ID: 997558072

View in Genome Browser
Species Human (GRCh38)
Location 5:134818949-134818971
Sequence CCCTCCTGGCAAAGAACCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997558068_997558072 5 Left 997558068 5:134818921-134818943 CCGCAATTACAATCAGAGGAACC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997558072 Original CRISPR CCCTCCTGGCAAAGAACCCA AGG Exonic
900285238 1:1895861-1895883 CCCTCCTGGCCACCAACCCGTGG + Intergenic
900753793 1:4418942-4418964 CTGTCCTGGTAGAGAACCCAAGG - Intergenic
903783079 1:25835075-25835097 TCCTCCTGGCACTGAGCCCAAGG + Exonic
907301246 1:53487609-53487631 CCATCCTGGCAGAGAAGACACGG - Intergenic
908441535 1:64159881-64159903 AGGTCCTGGCAAGGAACCCAGGG + Intronic
912139292 1:106702182-106702204 CCCTCCTGGCTCAGAACATAAGG - Intergenic
912145906 1:106794295-106794317 CCAACCTGGGAAAGAACCCCTGG - Intergenic
912413323 1:109492309-109492331 CCCTCCTGGCAGAGATCATATGG - Intronic
916485521 1:165254975-165254997 ACCTCCTGGAAAAGCATCCATGG + Intronic
916496983 1:165355649-165355671 CACTCCTGGGAAAGAACTGAGGG + Intronic
916627143 1:166570510-166570532 CCCTCCTTCCAAAGAACTCTTGG - Intergenic
919773373 1:201177212-201177234 ATCTCCTGGCAAAACACCCAGGG + Intergenic
920035888 1:203065230-203065252 GCCTCCTGGCTTAGAACCCTTGG + Intronic
921217494 1:212950433-212950455 CCCTCCCGCCAGAGAACCCCTGG + Intergenic
922338805 1:224639126-224639148 CCCTCCCAGCAAGGACCCCAGGG + Intronic
922574799 1:226654563-226654585 CCCACCTGCCACAGAACCCTGGG - Intronic
922675394 1:227546273-227546295 CCCACCTGGCAGAGGTCCCATGG + Intergenic
922912767 1:229231498-229231520 ACGTCCTGGCCAAGATCCCAGGG - Intergenic
1063090476 10:2861965-2861987 CCCTCTCAACAAAGAACCCATGG + Intergenic
1064050686 10:12056897-12056919 CCCACATGGCAAAGAACTGAGGG + Intergenic
1069843199 10:71352841-71352863 GCCTCCTGGCAAAGCACCAATGG - Intronic
1071499523 10:86193538-86193560 CCTTCCTGCCATAGTACCCAGGG + Intronic
1073046571 10:100642581-100642603 TACTCTGGGCAAAGAACCCAAGG + Intergenic
1075121575 10:119668518-119668540 CCCTCCTGGGAAAGGACCCTCGG + Intronic
1076704785 10:132295261-132295283 TCCTCCTAACAAAGAAACCAGGG + Intronic
1076738575 10:132469436-132469458 CCCTCCTGGGACAGGCCCCAGGG - Intergenic
1078103646 11:8344960-8344982 CCTGCCTGGCAAAGACCCCAAGG + Intergenic
1078349531 11:10581240-10581262 TCCCACTGGCACAGAACCCATGG - Intronic
1080174232 11:29342891-29342913 CCAGCCTGGCAAAGAGTCCAGGG - Intergenic
1081613445 11:44577083-44577105 CGCTGTTGGCCAAGAACCCATGG + Intronic
1081766056 11:45610810-45610832 CCCACATGGCAAAGAACCAAAGG + Intergenic
1084311908 11:68321946-68321968 CCTTCCTGGGGCAGAACCCAAGG - Intronic
1084622782 11:70284805-70284827 CCCTCCAGGCCAAGTAACCATGG - Intronic
1085026705 11:73240541-73240563 CCCTCCTGGCAGGGACCCCAGGG + Intergenic
1085099599 11:73789345-73789367 AACTCCTGGAAAAGAGCCCATGG + Intronic
1085818592 11:79768523-79768545 CTCACCTGGCACAGAGCCCAGGG - Intergenic
1089171406 11:116514107-116514129 CTCTCCTGGAATACAACCCATGG + Intergenic
1089214363 11:116826957-116826979 CCCTCCTGGCCAACCACACAGGG + Intergenic
1089214510 11:116827597-116827619 CCCGCATGGCAACGGACCCAGGG - Intergenic
1089590519 11:119537452-119537474 CTCTCTTGTCAAAGAAGCCAGGG - Intergenic
1091344922 11:134846085-134846107 CCCGACTGGCCCAGAACCCAAGG + Intergenic
1094641604 12:32281339-32281361 AGCTACTGGCAAAGAACGCAAGG - Intronic
1096722504 12:53533760-53533782 CACTCCTGGCACGGTACCCATGG - Intronic
1097990352 12:65825943-65825965 CCCTCCCGACAAAGAACGCATGG + Intronic
1102600415 12:114025494-114025516 CCCACATGGCAAAGAACTAAGGG + Intergenic
1103059416 12:117846916-117846938 CCCTCCTGGCAACTGACACAGGG + Intronic
1104411889 12:128565136-128565158 CCCGCCTGGCAGAGAACTGAAGG + Intronic
1104573932 12:129949441-129949463 CCATCCTGGGAAAGGTCCCAGGG + Intergenic
1105892408 13:24690934-24690956 CCCTCCTGGCTGAGGACCCCTGG + Intronic
1107031839 13:35861468-35861490 CCAGCCTGGGAAAGGACCCACGG + Intronic
1107882388 13:44843913-44843935 CCCTCCAGGCAAAGACCACCAGG - Intergenic
1113941723 13:114021882-114021904 CCCTCCTGGCACAGAGCCTGGGG - Intronic
1118713780 14:68544864-68544886 CCATCCTGCCAAAGAAGGCAGGG + Intronic
1119769125 14:77209515-77209537 CCCTACTATCAAAGAGCCCATGG + Intronic
1121845397 14:97168212-97168234 ACCTCCCGGCAAAAAGCCCAAGG + Intergenic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1123025231 14:105420820-105420842 CCTTCCTGTGAAAGACCCCACGG - Intronic
1125202127 15:37109524-37109546 CCCTCCTGCCACACACCCCAAGG + Intergenic
1126851261 15:52798548-52798570 CGGGCCTGGTAAAGAACCCACGG - Intergenic
1128943463 15:71806738-71806760 CTGACCTGCCAAAGAACCCAGGG + Intronic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1132053918 15:98634861-98634883 CCCTACAGGCAGAGCACCCAAGG - Intergenic
1132743861 16:1428748-1428770 CCCTCGTGGCTCAGAACCCCGGG - Intergenic
1133437367 16:5791455-5791477 CCCTCCTGGCCAAGATCCCAGGG - Intergenic
1134318933 16:13145077-13145099 GCCACCTGGCAAGGAACACATGG - Intronic
1135984361 16:27173132-27173154 ACATCCTAGCACAGAACCCAGGG + Intergenic
1136459101 16:30398807-30398829 CCCACCTGGCCCAGTACCCATGG + Exonic
1136480597 16:30539305-30539327 CCCTCCTGGGAAAGAACCAGGGG + Intronic
1137514057 16:49127243-49127265 CCCTCATGGCAAGGACTCCATGG + Intergenic
1139806151 16:69566489-69566511 CGCTCCGGCCAAAGAAGCCATGG - Intronic
1140746881 16:77988510-77988532 CACTGCTGGCAAAAAGCCCATGG + Intergenic
1141359675 16:83383820-83383842 CCCTCCATGAAAAGAAACCAAGG - Intronic
1143675145 17:8426998-8427020 CCTTCCTGGCAAGGGAGCCAAGG + Intronic
1144310989 17:14014205-14014227 CCCACCTGGCAAAAAACCAAGGG + Intergenic
1144648036 17:16988563-16988585 TCCTCCTGGCAACTCACCCAAGG - Intergenic
1148554151 17:48567864-48567886 CCCTCCTGGCTAACAAAACAAGG - Intronic
1150807450 17:68330380-68330402 CCATCATGTCAAACAACCCAAGG - Intronic
1152476285 17:80520535-80520557 CCTCCATGGCAAGGAACCCAGGG - Intergenic
1153248697 18:3098625-3098647 CATTCCTGGAAAAGAAACCAAGG + Intronic
1154492635 18:14933409-14933431 CCCACCTGGCCCAGAACCCAAGG - Intergenic
1156184317 18:34643234-34643256 CCACCATGGCTAAGAACCCATGG - Intronic
1156288391 18:35722073-35722095 GACTGCTGGCAAAAAACCCAAGG + Intergenic
1156485103 18:37460365-37460387 ACCTCCTGGAAAAGAAACAAGGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160278141 18:77459012-77459034 GTCACCTGGCAGAGAACCCAGGG + Intergenic
1161358374 19:3832238-3832260 CACACCTGGCAGAGATCCCAGGG + Intronic
1162943836 19:14030832-14030854 CCCAGCTGGCAAGGAACCCCTGG + Exonic
1163132619 19:15285063-15285085 CCCTTGTGGCACAGCACCCAGGG - Intronic
1166998769 19:46732725-46732747 CCCTGCTGGCGAGGCACCCAGGG + Intronic
929303973 2:40338502-40338524 CCCTCCTGGCCCACAAACCATGG + Intronic
929446108 2:42002688-42002710 ACCACATGGCAAAGAACCAAGGG + Intergenic
929453909 2:42053385-42053407 CCATCCTAGCAAGGAGCCCAGGG - Intronic
929929442 2:46240827-46240849 CCCTCATGACACAGAACACAGGG - Intergenic
930410998 2:51027191-51027213 CCAACCTGCCAAAGAACCCGAGG + Intronic
933514742 2:83286313-83286335 CCCTCCTAGCAAAGGCCCCTTGG - Intergenic
934052712 2:88223749-88223771 CCCTCCTTCCAGAGAACCCTGGG - Intergenic
936059304 2:109283976-109283998 CTCTCCTGGAAAAACACCCACGG - Intronic
937967182 2:127522209-127522231 CATCCCTGGCAAAGACCCCAAGG - Intronic
938243268 2:129759165-129759187 CCATCCTTGCAGGGAACCCAGGG - Intergenic
942194817 2:173507028-173507050 CCCTCCCTGCCAATAACCCAGGG - Intergenic
942859768 2:180595617-180595639 CTCACCTGGCAAAGAACTGATGG - Intergenic
943819124 2:192297352-192297374 CTTTCCTGTGAAAGAACCCAGGG + Intergenic
946570316 2:221017397-221017419 CCCACATGGCAAAGAACGGAGGG - Intergenic
947445128 2:230157356-230157378 CCCTCCTGTTAAAGAAACCCAGG - Intergenic
948856729 2:240733709-240733731 CGCTCCTGGCACAGAGCCCCAGG - Intronic
948982918 2:241503988-241504010 CCCTCCTGGTTAGGAACCCTGGG - Intronic
1169019904 20:2321977-2321999 TGCTCCTGGCAGAGCACCCAAGG - Intronic
1170146534 20:13181192-13181214 CCCTGGTGGCAAAGAGGCCAAGG - Intergenic
1172523338 20:35583085-35583107 AACTCCTGGCCAGGAACCCAGGG + Intergenic
1172971458 20:38875858-38875880 CCTTCCTGGCCACGATCCCAGGG + Intronic
1173744235 20:45424364-45424386 CCCACCTGACATAGAAGCCATGG - Exonic
1174002388 20:47384333-47384355 CCATCCTAGGAAAGAACTCAGGG + Intergenic
1175888110 20:62303478-62303500 CCCTGCTCGCAAACACCCCAGGG + Intronic
1175903818 20:62370294-62370316 CCCTCCTGTCCCAGAGCCCAGGG + Intergenic
1176108162 20:63399188-63399210 CCCTCCAGGGACAGACCCCACGG - Intergenic
1176267680 20:64219174-64219196 CCCTCCTGGCCATGGCCCCAAGG + Intronic
1179152709 21:38822388-38822410 CCCTCCTGGCTCTGAACCCTTGG + Intronic
1179547536 21:42122835-42122857 CTCTCCTGGCAATGAAACCTGGG + Exonic
1179640703 21:42745682-42745704 CCCTCCTGCCAAAGCAGCCATGG - Intronic
1181809645 22:25395611-25395633 CCTTCCTGGGGCAGAACCCAAGG + Intronic
1183080042 22:35450441-35450463 CCCTCCTGGGACAGACTCCAGGG + Intergenic
1183366516 22:37409844-37409866 CCCTCCTGGGTAAGAACAGATGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183748382 22:39705271-39705293 CCTGCCTGGCAAAGGACCTATGG + Intergenic
1184121455 22:42453109-42453131 GCCCCGTGGCAAAGAACCAAAGG + Intergenic
1184308728 22:43627458-43627480 CACTCCTCACAAACAACCCAAGG - Intronic
1184691675 22:46120095-46120117 CCCTCGTGGCAAAGGACACTGGG - Intergenic
949624110 3:5848739-5848761 CCCTCCTGGAAATGTTCCCAAGG - Intergenic
951397394 3:22185798-22185820 CCCACCTGGAAAAGCACCCTGGG + Intronic
951651583 3:24956851-24956873 CCTTACAGGCATAGAACCCAAGG - Intergenic
952889641 3:38031375-38031397 CCATCCTGCCCAAGAACCCTGGG - Intergenic
953872427 3:46638876-46638898 ACACCCTGGCAAAGATCCCATGG - Intergenic
953923074 3:46965613-46965635 CCCTCCTTGCAAAGCTCCAAGGG + Intronic
954160309 3:48716965-48716987 CCCTCCTCCCAAATGACCCAGGG + Intronic
955927230 3:64019437-64019459 CCCTCCTGTCAAGAAAGCCAAGG + Exonic
956939046 3:74136028-74136050 CCCTCCTGGCTAGGTAACCAAGG + Intergenic
959017394 3:101150725-101150747 CCCTCCTGGCAGCCAACACAGGG - Intergenic
959229422 3:103629612-103629634 CTCTCCTGTCAAAGAGCCCAAGG + Intergenic
959257307 3:104031483-104031505 CCTTCCTGGTAAAGAAGCCGTGG - Intergenic
960054748 3:113269130-113269152 ACCTCCTGCCAAGGAACCCTGGG - Intronic
961133617 3:124490916-124490938 CCCTGCTTTCATAGAACCCATGG + Intronic
961813042 3:129532706-129532728 CGCTCTTGGCAAAGAACGCTGGG - Exonic
962171282 3:133104054-133104076 CACTCCTTGCAAAGAATTCAAGG + Intronic
965071917 3:163925199-163925221 ACCTCCAGGCAAAGAAGGCAAGG + Intergenic
966988876 3:185208178-185208200 CCCACGTGGCAAAGAACTGAGGG + Intronic
969871772 4:10109160-10109182 CCCACATGACAAAGAAACCAAGG + Intronic
975182733 4:71365520-71365542 CCCTCCTTTAAATGAACCCATGG - Intronic
975347532 4:73310246-73310268 CCCACCTGGCAAGGAAGCAAGGG - Intergenic
978982417 4:114964157-114964179 CCCACATGGCAAGGAACACAGGG + Intronic
981757336 4:148154761-148154783 CGCTCCTGCAAAAGAACCCTCGG - Exonic
982393575 4:154892007-154892029 CCCTGGTGGCAAGGCACCCAAGG - Intergenic
985277460 4:188251776-188251798 CCCACATGGCAAGGAACCGAGGG + Intergenic
986242387 5:5972789-5972811 CCCTCTTGCCAAGGAACCCCTGG + Intergenic
990516898 5:56538841-56538863 CCCTCCTGGCAGAAAAACAATGG + Intronic
994134221 5:96266329-96266351 TTCTCCTGGCATGGAACCCAAGG - Intergenic
994633287 5:102312743-102312765 CCCACATGGCAAAGAACCAAAGG + Intergenic
995653871 5:114402684-114402706 CCCTCGAGGAAAACAACCCATGG + Intronic
996252728 5:121356841-121356863 CCCACATGGCAAAGAACTGAGGG + Intergenic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
997851483 5:137336791-137336813 GCCTCCAGGCAGAGAGCCCAGGG - Intronic
999985904 5:157005144-157005166 CCCCCATGGCAAGGAACTCAGGG - Intergenic
1002864089 6:1105988-1106010 CTCTGCAGGCAAAGACCCCATGG - Intergenic
1002932483 6:1644082-1644104 CTCTTCTGGCAAGGAACCCCCGG + Intronic
1003325952 6:5090933-5090955 CACTCCTGATAAAGAACACATGG - Intergenic
1004148149 6:13089280-13089302 CCATCTGGGCAGAGAACCCAGGG + Intronic
1004682738 6:17912343-17912365 CCCTTCTGGGAAAGAAACCCAGG + Intronic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1006992534 6:38227752-38227774 CTCTCCTTGCCAAGAACTCAGGG + Intronic
1007071493 6:39041493-39041515 CTCTCCTGGCCCAGAAGCCACGG + Intergenic
1014256097 6:119161220-119161242 CCTTCCCACCAAAGAACCCATGG + Intergenic
1015439705 6:133233690-133233712 CCTTCCTGCCAGAGAGCCCAGGG - Intergenic
1016897731 6:149070046-149070068 CCAACCTGGCAAAGGATCCAAGG - Intronic
1019488590 7:1300725-1300747 CCCTCCTGAAAAAAAACACAGGG + Intergenic
1020188128 7:5974220-5974242 CCTTCCTGTCAGAGGACCCATGG - Intronic
1020294790 7:6750549-6750571 CCTTCCTGTCAGAGGACCCATGG + Intergenic
1022407845 7:30108801-30108823 CCCTCCTGCCAAAGGAACAAAGG - Intronic
1024094577 7:45973771-45973793 CCCACCTGGCCAACAACCTAAGG - Intergenic
1028117245 7:87012780-87012802 ACCTTCTGCCAAAGGACCCATGG - Intronic
1032455069 7:132067014-132067036 CGTTACTGGCAAAGAGCCCAGGG + Intergenic
1034443399 7:151099579-151099601 CCCACCTGGCACAGGACCCAAGG - Intronic
1034670254 7:152852310-152852332 CCCTCCTGACACAGAGCCGAAGG + Intronic
1040610074 8:48975540-48975562 CCCTTGAGGTAAAGAACCCAGGG - Intergenic
1041653247 8:60322149-60322171 TCATCCTGGCAAATTACCCAGGG - Intergenic
1044735611 8:95275183-95275205 GCCTCTTGGGAAGGAACCCAAGG + Intergenic
1045908427 8:107376354-107376376 CTCTCCTGGAAAAGAACTCAGGG - Intronic
1047449766 8:124954517-124954539 CTGTCTTAGCAAAGAACCCAAGG - Intergenic
1047696348 8:127407120-127407142 CATTCATGGCACAGAACCCAGGG - Intergenic
1048544680 8:135375809-135375831 CCCTCCTGGTAAAAGAACCAGGG - Intergenic
1049060753 8:140274340-140274362 CCCTCCTGAGCAAGAACACAAGG + Intronic
1049208733 8:141375575-141375597 CCCTCCTGGATCAGCACCCATGG - Intergenic
1055786263 9:79872291-79872313 CTCTCATGGCAAAGAATGCAAGG - Intergenic
1058948041 9:109877107-109877129 CCCTTCTGGAAAAGCAGCCATGG - Intronic
1062496697 9:136835270-136835292 CCCTCCTGGCCTGGAACCCCAGG - Intronic
1186392042 X:9170470-9170492 CTCTGCTGCCAAACAACCCATGG + Intergenic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1189167322 X:38873049-38873071 TTGACCTGGCAAAGAACCCAGGG - Intergenic
1190391456 X:49935745-49935767 CCATGCTGGGAAAGGACCCAGGG - Intronic
1190642858 X:52496544-52496566 GGCTCCTGGCAAAAAACACAGGG - Intronic
1190644815 X:52516323-52516345 GGCTCCTGGCAAAAAACACAGGG + Intronic
1190908977 X:54754982-54755004 CTCTCCTGACAAAGATCCCCTGG - Intronic
1192177926 X:68897491-68897513 CCCTCCTGGCTGAGAAGCCTGGG + Intergenic
1193885563 X:86981593-86981615 CCCTCCTGTCAAAGGCCCAAAGG - Intergenic
1195830012 X:109046529-109046551 AACTCCTGTCAAAGAACCCTGGG - Intergenic
1196513870 X:116546710-116546732 CACTCCTCCCAAAGATCCCATGG - Intergenic
1197633610 X:128890178-128890200 TCCTCCAGCCAAAGAACCCTAGG - Intergenic
1198568463 X:137930423-137930445 CCCTCCTGCCAGAGAAAACAGGG - Intergenic
1201304350 Y:12537755-12537777 CACTCCTGGAAAAGAACGCAGGG - Intergenic