic
961701711 3:128749665-128749687 ATAAATCTCATGAGATCTGATGG + Intronic
962322480 3:134403248-134403270 ATAAACCTCATGAGATCTGATGG + Intergenic
963072697 3:141318186-141318208 ATAAGTCTCATGAGATCTCATGG - Intergenic
963453700 3:145516872-145516894 ATAAGCCTCATGATATCTGATGG + Intergenic
963975060 3:151471122-151471144 ATAAGCCTCATGAGATCTGATGG + Intergenic
964054787 3:152440473-152440495 ATAAGTCTCATGACATCTGATGG - Intronic
964737951 3:159935350-159935372 ATAAAACTCATGAAATCTGATGG - Intergenic
965007197 3:163042044-163042066 ATAAATCTCATGAGATCTGATGG - Intergenic
965355804 3:167671534-167671556 ATGAACCTTCAGACATCTTAAGG - Intergenic
965666329 3:171097564-171097586 ATAAATCTCAGGACATCTGATGG + Intronic
966153736 3:176893274-176893296 ATAAATCTCATGAGATCTGATGG + Intergenic
966513930 3:180796058-180796080 ATAAGCCTCATGAGATCTGATGG + Intronic
967155204 3:186685553-186685575 ATAAATCTCATGAGATCTGATGG - Intergenic
967572640 3:191048895-191048917 AAAAACCTACTGTCATCTCTGGG - Intergenic
967675491 3:192294053-192294075 ATAAATCTCATGAGATCTGATGG + Intronic
968907302 4:3460468-3460490 ATAAGTCTCATGAGATCTCATGG - Intergenic
968980502 4:3846527-3846549 ATAAGTCTCCTGAGATCTGATGG + Intergenic
969083640 4:4639526-4639548 ATAAGCCTCCTGAGATCTGATGG - Intergenic
969851767 4:9963191-9963213 ATAAGCCTCATGAGATCTGATGG - Intronic
970369500 4:15393096-15393118 ATAAATCTCATGAGATCTGATGG + Intronic
970599059 4:17626650-17626672 ATAAACCTACTCACATCTTCAGG + Exonic
970663634 4:18312766-18312788 ATAAACCTCTTAAGATCTGATGG - Intergenic
970683578 4:18539072-18539094 GTAAACCTCCAGACAACACATGG - Intergenic
970830796 4:20337332-20337354 ATACATCTCATGACATCTGATGG - Intronic
970898323 4:21129116-21129138 ATAAGTCTCATGAGATCTCATGG + Intronic
970956183 4:21814412-21814434 ATAAGTCTCATGAGATCTCATGG + Intronic
971112667 4:23606385-23606407 ATAAGCCTCATGAGATCTGATGG + Intergenic
971126395 4:23760067-23760089 ATAAGTCTCATGACATCTGATGG - Intronic
971248126 4:24948853-24948875 ATAAATCTCATGAGATCTGATGG + Intronic
971622271 4:28870411-28870433 ATAAATATTCAGACATCTCAGGG - Intergenic
971705633 4:30038937-30038959 ATAAGTCTCATGAAATCTCATGG - Intergenic
972087950 4:35242751-35242773 ATAAATTTCATGATATCTCAGGG + Intergenic
972137489 4:35909474-35909496 ATAAATCTCATGAGATCTGATGG + Intergenic
972227981 4:37036325-37036347 ATAAGCCTCATGAGATCTGATGG - Intergenic
972275529 4:37554101-37554123 ATAAATCTCATGAGATCTGATGG + Intronic
972382793 4:38535212-38535234 ATAAGCCTCATGAGATCTGATGG - Intergenic
972574992 4:40343438-40343460 ATAAATCTCATGAGATCTGATGG - Intronic
972939293 4:44177575-44177597 ATAAACCTCATGAGACCTGATGG + Intronic
973657137 4:53059724-53059746 GTCAACCTCCTGACATATCAAGG - Intronic
975403165 4:73960941-73960963 ATAAACCTCATGACATCTGATGG + Intergenic
975947561 4:79725989-79726011 ATCACCCTCCTGATATTTCATGG - Intergenic
976095189 4:81501187-81501209 ATGAATCTCCTGACATCTTCTGG + Intronic
976983694 4:91266015-91266037 ATAAATCTCATAAGATCTCATGG - Intronic
977116196 4:93031593-93031615 ATAAATCTCATGAGATCTGATGG + Intronic
978100922 4:104840528-104840550 ATAAGTCTCCTGAGATCTGATGG - Intergenic
978201402 4:106027594-106027616 ATAAATCTCATGAGATCTGAAGG + Intergenic
978226104 4:106337402-106337424 ATAAGTCTCATGAGATCTCATGG + Intronic
978240189 4:106505855-106505877 ATGTAGGTCCTGACATCTCAGGG + Intergenic
979346868 4:119598365-119598387 TCCAAACTCCTGACATCTCAAGG + Intronic
979419803 4:120489609-120489631 ATAAATCTCATGAGATCTGATGG - Intergenic
980201178 4:129658007-129658029 ATAAGTCTCATGACATCTGATGG - Intergenic
980264174 4:130493719-130493741 ATAAATCTCATGAGATCTGATGG - Intergenic
980391612 4:132155099-132155121 ATAACTCTCATGACATCTGATGG - Intergenic
980456002 4:133044276-133044298 ACAATCCTCTTGACATCTCTTGG + Intergenic
980545923 4:134261159-134261181 ATAAAACTCATGATATCTCATGG - Intergenic
980875356 4:138656830-138656852 ATAAATCTCCTAACACCTCGTGG + Intergenic
981918186 4:150057493-150057515 ATAAGTCTCATGAGATCTCATGG + Intergenic
982124383 4:152171786-152171808 ATAAATCTCATGAGATCTGATGG + Intergenic
982127272 4:152195274-152195296 ATAAGTCTCATGAGATCTCATGG + Intergenic
982229857 4:153198362-153198384 ATAAGTCTCATGAGATCTCATGG + Intronic
982577636 4:157135489-157135511 ATAAGCCTCATGAGATCTCATGG + Intronic
982968764 4:161951072-161951094 ATAAGTCTCATGACATCTGATGG + Intronic
983033315 4:162830578-162830600 ATAAATCTCATGAGATCTAATGG + Intergenic
983874569 4:172861726-172861748 ATAAGTCTCAGGACATCTCATGG + Intronic
984434633 4:179693639-179693661 ATAAAACATCTTACATCTCAAGG + Intergenic
985159826 4:187033109-187033131 ATAAATCTCATGAGATCTGATGG + Intergenic
985417406 4:189750805-189750827 ATAAATCTCATGAGATCTGATGG - Intergenic
986201204 5:5580379-5580401 ATAAATCTCATGAGATCTGATGG + Intergenic
986612087 5:9579047-9579069 AGAAACATCTTGACATCTCTGGG - Intergenic
986864899 5:11974689-11974711 GTAAGCCTCATGAGATCTCATGG - Intergenic
986882155 5:12187404-12187426 ATAAATCTTCTTACATCACATGG - Intergenic
987218940 5:15769536-15769558 ATAATCCTCCTGGCACCACATGG + Intronic
987225232 5:15832959-15832981 ATAAGCCTCATGATATCTGATGG + Intronic
987659427 5:20853916-20853938 ATAATCCTCATGAGATCTGATGG + Intergenic
988356856 5:30187748-30187770 ATAAATCTCATGAGATCTCATGG + Intergenic
988388127 5:30593135-30593157 ATAAGCCTCATGAGATCTGATGG - Intergenic
988400593 5:30755132-30755154 ATAAGTCTCATGATATCTCATGG + Intergenic
988644105 5:33074942-33074964 ATAAACTTCCTGAGATCTTCAGG - Intergenic
988764222 5:34351731-34351753 ATAATCCTCATGAGATCTGATGG - Intergenic
988865615 5:35331217-35331239 ATAAACCTCACGAGATCTGACGG + Intergenic
988979673 5:36554076-36554098 ATAAACCTCCTATCTTCTCCTGG + Intergenic
989181657 5:38583866-38583888 ATAAGTCTCATGACATCTGATGG + Intronic
989532698 5:42525782-42525804 ATAAGTCTCCTGAGATCTGAGGG + Intronic
989751305 5:44897016-44897038 ATAAATCTCATGAGATCTGATGG + Intergenic
990016879 5:51073908-51073930 ATAAGCCTCATGAGATCTGATGG - Intergenic
990080429 5:51906296-51906318 ATAAGCCTCATGAGATCTGATGG + Intergenic
990448064 5:55911243-55911265 ATAAATCTCATGAGATCTGATGG - Intronic
990497584 5:56363950-56363972 ATAAGTCTCATGAGATCTCATGG + Intergenic
991183712 5:63784267-63784289 ATAAATCTCATGAGATCTGATGG + Intergenic
992743799 5:79799323-79799345 ATAAAACTCTGGAAATCTCAAGG - Intronic
992775542 5:80085684-80085706 ATTCACCTCCTGACTTTTCATGG + Intergenic
993126009 5:83836388-83836410 ATAGATCTCCTGACATGTCCTGG + Intergenic
993755139 5:91719899-91719921 ATAAACATCCAGACATCTGCTGG - Intergenic
993875582 5:93302946-93302968 AAAAACATCCTGAAACCTCAGGG + Intergenic
994251247 5:97540143-97540165 ATAAATCTCATGAGATCTGATGG - Intergenic
994536322 5:101034451-101034473 ATAAATCTCATGAGATCTGATGG + Intergenic
994760355 5:103844241-103844263 ATAAGTCTCATGAGATCTCACGG - Intergenic
994878600 5:105457181-105457203 ATAAAACTCCTAATATCTGAGGG + Intergenic
995212318 5:109554127-109554149 ATAAGCCTCATGAGATCTGATGG - Intergenic
995412625 5:111875926-111875948 ATAAAACCCCTTACATTTCACGG - Intronic
995944181 5:117622710-117622732 ATAACCCTCCTGACAGCACTAGG + Intergenic
996560194 5:124820213-124820235 ATAAATCTCATGAGATCTGATGG + Intergenic
997556549 5:134804213-134804235 ATAAACCTCCTGACATCTCAGGG - Intronic
997854828 5:137363998-137364020 ATAAACAGCCTGAGATCCCAGGG + Intronic
998086053 5:139324508-139324530 ATTGAACTCCTGAGATCTCAGGG + Intronic
999579281 5:153017532-153017554 ATAAACAACTTTACATCTCATGG + Intergenic
1000363614 5:160470740-160470762 ATAAAACTCTGCACATCTCAGGG + Intergenic
1000398104 5:160797059-160797081 TGAAACCCCCTGACAACTCAGGG - Intronic
1000571988 5:162925811-162925833 ATAAGTCTCATGACATCTGATGG - Intergenic
1000703423 5:164481226-164481248 ATAAATCTCATGAGATCTGATGG - Intergenic
1001113692 5:168920985-168921007 CTAAACCTCTTGACAGCTCAAGG - Intronic
1002013195 5:176301248-176301270 ATAAATCTCATGAGATCTGATGG + Intronic
1002214645 5:177621498-177621520 ATAAATCTCATGAGATCTGATGG - Intergenic
1002320048 5:178369620-178369642 ATAAGTCTCCTGAGATCTGATGG + Intronic
1003212904 6:4082982-4083004 CTACACCTCCAGCCATCTCATGG + Intronic
1003939144 6:11006879-11006901 ATAAAGGTCCTGACTTCTGAAGG + Intronic
1004249500 6:14012023-14012045 ATAAATCTCATGAGATCTCATGG - Intergenic
1004450642 6:15742238-15742260 ATAAATCTCATGAGATCTTATGG - Intergenic
1004592941 6:17070860-17070882 ATAAGCCTCATGAGATCTGATGG + Intergenic
1005982808 6:30850364-30850386 ATAAGTCTCATGAGATCTCATGG + Intergenic
1006687123 6:35844712-35844734 ATAAACCTCGGAACAACTCAGGG - Intronic
1009559330 6:65219861-65219883 ATAAGCCTCATGAGATCTGATGG - Intronic
1010021696 6:71167750-71167772 ATAAGTCTCATGACATCTGATGG + Intergenic
1010730638 6:79387111-79387133 ATAAGCCTCATGAGATCTGATGG - Intergenic
1010735985 6:79444145-79444167 ATAAGCCTCATGAGATCTGATGG - Intergenic
1010883069 6:81202751-81202773 ATAAGCCTCATGAGATCTTATGG + Intergenic
1010934487 6:81845340-81845362 ATACACATCCAGACATGTCAGGG - Intergenic
1011108184 6:83806090-83806112 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1011343636 6:86345884-86345906 ATAAGCCTCATGAGATCTGATGG - Intergenic
1011382661 6:86759725-86759747 ATAAATCTCATGAGATCTGATGG - Intergenic
1011834058 6:91408413-91408435 ATAAGCCTCATGAGATCTGATGG + Intergenic
1012070348 6:94605743-94605765 ATAAGTCTCATGAGATCTCATGG - Intergenic
1012298127 6:97549986-97550008 ATAAATCTCATGAGATCTGATGG - Intergenic
1013477868 6:110526030-110526052 ATAAGTCTCATGAGATCTCATGG + Intergenic
1014085536 6:117338660-117338682 AAACATCTCCTGACATTTCAAGG - Intronic
1014147505 6:118015034-118015056 ATAAGTCTCATGACATCTCATGG + Intronic
1014305182 6:119732345-119732367 ATAAATCTCATGAGATCTGATGG + Intergenic
1014346058 6:120270807-120270829 ATAAGTCTCATGACATCTGATGG + Intergenic
1014611540 6:123553746-123553768 ATAAGTCTCCTGAGATCTGATGG - Intronic
1016126612 6:140411663-140411685 ATAAGTCTCATGAGATCTCATGG + Intergenic
1016134684 6:140525076-140525098 ATAAATCTCATGATATCTGATGG + Intergenic
1016151297 6:140745769-140745791 ATAAATCTCATGAGATCTGATGG + Intergenic
1016304197 6:142666289-142666311 ATAAGTCTCATGACATCTGACGG - Intergenic
1017507738 6:155083918-155083940 ATAAACCTCCTGGCATTTTTTGG + Intronic
1017532350 6:155308022-155308044 TTAGATTTCCTGACATCTCAGGG - Intronic
1018194326 6:161341782-161341804 TTACACCTGCTGAAATCTCACGG - Intergenic
1018577824 6:165278016-165278038 ATAACCCTCCTCAGATCTCTTGG + Intergenic
1019940988 7:4290933-4290955 ATAAGTCTCATGACATCTGATGG + Intergenic
1019941469 7:4295354-4295376 ATAAATCTCATGAGATCTGATGG - Intergenic
1020937947 7:14491254-14491276 ATAAATCTCATGAGATCTGATGG + Intronic
1021136796 7:16974772-16974794 ATAAATCTCATGAGATCTGATGG - Intergenic
1021624548 7:22579892-22579914 ATAAATCTCATGAGATCTGATGG - Intronic
1021854409 7:24839624-24839646 AAAAACCCCCTGATATCTCAGGG + Intronic
1022349429 7:29553741-29553763 ATAAGCCTCATGAGATCTGATGG - Intergenic
1023570109 7:41562989-41563011 ATAAATCTCATGAGATCTGATGG - Intergenic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1024183073 7:46917098-46917120 ATAACCCTCCTGACACTTGAAGG + Intergenic
1024431723 7:49295928-49295950 ATAAATCTCATGAGATCTGATGG + Intergenic
1025058508 7:55784664-55784686 ATAAGTCTCATGACATCTGATGG - Intergenic
1025285640 7:57658549-57658571 ATAAGCCTCGTGAGATCTGATGG + Intergenic
1026220253 7:68390110-68390132 ATAAATCTCATGAGATCTGATGG - Intergenic
1026236732 7:68533779-68533801 ATAAGTCTCCTGAGATCTGATGG + Intergenic
1026530016 7:71189170-71189192 ATAAATCTCATGAGATCTGATGG + Intronic
1026537647 7:71253343-71253365 ATAAGCCTCATGAGATCTGATGG - Intronic
1026573681 7:71554280-71554302 ATAAATCTCGTGAGATCTGATGG + Intronic
1027835713 7:83238914-83238936 ATAAGCCTCATGAGATCTGATGG - Intergenic
1028264024 7:88701071-88701093 CTAATCCTCATGACAACTCAGGG + Intergenic
1028318247 7:89431166-89431188 ATAAATCTCATGAGATCTGATGG - Intergenic
1029613129 7:101638207-101638229 ATAAATCTCATGAGATCTGATGG + Intergenic
1030805263 7:113910099-113910121 ATAAATCTCGTGAGATCTGATGG - Intronic
1031521790 7:122776226-122776248 ATAAATCTCATGAGATCTGATGG + Intronic
1031956447 7:127947345-127947367 ATAAAGCTCCTGGCATATCTAGG - Intronic
1032682328 7:134197680-134197702 AAAAATCTCCTGACATCTACAGG - Intronic
1033426478 7:141249235-141249257 ATAAGTCTCCTGAGATCTGATGG + Intronic
1033626275 7:143112725-143112747 ATATACCTCCTGAAAGCTTAAGG - Intergenic
1033884763 7:145931880-145931902 ATAAGCCTCATGAGATCTGATGG + Intergenic
1034044787 7:147916305-147916327 AGAATCCTCCTGTCACCTCATGG + Intronic
1034115407 7:148579509-148579531 ATAAGCCTCATGAGATCTGATGG - Intergenic
1035884385 8:3276492-3276514 ATAAGACTCATGAGATCTCATGG - Intronic
1037244979 8:16823143-16823165 ATAAATCTCATGAGATCTCATGG - Intergenic
1037294406 8:17385429-17385451 ATACGCCTCATGACATCTGATGG + Intronic
1037310186 8:17547300-17547322 ATACACCTCATGAGATCTGATGG - Intronic
1037784484 8:21894532-21894554 AGAAGCCTCCTGGCATTTCATGG + Intergenic
1037984720 8:23282662-23282684 ATAAGTCTCCTGAGATCTGATGG + Intronic
1038713328 8:29969679-29969701 ATAAGTCTCATGAGATCTCATGG + Intergenic
1039642863 8:39242566-39242588 ATAAATCTCATGAGATCTGATGG - Intronic
1039657137 8:39422598-39422620 ATAAGTCTCCTGAGATCTGATGG - Intergenic
1041873296 8:62659830-62659852 ATAAGTCTCATGACATCTGATGG + Intronic
1041978360 8:63825818-63825840 ATAAACCTCTTAATATCTCTGGG + Intergenic
1042030486 8:64470619-64470641 ATAAATCTCATGAGATCTGATGG + Intergenic
1042130322 8:65581628-65581650 ATAAGTCTCATGACATCTGATGG - Intergenic
1042372604 8:68008742-68008764 ATAAATCTCATGAGATCTGATGG + Intronic
1042632348 8:70832000-70832022 ATAAACCTAATTCCATCTCAGGG + Intergenic
1043302989 8:78757919-78757941 ATAAGTCTCATGAGATCTCATGG + Intronic
1044962549 8:97544981-97545003 AGAAACCTACTGATCTCTCAAGG - Intergenic
1045629593 8:104102741-104102763 ATAAATCTCATGAGATCTGATGG - Intronic
1045667673 8:104507389-104507411 CTTAACCTCATGAAATCTCAAGG + Intronic
1046606177 8:116374481-116374503 ATAAATCTCATGAGATCTGATGG - Intergenic
1046689172 8:117263447-117263469 ATAAGCCTCATGAGATCTGATGG + Intergenic
1046928855 8:119823428-119823450 ATAAATCTCATGAAATCTGATGG + Intronic
1047240338 8:123081788-123081810 ATAAATCTCATGAGATCTGATGG - Intronic
1048313832 8:133347585-133347607 ATAAATCTCATGAGATCTCATGG + Intergenic
1050156819 9:2676136-2676158 ATAAATCTCACGACATCTGATGG + Intergenic
1051979644 9:22998355-22998377 ATAAATCTCATGACATCTGATGG - Intergenic
1052146119 9:25051603-25051625 ATAAGCCTCATGACATCTGATGG - Intergenic
1052362943 9:27579312-27579334 TTAATCCTCCTGACATCTCTAGG + Intergenic
1052526969 9:29630432-29630454 ATAAATCTCATGAGATCTGATGG + Intergenic
1052782422 9:32795164-32795186 ATAAATCTCATGAGATCTGATGG - Intergenic
1053537054 9:38936500-38936522 ATAAACCTACTGACAAGTCGTGG + Intergenic
1054629083 9:67427430-67427452 ATAAACCTACTGACAAGTCGTGG - Intergenic
1055080973 9:72267246-72267268 ATAACTCTCCTGAGATCTGATGG - Intergenic
1055735085 9:79319175-79319197 ATAAATCTCATGAGATCTGATGG + Intergenic
1056999479 9:91494236-91494258 ATAAACCTCATGAAATCTGATGG - Intergenic
1058193575 9:101947496-101947518 ATAAGCCTCATGACAACTGATGG + Intergenic
1058600283 9:106661692-106661714 ATAGTCCTCATGATATCTCATGG + Intergenic
1059519045 9:114922672-114922694 AAAAATCTCCTGAAATTTCATGG + Intronic
1059731705 9:117063415-117063437 ATAAATCTCATGAGATCTGATGG + Intronic
1059988831 9:119845350-119845372 ATAAATCTCCTGACTTCTGCAGG - Intergenic
1061696499 9:132379514-132379536 ATAATCCTCACGACAACTCAAGG + Intronic
1062299361 9:135856332-135856354 ATAAATCTCATGAGATCTGATGG - Intronic
1062740657 9:138173156-138173178 ATAAGCCTCATGAGATCTGATGG - Intergenic
1203635734 Un_KI270750v1:108843-108865 ATAAATCTCATGAGATCTGATGG + Intergenic
1185552179 X:991957-991979 ATAAACCTCTTTAAATCTCTTGG - Intergenic
1185797602 X:2980343-2980365 ATAAATCTCGTGAGATCTGATGG + Intergenic
1185982635 X:4796502-4796524 ATAAGTCTCATGACATCTGATGG + Intergenic
1186991865 X:15078416-15078438 ATAAATCTCATGAGATCTGATGG + Intergenic
1187260865 X:17684034-17684056 ATAAATCTCGTGAGATCTGATGG + Intronic
1187619268 X:21031819-21031841 ATAAATCTCATGAGATCTGATGG - Intergenic
1187626211 X:21117038-21117060 ATAAGTCTCATGACATCTGATGG - Intergenic
1187675647 X:21713595-21713617 ATAAGTCTCATGAGATCTCATGG - Intronic
1187814433 X:23215554-23215576 CTAAACCTACTTACTTCTCAAGG - Intergenic
1189028976 X:37429942-37429964 ATAAATCTCATGAAATCTGATGG - Intronic
1190974669 X:55387501-55387523 ATAAGTCTCATGACATCTGATGG + Intergenic
1191188466 X:57639162-57639184 ATAAGACTCATGACATCTCATGG + Intergenic
1191598331 X:62973475-62973497 ATAAATCTCATGAGATCTGATGG - Intergenic
1192508310 X:71704766-71704788 ATAAGTCTCATGAGATCTCATGG + Intergenic
1192518386 X:71776787-71776809 ATAAGTCTCATGAGATCTCATGG - Intergenic
1193014425 X:76716296-76716318 ATAAATCTCATGAGATCTGATGG + Intergenic
1193116397 X:77779649-77779671 ATAAAATTCCTGCCATCTTAAGG - Intronic
1194479758 X:94406324-94406346 ATAAGCCTCATGAGATCTGATGG + Intergenic
1194542503 X:95191405-95191427 ATAAGTCTCATGAGATCTCATGG - Intergenic
1195762359 X:108260498-108260520 ATAAGCCTCACGACATCTGATGG + Intronic
1197387754 X:125821774-125821796 CTAAACCTCCTGACCTGTGATGG + Intergenic
1197483370 X:127014934-127014956 ATAAGTCTCATGAGATCTCATGG + Intergenic
1197676507 X:129336160-129336182 ATAAACCCCATGAGATCTGATGG - Intergenic
1198393623 X:136201524-136201546 ACCCACCTCCTGAGATCTCATGG + Intronic
1199580630 X:149356869-149356891 ATAAGTCTCATGAGATCTCATGG + Intergenic
1199656058 X:149996539-149996561 ATAAAAATCGTGACATCACAGGG + Intergenic
1201023709 Y:9685134-9685156 ACAAACCCTGTGACATCTCAGGG + Intergenic
1201482783 Y:14457948-14457970 ATAAGCCTCATGAGATCTGATGG + Intergenic
1201525588 Y:14929966-14929988 ATAAATCTCATGAGATCTGATGG + Intergenic
1201617557 Y:15918517-15918539 ATAAATCTCATGATATCTGATGG - Intergenic
1201759421 Y:17520874-17520896 ATAAGCCTCATGAGATCTAATGG + Intergenic
1201842133 Y:18385116-18385138 ATAAGCCTCATGAGATCTAATGG - Intergenic
1201927922 Y:19310433-19310455 ATAAGTCTCATGACATCTGATGG - Intergenic