ID: 997570133

View in Genome Browser
Species Human (GRCh38)
Location 5:134921043-134921065
Sequence CAGGTGGGTGGAGCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 493}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997570127_997570133 -4 Left 997570127 5:134921024-134921046 CCTGTCGGTGGACATGCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493
997570120_997570133 17 Left 997570120 5:134921003-134921025 CCCTGTCCTCGCCATCGCAGCCC 0: 1
1: 0
2: 0
3: 12
4: 181
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493
997570126_997570133 -3 Left 997570126 5:134921023-134921045 CCCTGTCGGTGGACATGCACCAG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493
997570125_997570133 6 Left 997570125 5:134921014-134921036 CCATCGCAGCCCTGTCGGTGGAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493
997570122_997570133 11 Left 997570122 5:134921009-134921031 CCTCGCCATCGCAGCCCTGTCGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493
997570121_997570133 16 Left 997570121 5:134921004-134921026 CCTGTCCTCGCCATCGCAGCCCT 0: 1
1: 0
2: 1
3: 10
4: 150
Right 997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG 0: 1
1: 0
2: 6
3: 62
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997570133 Original CRISPR CAGGTGGGTGGAGCAGCCCC AGG Intronic
900096939 1:943645-943667 CTGGAGGATGGAGCAGCACCCGG + Intronic
900148663 1:1168922-1168944 GAGGTGGCAGGAGCCGCCCCCGG + Intergenic
900150986 1:1179331-1179353 CAGGTGAATAGAGCAGCCCTGGG + Exonic
900285765 1:1899620-1899642 CACGGGGGTGGAGCAGGCTCAGG + Intergenic
900740574 1:4328511-4328533 CTAGTGAGAGGAGCAGCCCCGGG + Intergenic
901211214 1:7527056-7527078 CAGGGGAGAGGAGCAGCCGCTGG - Intronic
901223933 1:7601105-7601127 GAGGTGGGGGGGTCAGCCCCCGG - Intronic
901627393 1:10631858-10631880 CAGGTGAGGGTGGCAGCCCCTGG - Intergenic
901633986 1:10661170-10661192 CAGGTGTGTGGATGTGCCCCTGG + Intronic
901745861 1:11373075-11373097 CAGATGTGAGTAGCAGCCCCAGG + Intergenic
901799835 1:11701658-11701680 CGGCTGGGAGGAGCAGACCCTGG + Intronic
902638384 1:17750350-17750372 CTGGGGTGGGGAGCAGCCCCAGG + Intergenic
902650295 1:17832921-17832943 CAGGTGGGGGTTGCAGTCCCAGG - Intergenic
902673777 1:17994210-17994232 CAGGTGGCAGGAGCAGCCGTGGG + Intergenic
903742022 1:25563847-25563869 CTGGTCCCTGGAGCAGCCCCAGG - Intronic
904248685 1:29206728-29206750 CAGGTTGGGGGAGCAGGCCAGGG - Intronic
904287374 1:29461155-29461177 GAGGAGGGTGGAGCAGGGCCAGG + Intergenic
904370634 1:30045524-30045546 GAGGAGGGTGGAGCAGGGCCAGG + Intergenic
904559797 1:31388749-31388771 CAAGAGGGTGGAGGAGACCCTGG - Intergenic
905449076 1:38045754-38045776 CAGGTTGGTGGGGCTGCCGCTGG + Exonic
905530842 1:38677521-38677543 CTGGTGGGTGGAGAAGCACCCGG - Intergenic
905974049 1:42162775-42162797 CAGTCGGGAGGAGCAGCCCGGGG - Exonic
906692228 1:47800077-47800099 CAACTGGCTGGAGCAGCCCCTGG - Intronic
907070244 1:51527979-51528001 CAGGTGTGTGCCACAGCCCCTGG - Intergenic
907253660 1:53161262-53161284 CAGGTGGCTGGGGGAGCACCAGG - Intergenic
907290178 1:53408544-53408566 CAGGTGGGTAGTGCAGGCCAGGG - Intergenic
907319273 1:53592625-53592647 CTGGTGGCTGGGCCAGCCCCTGG - Intronic
908487595 1:64610626-64610648 CACATGGGCGGAGCTGCCCCAGG - Intronic
908532714 1:65049094-65049116 CAGGTGGTTACAGCTGCCCCTGG - Intergenic
912537672 1:110387749-110387771 TAGGGGGGTGGCCCAGCCCCAGG + Intronic
912696881 1:111848659-111848681 CTGCTGGGTGGGCCAGCCCCAGG - Intronic
913089660 1:115467969-115467991 GAGGTGGGTGGGGCTGCCCTGGG - Intergenic
913971841 1:143422493-143422515 CAGCTGGGCGGGGCAGCCACAGG - Intergenic
913993225 1:143634597-143634619 CAGGTGGGGGCCTCAGCCCCTGG + Intergenic
914066220 1:144248106-144248128 CAGCTGGGCGGGGCAGCCACAGG - Intergenic
914086070 1:144455623-144455645 CAGGTGGGGGCCTCAGCCCCTGG + Intronic
914112933 1:144718248-144718270 CAGCTGGGCGGGGCAGCCACAGG + Intergenic
914191962 1:145419574-145419596 CAGGTGGGGGCCTCAGCCCCTGG + Intergenic
914227548 1:145733704-145733726 CAGGTGGGTAGAACAGCCAGGGG - Intronic
914362123 1:146944452-146944474 CAGGTGGGGGCCTCAGCCCCTGG - Intronic
914489503 1:148142503-148142525 CAGGTGGGGGCCTCAGCCCCTGG + Intronic
914513010 1:148351343-148351365 CAGGTGGGGGCCTCAGCCCCAGG + Intergenic
914589869 1:149097524-149097546 CAGGTGGGGGCCTCAGCCCCTGG + Intronic
915095726 1:153460760-153460782 CAGGTGGGTGGGACACACCCAGG + Intergenic
915303771 1:154966359-154966381 GCAGTGGGTCGAGCAGCCCCTGG + Exonic
915349087 1:155213400-155213422 CAGATGGGAGGGGCAGCCCTGGG + Intronic
915352274 1:155234027-155234049 CAGATGGGAGGGGCAGCCCTGGG + Intergenic
916075563 1:161198254-161198276 CTGCTGGGTGGAGCAGAGCCTGG - Exonic
917848354 1:179040653-179040675 GAGGTGGGGGGATCAGCGCCCGG - Intronic
918332157 1:183471565-183471587 CAGGCGGGTGGAAAAGCCCATGG + Intergenic
919788842 1:201277138-201277160 CTGGTGTGTGGAGGAGCCCTAGG + Intergenic
919910109 1:202105999-202106021 CAGGGAGGTGGAGAAGCCGCAGG + Intergenic
920051248 1:203166307-203166329 GATGTTGGTGGTGCAGCCCCAGG + Exonic
920071173 1:203304397-203304419 CAGGGGGGTGGAGAAGCCTGGGG + Intergenic
922748573 1:228060413-228060435 CAGGTGGGTGGTCAAACCCCAGG - Exonic
923046226 1:230357465-230357487 CAGGTGGTTGCAGCAGCTTCTGG - Intronic
1064839377 10:19573387-19573409 CAGGTGGTGGCAGCAGCCCTGGG + Intronic
1065020945 10:21501135-21501157 CAGGTGAATCCAGCAGCCCCAGG + Intergenic
1065249542 10:23796694-23796716 CTGGAGGGTAGAGCAGCTCCAGG + Intronic
1065336352 10:24657243-24657265 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1065665833 10:28059271-28059293 CAGGTGTGTGAAGCAGACGCTGG + Intronic
1066314458 10:34230276-34230298 CTGCTGGGTGGACCAGGCCCTGG - Intronic
1066745565 10:38602511-38602533 GATGGTGGTGGAGCAGCCCCTGG + Intergenic
1067179650 10:43974825-43974847 CAGGAGGATGGAGCAGGCGCAGG + Intergenic
1067180239 10:43979816-43979838 GAGGGTGGAGGAGCAGCCCCTGG + Intergenic
1067325277 10:45260270-45260292 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1069749775 10:70737641-70737663 CAGGTGGATGGAGCTTCCCCTGG + Intronic
1069792103 10:71029486-71029508 CACGTGGGTCAAGCAGCCCCAGG + Intergenic
1069835918 10:71308091-71308113 CAGGAGGTTGGAGCAGTCCTGGG - Intergenic
1070264910 10:74892895-74892917 CATGTGGCTGGAGCTGCCCCTGG + Intronic
1070628471 10:78067815-78067837 CAGTTGTCTGGAGCAGCCCTGGG + Intergenic
1070698877 10:78584443-78584465 CAGGGAGGTGGACCAGCTCCTGG + Intergenic
1071416188 10:85444261-85444283 CAGGTGGGTGGAACAAGCCCAGG - Intergenic
1073101561 10:101009230-101009252 CAGGTGGGTGAAGCATGCCCTGG - Intronic
1073301110 10:102471394-102471416 CAGGTATGGGGAGCAGCTCCCGG + Exonic
1073535672 10:104274887-104274909 CAGGTGGTTTGCGCAGCTCCCGG - Exonic
1076193477 10:128499022-128499044 CAGGTGGGTGAAGGAGTCCCAGG + Intergenic
1076440722 10:130479535-130479557 CAGGTGGGTGCAGCCTCCCTGGG + Intergenic
1076739746 10:132477395-132477417 CAGGAAGGAGGAGCAGCCTCTGG - Intergenic
1076745994 10:132514876-132514898 CCGGAGGGTGCACCAGCCCCAGG - Intergenic
1076772874 10:132676669-132676691 CAGGAGGAGGGAGCAGCCACAGG - Intronic
1076802730 10:132838792-132838814 CCCGTGGGTGCAGCAGCCCCTGG - Intronic
1076802810 10:132839264-132839286 CAGGGGGGTGGCGCAGCCCCAGG + Intronic
1076881660 10:133242392-133242414 CAGGTGGGTGGAGTAGGGCTTGG - Intergenic
1076907943 10:133372778-133372800 CAGGTGGGGGGTGCAGCACTAGG + Intronic
1077014393 11:393385-393407 CAGGGGGGCGGGGCCGCCCCAGG - Intronic
1077067275 11:647817-647839 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067285 11:647852-647874 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067295 11:647887-647909 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067305 11:647922-647944 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067315 11:647957-647979 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067325 11:647992-648014 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067335 11:648027-648049 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077067345 11:648062-648084 CAGGTGGGTGGACTTGACCCAGG + Intronic
1077181270 11:1218306-1218328 CAGGTGTGGGGAGGAGCCCGGGG - Intergenic
1077264755 11:1643051-1643073 CAGGGCAGTGGTGCAGCCCCTGG - Intergenic
1077308025 11:1876543-1876565 CAGCCGGGTGGGGCAGCCACAGG + Intronic
1077323654 11:1953902-1953924 CAGGTGGGGAGAGCAGCCGTTGG + Intronic
1077412847 11:2411439-2411461 CATGGGGGTGCAGCAGCGCCTGG + Exonic
1077518077 11:3014227-3014249 CAGGTGGGGGTTGCAGCCCCAGG - Intronic
1077668537 11:4137489-4137511 GAGGTGGGGGGTTCAGCCCCCGG - Intronic
1078513896 11:12007421-12007443 CAGGTGCGGGGAGCTGTCCCTGG - Intronic
1079997785 11:27314019-27314041 CAGGTGGGTAGATCAGGCCAGGG + Intergenic
1080047173 11:27821294-27821316 CAGCTGGCTGCAGCTGCCCCCGG - Intergenic
1080477394 11:32608471-32608493 CAGGGGTGTGGAGCTGCCCAAGG - Intronic
1081785680 11:45745232-45745254 AGGGTGGGTGGAGCAGCCAAGGG + Intergenic
1082678858 11:56143930-56143952 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1082711800 11:56561515-56561537 CATGAGGGTGGAGTTGCCCCAGG + Intergenic
1083147459 11:60769919-60769941 GCGGTGGGTGGAGGAGGCCCTGG - Intronic
1084116418 11:67045287-67045309 TAGGTGGGGGGGGCAGCTCCAGG + Intronic
1084144218 11:67255535-67255557 CAGGAGGGGCCAGCAGCCCCAGG + Exonic
1084274219 11:68043461-68043483 CAGGGAGCTGGAGCAGCCGCTGG + Exonic
1084334488 11:68448738-68448760 CTGGTGGGCACAGCAGCCCCGGG - Intronic
1084426316 11:69086199-69086221 CATGGGGGTGGGGGAGCCCCGGG + Intronic
1084447007 11:69209570-69209592 CACGGGTGTGGAGCAGGCCCCGG - Intergenic
1084701287 11:70787780-70787802 CTGGAGGCTGGAGCATCCCCAGG - Intronic
1084742962 11:71150979-71151001 CAGGTGGGTGGAGTGGGCTCAGG - Intronic
1084957621 11:72699621-72699643 CAGATGGGAGCAGGAGCCCCGGG - Intronic
1085276878 11:75306223-75306245 CAGGTGGGTGGAGTTGCCCAGGG - Intronic
1085347064 11:75775059-75775081 CAGGTGTATGGAGTAGCCCGAGG + Intronic
1087847429 11:102989385-102989407 CGGGTGGGTGGAGAAGGCGCTGG - Intergenic
1088014086 11:105037954-105037976 CACGAGGGTGGAGCTGCCCAAGG + Intergenic
1089742887 11:120597191-120597213 AAGGTGAGTGGAGCTGCCTCTGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090254605 11:125274650-125274672 CTGGGGGCTGGAGCAGGCCCAGG + Intronic
1090376449 11:126292921-126292943 CAGGGGGATGGTGCAGCCCTCGG - Exonic
1090378566 11:126308962-126308984 CAGGTGGGTGGGGGTGGCCCTGG - Intronic
1091055526 11:132414838-132414860 GAGGTGGGGGGTGCAGCTCCAGG + Intergenic
1202806641 11_KI270721v1_random:9097-9119 CAGGTGGGGAGAGCAGCCGTTGG + Intergenic
1092401903 12:8184469-8184491 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1092443558 12:8531300-8531322 CACGTGGGTGGAGCAGAGCAAGG - Intergenic
1092914110 12:13174035-13174057 GAGGTGGGTGGACCTGCACCTGG - Intergenic
1094295664 12:28901692-28901714 CACAGGGGTGGAGCAGCACCTGG + Intergenic
1094326173 12:29241862-29241884 CTGATGGGTGTAGCACCCCCTGG + Intronic
1094819109 12:34211200-34211222 CAGGTGGGTCGTGGAGTCCCTGG - Intergenic
1095098200 12:38159029-38159051 CAGGTGGACGGTGGAGCCCCTGG + Intergenic
1095744993 12:45648172-45648194 CTGGCAGGTGGAGCAGACCCAGG + Intergenic
1096082438 12:48842267-48842289 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1096167379 12:49436600-49436622 GAGGTGGGGGGGTCAGCCCCCGG - Intronic
1096856611 12:54488330-54488352 GAGGTGGGGGGGTCAGCCCCCGG - Intergenic
1097010901 12:55952930-55952952 CAGGTGAGAGGAGCAGCCTTGGG + Exonic
1098413090 12:70203006-70203028 GAGGTGGGGGGGACAGCCCCCGG + Intergenic
1100487846 12:95048201-95048223 CAGGTGGGAGCAGCTGCACCTGG + Intronic
1101409769 12:104458214-104458236 CTGGGGGCTGGAGCAGGCCCCGG - Intronic
1102827861 12:115965449-115965471 CAGATGTGGGGAGCAGGCCCTGG - Intronic
1103091696 12:118102710-118102732 CCGTTGGGTGGAGCAGACCCGGG + Intronic
1103340849 12:120220437-120220459 GAGGCGGGTTCAGCAGCCCCTGG - Intronic
1103556880 12:121771709-121771731 GAGGTGGGTGGAGCTGACCTGGG - Intronic
1103763136 12:123265553-123265575 CAGGTGGGTGGAGAGGGCCCCGG + Intronic
1104271979 12:127290424-127290446 GAGGTGGGTGAAGAAGCACCTGG + Intergenic
1104462832 12:128969443-128969465 GAGGTGGGAAGAGAAGCCCCTGG + Intronic
1104521983 12:129484912-129484934 CGGTTGGGTGGGGCTGCCCCTGG + Intronic
1104759581 12:131288924-131288946 CTGGTGGATGGAGCAGCCGCAGG - Intergenic
1104761757 12:131301000-131301022 GGTGTGGGTGGAGCAGCCACAGG - Intergenic
1104770195 12:131356704-131356726 CCTGTGGGTGGAGCAGGCCAAGG + Intergenic
1104818015 12:131659784-131659806 GGTGTGGGTGGAGCAGCCACAGG + Intergenic
1104821133 12:131678288-131678310 CTGGTGGATGGAGCAGCCGCAGG + Intergenic
1104897595 12:132171930-132171952 CAGGCGTCTGGAGCAGCCTCCGG - Intergenic
1104978296 12:132561785-132561807 CAGGAGGATGGTGCAGGCCCAGG + Intronic
1105950772 13:25227949-25227971 CAGGTGGGCCGAGCAGACACTGG - Intergenic
1107184043 13:37496204-37496226 CAGGTGTGAGGCACAGCCCCAGG + Intergenic
1107815144 13:44238092-44238114 CAGTTAGGTGCAGCAGCCACAGG + Intergenic
1107833683 13:44396814-44396836 CAGGTGCTCGGAGCAGCCCACGG - Intronic
1108590931 13:51912367-51912389 CACGTGGGGGCAGCAGCCTCAGG + Intergenic
1109750572 13:66685697-66685719 CATGTGGGTGGAGCTGCCCAAGG + Intronic
1110269363 13:73574898-73574920 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1112492581 13:99880736-99880758 CTGGCAGGTGGAGCTGCCCCAGG + Intronic
1113120278 13:106917651-106917673 CAGGTTCGTGGCGCAGCCCGGGG + Intergenic
1113418927 13:110154979-110155001 CACCTGAGTGGAGCAGCCACAGG + Intronic
1113835403 13:113325580-113325602 CGGGTGGTCAGAGCAGCCCCCGG + Exonic
1114241679 14:20874094-20874116 CTGGTGGGAAGATCAGCCCCAGG + Intergenic
1114647254 14:24262715-24262737 CAGGTGGACGGACCAGGCCCAGG - Intronic
1115480051 14:33851719-33851741 CAGATGGGAGGAGGAGTCCCCGG + Intergenic
1117194766 14:53328884-53328906 TGGGTGTGAGGAGCAGCCCCGGG + Intergenic
1119296823 14:73539431-73539453 CCGCTGGGTAGAGCAGCACCTGG - Intronic
1119483581 14:74974608-74974630 AGGGAGGGTGGAGCAGCCCTGGG + Intergenic
1119631690 14:76237581-76237603 CAGTCGGGTGGAGAAGCCCAAGG - Intronic
1120222304 14:81748085-81748107 CAGGAGGGTGGAGCAGGCTCTGG + Intergenic
1122059733 14:99129002-99129024 CAGGTGGGTGAAGGAGAGCCAGG + Intergenic
1122637985 14:103139094-103139116 GAGGTGCCTGGAGCAGACCCGGG + Intergenic
1125629648 15:41136696-41136718 CAGGTAGGTGGAGGAGCCACAGG - Intergenic
1127525763 15:59791121-59791143 CAAGTGGGTGGAACAAGCCCAGG - Intergenic
1127578716 15:60317205-60317227 TAGGTGGGTGGACATGCCCCAGG - Intergenic
1128216851 15:65940357-65940379 CAGGAGAGTGCAGCAGCCCAGGG - Intronic
1128860656 15:71068555-71068577 CACGTGGCTGGGGAAGCCCCGGG - Intergenic
1128995081 15:72289572-72289594 CAGGTGGGTGGGCCAGGCCTGGG - Intronic
1129166813 15:73783158-73783180 CAGGAGGGTGGTCTAGCCCCTGG - Intergenic
1129325544 15:74798560-74798582 CAGGTGGCTGGAGGGGGCCCAGG + Intronic
1129332103 15:74833006-74833028 CAGGTGGGTGGACCAGTCACAGG - Intergenic
1130017929 15:80201778-80201800 CACCTGGGAGGAGCAGCACCTGG - Intergenic
1132352447 15:101148500-101148522 CAGCTGGGAGGGGCAGTCCCAGG + Intergenic
1132554943 16:568273-568295 CAGATGGGTGGCCCAGCCCGGGG - Exonic
1132749504 16:1450936-1450958 CAGCTGGGTCTAGCAGCGCCAGG + Intronic
1132931746 16:2462292-2462314 CAGGTTTGCAGAGCAGCCCCAGG + Intronic
1133002402 16:2857994-2858016 GAGGAGGGAGGAGCAGCCTCCGG + Intronic
1133102248 16:3486495-3486517 CAGGGTGCTGGGGCAGCCCCAGG + Exonic
1133175073 16:4008313-4008335 CAGGTGGGTGGATCCTGCCCCGG + Intronic
1136516474 16:30771704-30771726 CAGGAGGCAGGAGCAGCTCCAGG + Intronic
1136545664 16:30953405-30953427 CAGGGCAGTGGAGAAGCCCCAGG - Exonic
1136717136 16:32289869-32289891 CAGCGGCGTGGAGCAGGCCCTGG + Intergenic
1136835510 16:33496123-33496145 CAGCGGCGTGGAGCAGGCCCTGG + Intergenic
1136872076 16:33816640-33816662 CTGGTGTCTGGAGCACCCCCTGG - Intergenic
1137286208 16:47017791-47017813 CAGGTGGGAGGCGGAGCCACCGG + Intergenic
1138512434 16:57516361-57516383 CCGGCGGGTGGAGCAGCACGAGG - Exonic
1139467059 16:67159723-67159745 CAGCTGGCTGGAGCAGCCGCCGG + Intronic
1139481078 16:67231067-67231089 CAGGTGGCTGGAGCAAGCCCTGG + Intronic
1141609681 16:85174352-85174374 CAGGTGGGTGGTGAGGCCGCTGG + Intronic
1141662382 16:85448463-85448485 CAGGTGACTGGAGCATCTCCAGG - Intergenic
1141798700 16:86292386-86292408 CTGGTGGCAGGAGCTGCCCCGGG - Intergenic
1142238757 16:88935578-88935600 CGCGTGGGTGGAGCAGGCACAGG + Intronic
1142373484 16:89695532-89695554 CAGATAGGAGGAGCAGGCCCAGG - Intronic
1203009293 16_KI270728v1_random:227909-227931 CAGCGGCGTGGAGCAGGCCCTGG - Intergenic
1203100096 16_KI270728v1_random:1299428-1299450 CTGGTGTCTGGAGCACCCCCTGG + Intergenic
1203145687 16_KI270728v1_random:1796436-1796458 CAGCGGCGTGGAGCAGGCCCTGG + Intergenic
1142625505 17:1189182-1189204 CCGTTGGTTGGAGCAGTCCCAGG + Intronic
1142978804 17:3659925-3659947 CAGGAGGCTGAAGCTGCCCCCGG - Exonic
1143434848 17:6915745-6915767 GAGGTGGCTGGAGGAGCCCTCGG - Intronic
1143465555 17:7134024-7134046 GAGGTGGTTGGAGGAGGCCCGGG - Intergenic
1144630990 17:16872416-16872438 CAGCTGGGAGAAGCAGCCCAAGG - Intergenic
1144650324 17:17003060-17003082 CAGCTGGGAGAAGCAGCCCAAGG + Intergenic
1144686849 17:17231774-17231796 CAGGTGGGTGGTGCATTCGCAGG - Exonic
1144888123 17:18477710-18477732 CAGATGGGAGTGGCAGCCCCAGG + Intronic
1145007209 17:19344558-19344580 CGGGTGGGTCCAGCAGCCGCGGG + Intronic
1145027093 17:19476073-19476095 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1145144082 17:20466593-20466615 CAGATGGGAGTGGCAGCCCCAGG - Intronic
1145418187 17:22741464-22741486 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1145791781 17:27632115-27632137 CAGATGGGAGTGGCAGCCCCAGG + Intronic
1146055334 17:29578015-29578037 CAGGGGGGTGGAGCGGTACCAGG + Intronic
1146172816 17:30646379-30646401 CGGGTGGGAGGGGCAGCCTCGGG - Intergenic
1146346273 17:32062390-32062412 CGGGTGGGAGGGGCAGCCTCGGG - Intergenic
1147121031 17:38335177-38335199 CAGGTAGCAGGAGCAGCCCCAGG + Exonic
1147554279 17:41466507-41466529 CAAGTGCTTGGAACAGCCCCTGG - Intronic
1147591997 17:41689502-41689524 CAGCTGGGTGGGGCACCGCCTGG + Intronic
1147911805 17:43860484-43860506 CAGGTGGGCGGAGCAGAGGCTGG - Intronic
1147952460 17:44114690-44114712 CAGGTTGGAGGAGCTGCCCAGGG - Intronic
1148291901 17:46459162-46459184 TAGGTTGTTGGAGCACCCCCTGG - Intergenic
1148314091 17:46676853-46676875 TAGGTTGTTGGAGCACCCCCTGG - Intronic
1148648786 17:49234815-49234837 CAGGTGGATTGAGCTGTCCCTGG - Intergenic
1148945636 17:51259982-51260004 GTGGCGGGTGCAGCAGCCCCCGG + Exonic
1150284486 17:63947302-63947324 CCGGTGGGAAGAGCAGCCCTGGG + Intronic
1151320671 17:73350515-73350537 CTGGTGGGTGGGGCAGCCTAGGG - Intronic
1151369305 17:73637861-73637883 CATCTGGGTTGGGCAGCCCCTGG - Intronic
1151605077 17:75130843-75130865 CCGCTGGGTGGAGCAGCACCTGG - Exonic
1152073402 17:78145126-78145148 CAGGCTGGTCCAGCAGCCCCAGG + Intergenic
1152516123 17:80825950-80825972 CTCGTGAGTGGAGCAGCCCTGGG + Intronic
1152638789 17:81440965-81440987 CAGGTGGCAGGCGCAGCTCCTGG - Intronic
1152701114 17:81820135-81820157 CCGGGGGGTGGAGCTCCCCCAGG - Intergenic
1153372303 18:4333229-4333251 CATCTGGGATGAGCAGCCCCTGG - Intronic
1154255452 18:12777628-12777650 GAGCGGGGTGGCGCAGCCCCAGG - Intergenic
1155492790 18:26416760-26416782 GAGGGGGCTGGAGCAGCTCCAGG + Intergenic
1156103853 18:33633060-33633082 CACGTGGGAGGAGCAGCACAAGG - Intronic
1157591892 18:48841269-48841291 CCAGTGGCTGGAGCGGCCCCTGG + Intronic
1158910980 18:62062184-62062206 CAGGTGGGGGGAGCAGGGTCAGG - Intronic
1159873015 18:73779497-73779519 CAGGTGCTTGGGGCAGCCTCTGG - Intergenic
1160441678 18:78898231-78898253 CATGGGGGTGGTGCAGGCCCTGG + Intergenic
1160684423 19:426891-426913 CAGGCGGGTGGAGGAATCCCTGG + Intronic
1160939627 19:1614242-1614264 CAGGTGGTGGGGGCGGCCCCTGG + Intronic
1161171523 19:2814605-2814627 CAGGTGCATGGAGCAGAGCCAGG - Exonic
1161203479 19:3028686-3028708 CAGGTGAGGGGGGCCGCCCCAGG - Exonic
1161429635 19:4224190-4224212 CAGGTGAGTGGCCCAGCTCCTGG + Exonic
1161519140 19:4713878-4713900 GGGGTGGGTGGGGCGGCCCCCGG - Intronic
1161552782 19:4923378-4923400 CAGGTCGGAGGTGCAGCCCTGGG - Intronic
1162989610 19:14293708-14293730 CGGGTGGGAGGGGCAGCCTCGGG + Intergenic
1163103902 19:15112584-15112606 CAGATTGGTGGTGCAGGCCCTGG - Intronic
1163376891 19:16938605-16938627 CAGGTGCGTGGAGCAGGACAGGG + Intronic
1163632510 19:18424605-18424627 GGGGTGGGGGGAGCAGCACCTGG + Intronic
1163945188 19:20529754-20529776 GAGGTGGGGGGCTCAGCCCCCGG - Intergenic
1164573678 19:29392598-29392620 CAGATGCGTGGAGAAACCCCTGG - Intergenic
1164776650 19:30858297-30858319 TGGCTGGGAGGAGCAGCCCCTGG - Intergenic
1165106190 19:33470895-33470917 CAGGTAGGAAGAGCAGCCCAGGG + Intronic
1165328574 19:35128129-35128151 CAGGTACGTGGGGCAGTCCCTGG - Intronic
1165907691 19:39203756-39203778 CAGGGGTGTGGAGCAGCCTCGGG + Intronic
1166199333 19:41226321-41226343 CAGGTGGCTGGACCCGACCCAGG + Intronic
1166253718 19:41587707-41587729 CAGGTGTGTGGAGGAGCTGCAGG - Intronic
1166257664 19:41618158-41618180 CAGGTGTGTGGAGGAGCTGCAGG + Intronic
1166338931 19:42125772-42125794 CAGGGTGGTGGGCCAGCCCCTGG - Intronic
1166410304 19:42552288-42552310 CAGGTGTGTGGAGGAGCTGCAGG + Intronic
1166435849 19:42766107-42766129 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166445729 19:42856135-42856157 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166453120 19:42918283-42918305 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166465394 19:43026869-43026891 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166471527 19:43083074-43083096 CAGGAGGCTGGAGCTGCACCAGG + Intronic
1166632424 19:44418805-44418827 CAGGTGGGTGGAGCATTCATAGG - Intronic
1167103114 19:47416292-47416314 CAAGTGCGTGGAACAGCACCTGG - Intronic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
1168689598 19:58368738-58368760 CCCCTTGGTGGAGCAGCCCCGGG - Exonic
925193964 2:1908426-1908448 TAGGTGGGCAGAGCAGTCCCCGG + Intronic
925336451 2:3102300-3102322 CAGGTGGGAGGCCGAGCCCCTGG + Intergenic
925376472 2:3389380-3389402 CTGGCGGTTGGAGCAGCCCCCGG - Intronic
925428460 2:3770908-3770930 CTGGTGGGTGGAGCATCCCAGGG - Intronic
925844716 2:8024816-8024838 CAGCTGGGTGAGGCAGCCCGTGG - Intergenic
926098282 2:10096902-10096924 GAGGAGTGTGGAGCTGCCCCAGG + Intergenic
927496327 2:23554075-23554097 CTGGGGGCTGGAGCAGCCCCAGG + Intronic
927833312 2:26371098-26371120 GAGGTGGGGGGGTCAGCCCCTGG - Intronic
928435334 2:31251235-31251257 CAGGTGTGTGGTGCAGGGCCAGG + Intronic
928783599 2:34854574-34854596 CAGGAGGGTAGAGCACCACCTGG + Intergenic
929589041 2:43133440-43133462 CGGGTGGGTGGACCAGCCTGAGG + Intergenic
929868415 2:45737511-45737533 CAGTTGCGAGGAGGAGCCCCGGG - Intronic
930990760 2:57650966-57650988 CAGGTGGGGTGAGAAGCCCCTGG + Intergenic
932278316 2:70468294-70468316 GAGGAGGGTCCAGCAGCCCCAGG - Intronic
932400749 2:71479510-71479532 CAGGCAGGTGCTGCAGCCCCTGG - Intronic
932761568 2:74441644-74441666 GAGGTGGCTGGGGCTGCCCCCGG + Intronic
934176531 2:89583425-89583447 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934188634 2:89766251-89766273 AATGGTGGTGGAGCAGCCCCTGG - Intergenic
934286841 2:91657786-91657808 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934307964 2:91841702-91841724 GATGGTGGTGGAGCAGCCCCTGG + Intergenic
934546143 2:95218118-95218140 CAGATGGGTTTAGCAGCCCCAGG - Intronic
934739145 2:96706644-96706666 CAGGTGTGTTCTGCAGCCCCAGG + Exonic
935275702 2:101474078-101474100 CGGGTGTGAGGAGCGGCCCCAGG - Intronic
935820441 2:106887475-106887497 CAAGTGGTTGAAGCAGCCTCCGG + Intergenic
937065045 2:119011510-119011532 CAGAGGGGTGGAGCAGCCCCAGG - Intergenic
937909115 2:127066841-127066863 CAGGTGGATCGCTCAGCCCCAGG + Intronic
938406457 2:131035639-131035661 CAGGTGTGTGGAAGACCCCCGGG + Intronic
939002104 2:136748296-136748318 CAGCTGTGTGCAGCAGCCACTGG - Intergenic
940126783 2:150334886-150334908 CAGGAGGGGTGATCAGCCCCCGG + Intergenic
941366915 2:164621215-164621237 CAGGTGTGTGGCGCTGCCCAGGG - Exonic
941687020 2:168457011-168457033 CAGGTGGGTGGCGCGGGCCCCGG - Intronic
942318140 2:174713099-174713121 CTGTTGGCTGGAGCTGCCCCAGG + Intergenic
944580339 2:201126679-201126701 AAGGTTGTTGCAGCAGCCCCAGG + Intronic
945110458 2:206356543-206356565 GAGGTGGGGGGGTCAGCCCCCGG - Intergenic
946163097 2:217847905-217847927 GAGGAGAGTGGAGAAGCCCCTGG + Exonic
946309649 2:218876286-218876308 CAGGGGGGTGGGGCAGGCACAGG + Intergenic
946765455 2:223036234-223036256 CAGGAGGCTGGAACAGCCTCAGG - Intergenic
947633842 2:231670318-231670340 ACTGTGGGTGGAGGAGCCCCTGG + Intergenic
948101245 2:235374879-235374901 CAGGTGGGTGGAGTAAAACCAGG - Intergenic
948109065 2:235440113-235440135 CAGGTGGTAGGAGGAGCCCTGGG + Intergenic
948169314 2:235888393-235888415 GAGCTGTGTGGAGCAGCCCTAGG - Intronic
948367859 2:237470070-237470092 CAGGGGGCTGGAGCAGCCCCAGG + Intergenic
948759799 2:240183562-240183584 GAGGTGGGACGGGCAGCCCCGGG - Intergenic
948779369 2:240308432-240308454 CAGGTTGGTACAGCAGCCCTCGG - Intergenic
948912672 2:241012175-241012197 CAGGCAGGTGGCCCAGCCCCAGG + Intronic
949076375 2:242061362-242061384 CAGGTGGGTGGTGCAGTACCAGG + Intergenic
1169111987 20:3040157-3040179 CAAGTTTGGGGAGCAGCCCCTGG + Intergenic
1169112830 20:3044610-3044632 CAGGAGGGTGGGGGAGCCCCCGG - Intronic
1169140409 20:3224425-3224447 CAGGCTGGTGGGGCACCCCCAGG + Intergenic
1169141811 20:3230864-3230886 CAGGTGGGCGCCGCAGCCCAGGG + Intronic
1169217492 20:3802001-3802023 CAAGAGGCTGGAGCGGCCCCAGG + Exonic
1169648558 20:7841832-7841854 CAGGAGGGTGCAACAGCCTCAGG + Intergenic
1170961252 20:21027803-21027825 CAGTTGGGTGGAGCAACCCCAGG - Intergenic
1172051550 20:32122199-32122221 GAGGTGGGGGCATCAGCCCCCGG - Intronic
1172402224 20:34659423-34659445 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1174111605 20:48201486-48201508 CAGGTGGCTGGAGCGGCTGCTGG - Intergenic
1175004235 20:55665371-55665393 GAGGTGGTGGGAGCATCCCCGGG - Intergenic
1175268880 20:57720004-57720026 CAGGTGGGTGAGGCAGAGCCAGG + Intergenic
1175692791 20:61077598-61077620 AAAGTGGATGGAGCAGCCTCTGG + Intergenic
1175957344 20:62618172-62618194 CAGGAGGGTGGAGAACTCCCAGG - Intergenic
1178699040 21:34818202-34818224 CATGGGAGTGGAGCAGCCCAGGG - Intronic
1179164075 21:38921806-38921828 CAGGCGGGGGAAGAAGCCCCAGG - Intergenic
1179325667 21:40341035-40341057 CAGGTGGCTGGAGAAGTCCCTGG + Intronic
1179606586 21:42519664-42519686 CTGGTTGGTGGAGCATCCACAGG + Intronic
1179999174 21:44987380-44987402 AAGGCGGGTGGAGCAGTGCCCGG - Intergenic
1181038602 22:20181609-20181631 CAGGCTGGCAGAGCAGCCCCAGG + Intergenic
1181447950 22:22993095-22993117 AAGGTGGGTGGAACAGCTGCAGG + Intergenic
1181498151 22:23299846-23299868 CAGCGTGGTGGAGAAGCCCCAGG - Intronic
1181581938 22:23833436-23833458 CAGGTGACTGGAGCATCCACTGG + Intronic
1181959234 22:26610985-26611007 CAGGGTGGAGGGGCAGCCCCAGG - Intronic
1182299118 22:29328260-29328282 CAAGTGGGTGGTGCAGGCCCTGG + Exonic
1182837028 22:33350551-33350573 AAGGTGGGTGGAGGAGCAGCTGG + Intronic
1183157406 22:36085947-36085969 CAGGTGGCAGGCGCAGCCCGAGG + Intergenic
1184160513 22:42694634-42694656 CAGGTGGTTGGAGGAGCAGCAGG + Exonic
1184265045 22:43342327-43342349 GACGTCGGTGGAGCAGACCCAGG - Intronic
1184362473 22:44026621-44026643 CTCCAGGGTGGAGCAGCCCCTGG + Intronic
1184366091 22:44052365-44052387 CAGGTGAGGAGAGCAGGCCCGGG - Intronic
1184569745 22:45314698-45314720 CAGGTGGGTCCACAAGCCCCTGG + Intronic
1184730812 22:46370001-46370023 CAGGTGGCAGGAGCTGCTCCTGG + Intronic
1185030409 22:48440001-48440023 CAGGTGGGTGAAGAAGCCGACGG - Intergenic
1185031258 22:48444324-48444346 CTTGTGGCTGGAGCTGCCCCAGG + Intergenic
1185041923 22:48508503-48508525 CAAGTGGCTGCAGCAGCCTCAGG - Intronic
1185060341 22:48603266-48603288 CATGTGGGCAGAGCAGCCTCCGG - Intronic
1185102070 22:48845907-48845929 CAGGCAGGTGGGGCAGCCACAGG + Intronic
1185214270 22:49589661-49589683 AAGGTGGCTGCAGCAGCCCCGGG - Intronic
1185268520 22:49917934-49917956 CAGGTGGGAGGTCCGGCCCCAGG + Intronic
1185268534 22:49917972-49917994 CAGGTGAGAGGTCCAGCCCCAGG + Intronic
1185268579 22:49918089-49918111 CAAGTGAGGGGTGCAGCCCCAGG + Intronic
1185321297 22:50201269-50201291 CACGCGGGTGAAGCAGGCCCCGG - Exonic
1185414982 22:50704927-50704949 CAGCTGGGTGGGGACGCCCCAGG - Intergenic
950359576 3:12440991-12441013 GAGGTGGCTGGACCAGCCCCAGG - Intergenic
950437552 3:12989653-12989675 CAGGTGTGTGGAGTGGCCCAGGG - Intronic
952588550 3:34923288-34923310 CAGATGAGTGGAGCAGCCTCTGG - Intergenic
952629022 3:35442367-35442389 CTGGTGGGTTGAGCAGCTTCAGG - Intergenic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
953563691 3:44013668-44013690 CAAGGGGCTGCAGCAGCCCCTGG - Intergenic
953960645 3:47263422-47263444 CAGGTGGCTGGAGCTGTCACAGG - Intronic
955329425 3:58034813-58034835 CGGGTGGGTGTAGCAGTCCCAGG + Intronic
956363270 3:68471472-68471494 CAGAGGGGTGGAGCTGCCCAAGG + Intronic
957457707 3:80473174-80473196 CAGAGGGGTGGAGCTGCCCAAGG + Intergenic
958808858 3:98838088-98838110 GAGGTGGGGGGTTCAGCCCCCGG - Intronic
959526818 3:107386805-107386827 CAGGATGGTGCAGCAGCCCATGG + Intergenic
960537364 3:118828428-118828450 CTGGTTGGTGCAGCAGCCCTTGG + Intergenic
961901173 3:130213340-130213362 CATGTGGGTAGAGCAGGCCCTGG + Intergenic
961962533 3:130868369-130868391 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
963612624 3:147490666-147490688 CAGTTTGATGGAGCTGCCCCTGG - Intronic
964334051 3:155636016-155636038 CAGATGGCTGTAGCAGCTCCAGG + Intronic
966486443 3:180476325-180476347 AAGGTGGCTGGAGCCGCCCATGG + Intergenic
966942578 3:184756262-184756284 CTGGTAGGTGGAGCAGCTCAGGG + Intergenic
968506269 4:972752-972774 CAGCTGGGTGGAGCAGGGCTGGG + Intronic
968520725 4:1033642-1033664 CAGGGAGGTGGAGCATCCCGAGG + Intergenic
968607586 4:1542810-1542832 CAGATGGGTGCTGCAGGCCCTGG + Intergenic
968760995 4:2442759-2442781 CAGCTGGGAGGAGCAGCCCCCGG - Intronic
968814009 4:2812475-2812497 CAGGTCAGTGGGGCGGCCCCAGG + Intronic
968952664 4:3702807-3702829 CAGGTCAGGGGAGCAGCCCTCGG + Intergenic
968964719 4:3764086-3764108 CAGGCTGGGGGAGGAGCCCCAGG + Intergenic
969285403 4:6199630-6199652 CACGTGGGCGGAGCAGCGCGAGG + Intronic
970836051 4:20408928-20408950 GGGGTGGGAGAAGCAGCCCCAGG - Intronic
975942754 4:79667937-79667959 CAGATGGATGGAGCAGCACGTGG + Intergenic
976068714 4:81217945-81217967 GCCATGGGTGGAGCAGCCCCAGG - Intergenic
979622580 4:122812517-122812539 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
979899498 4:126200277-126200299 CAGGTGGGGAGGGCAGCTCCAGG + Intergenic
982566826 4:156996646-156996668 CAGAAGGGTGGAGCTGCCCAAGG - Intergenic
982737106 4:159018242-159018264 CACGTGGCTGCAGCAGCCCCTGG + Intronic
982820878 4:159939736-159939758 GAGGTGGGGGGGTCAGCCCCCGG - Intergenic
985508524 5:298834-298856 CAGCTGGGGGGAGCAGCTGCGGG - Intronic
985509545 5:305071-305093 CAGGTGGGAGCTGCAGCTCCAGG + Intronic
985703388 5:1386875-1386897 GAGTTGGGGAGAGCAGCCCCAGG - Intergenic
985719298 5:1481019-1481041 CAGGTGCTTGGTGCAGGCCCTGG - Intronic
986341310 5:6791497-6791519 CAGGTGGGTGCAGCAGCAGAAGG + Intergenic
987362503 5:17120085-17120107 GAGGAGGGTAGAGGAGCCCCAGG + Intronic
988478788 5:31611986-31612008 CAGGTGGCTAGAGCATCTCCCGG + Intergenic
988564642 5:32311801-32311823 CAGGTAGAGGGAACAGCCCCCGG - Intronic
989061459 5:37415453-37415475 GAGGTGGGGGGATCAGCCCCCGG - Intronic
989579435 5:43018078-43018100 CTGGTGGGAGGAGCAGCGCTGGG - Intergenic
990332602 5:54742512-54742534 CGTGTGGGTGGAGCACCCCCAGG - Intergenic
990947391 5:61263252-61263274 CAGGTGAGAGGAGCCGCTCCTGG + Intergenic
992629361 5:78665885-78665907 CTGCTGAGTGGAGAAGCCCCAGG + Intronic
993790957 5:92210603-92210625 CAGGTGTGAGCAACAGCCCCCGG - Intergenic
995053644 5:107734905-107734927 CATGTGGGTGGAGGATCACCAGG - Intergenic
995246079 5:109937126-109937148 CAGCTGGTTGGACCAGCCTCAGG + Intergenic
997302342 5:132814577-132814599 CTGGTGGGTCCAGCGGCCCCCGG - Exonic
997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG + Intronic
997687688 5:135800131-135800153 CAGGCGGGTTGTACAGCCCCTGG - Intergenic
998395035 5:141812718-141812740 CAGGTGGGTGGGAGAGCCTCTGG + Intergenic
999088336 5:148912847-148912869 CAGGTGGATGGAGGAGCTCCAGG - Intergenic
999143825 5:149379747-149379769 CAGGTGAGTTCAGCAGCCCTAGG + Intronic
1001487321 5:172128871-172128893 GAGGAGGGTGGAGCAGCCTCAGG + Intronic
1001844043 5:174904815-174904837 CAGATGGGAGGACCCGCCCCAGG - Intergenic
1002180445 5:177428411-177428433 CAGGTGGGAGGGGCAGAGCCAGG - Intronic
1002193922 5:177492227-177492249 CAGGACCGTGCAGCAGCCCCTGG + Intronic
1004198990 6:13530793-13530815 AAGGTGGCTGCAGCAGCTCCAGG + Intergenic
1004448706 6:15726228-15726250 GAGGTGGGGGGGTCAGCCCCCGG - Intergenic
1004727487 6:18325363-18325385 CTGGTTCCTGGAGCAGCCCCTGG - Intergenic
1005468959 6:26143103-26143125 AAGGAGGCTGGAGAAGCCCCAGG - Intergenic
1005578237 6:27210077-27210099 CAGCTGGGAGGAGCAGGTCCGGG - Intergenic
1006011465 6:31046025-31046047 GAGCTGGGAGGAGCAGCCCTGGG - Intergenic
1006393388 6:33771946-33771968 GAGGAGGGTCGGGCAGCCCCAGG - Exonic
1006393602 6:33773015-33773037 GAGGTGTCTGGAGCACCCCCAGG + Intronic
1006505291 6:34485387-34485409 CAGGGGGCTGGGGCAGACCCTGG + Intronic
1006742756 6:36321100-36321122 CAGGTGGGTAGATGAGGCCCTGG + Intronic
1006980640 6:38145132-38145154 GAGGTGGGTGGAGCAGGAGCTGG - Intronic
1007401055 6:41602516-41602538 CAGTTCTGTGGACCAGCCCCGGG + Intergenic
1007403178 6:41616436-41616458 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1008421344 6:51303174-51303196 CAGGTGGGCAGAGCAGCAGCTGG + Intergenic
1012088435 6:94859657-94859679 CACATGGTTGGAGAAGCCCCAGG + Intergenic
1012429932 6:99153601-99153623 CAGGTGGGTGGAGGAGGGCCTGG + Intergenic
1012466415 6:99521274-99521296 CAGGTGGGTGTTACATCCCCAGG - Intronic
1016175289 6:141071999-141072021 CACATGGGTGGAGCTGCCCAAGG + Intergenic
1017660700 6:156670439-156670461 GAGGTGGGGGGGTCAGCCCCCGG + Intergenic
1017913994 6:158818487-158818509 CTGGTGGGGGGCGCAGGCCCGGG + Intronic
1017992838 6:159505759-159505781 CAGGTGGGTGGGGCAGGAGCTGG - Intergenic
1018693515 6:166370003-166370025 CAGGAGTAGGGAGCAGCCCCAGG + Intronic
1018830959 6:167443247-167443269 CGGGTGGGTGGAGGTCCCCCTGG + Intergenic
1018837587 6:167496958-167496980 CACCTGGGTGGAGTAGCACCTGG + Intergenic
1018962931 6:168461107-168461129 CATGTGGGTGGGGAAGCCTCAGG + Intronic
1019153937 6:170026341-170026363 CAGGTGGGTAGGGCAGGCCCGGG + Intergenic
1019265165 7:111072-111094 CAGGTGGGTGCTGGAGGCCCTGG - Intergenic
1019379468 7:713310-713332 CAGGTGGGTGGAGGACCCCGGGG - Intronic
1019571993 7:1717264-1717286 CAGGTACCTGGAGCAGCCCATGG + Intronic
1019597773 7:1866232-1866254 CAGGTTGGTGGTGCAGAGCCCGG + Intronic
1019663887 7:2241896-2241918 CAGGTGGGGGGCGCAGCGCCGGG - Intronic
1020125163 7:5529502-5529524 TGGCTGGGTGGGGCAGCCCCGGG - Intronic
1021672344 7:23046272-23046294 GAGGTGGGGGGTTCAGCCCCCGG - Intergenic
1022947279 7:35299688-35299710 CAGGAAGGTGGAGTAGTCCCTGG - Intergenic
1023109680 7:36796617-36796639 CAGGTGGCTGGAGCCTCTCCTGG - Intergenic
1023146959 7:37160848-37160870 CAGGTGGGAGGAGCAGACATAGG + Intronic
1023261597 7:38363680-38363702 GAGGTGGGGGAAGCAGACCCTGG + Intergenic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1023931248 7:44707895-44707917 CCGGTGGCTGGAGCAGCCGCTGG - Exonic
1024526025 7:50350074-50350096 TAGGGAGGTGGGGCAGCCCCGGG + Intronic
1024538737 7:50459827-50459849 GAGGTGGGGGAATCAGCCCCCGG + Intronic
1024538888 7:50460180-50460202 GAGGTGGGGGGGTCAGCCCCTGG + Intronic
1025069649 7:55887509-55887531 CCGGTGGCTGGACCGGCCCCAGG + Intronic
1025177546 7:56809717-56809739 CAGGAGGCTGGAGCTGGCCCTGG + Intergenic
1025991776 7:66502956-66502978 GAGGTGGGTGTTGCAGGCCCGGG - Intergenic
1026958832 7:74395695-74395717 CAGGAGTGTGGAGGAGCCCACGG - Intronic
1028430739 7:90744633-90744655 GAGGTGGGGGGGTCAGCCCCCGG - Intronic
1029698300 7:102229120-102229142 CAGCTGGGGCGGGCAGCCCCTGG + Intronic
1032569830 7:132985498-132985520 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1033970630 7:147034733-147034755 CAGCTGGGTGGCCCAGCTCCAGG - Intronic
1034415969 7:150964421-150964443 CAGACAGGTGGAGGAGCCCCAGG + Intronic
1034439121 7:151077601-151077623 CAGGTGGATGGGGCAGCCTGGGG - Exonic
1035055995 7:156037130-156037152 CTGGTGGGAGGAGGAGGCCCTGG - Intergenic
1035066127 7:156106170-156106192 CTTGTGGGCGGAGCAGCCCTGGG + Intergenic
1035085294 7:156253010-156253032 CTGGTGGATGGAGCAGCTCCAGG + Intergenic
1035091803 7:156319119-156319141 CGGGTGGGTGGGGCAGCCACTGG - Intergenic
1035113787 7:156506086-156506108 CAGGAGGGAGAGGCAGCCCCCGG + Intergenic
1035269127 7:157709686-157709708 CGGGTGTGTGGCGCAGCTCCTGG - Intronic
1035462887 7:159056081-159056103 CAGGTGGAGAGTGCAGCCCCAGG - Intronic
1037152663 8:15656578-15656600 GAGGTGGGTGGGGCTGCCCAAGG - Intronic
1038687772 8:29734181-29734203 TAGGAGGGAGGAGCAACCCCAGG - Intergenic
1039061191 8:33573534-33573556 GAGGTGGGTGGATCACCCACTGG + Intergenic
1039374156 8:37016419-37016441 CACCTGGATGGAGCAGCCACAGG - Intergenic
1039838852 8:41279356-41279378 TAGGTGGGTAGACCAGACCCCGG - Intronic
1040111677 8:43569543-43569565 CAGGTGGGTAGTGGAGTCCCTGG - Intergenic
1040334557 8:46409456-46409478 CAGGTGGGTTGCAAAGCCCCAGG + Intergenic
1040337076 8:46421450-46421472 CAGGTGGGCTGTGAAGCCCCCGG + Intergenic
1041157565 8:55004277-55004299 CAGGTGGGTAGAGGAGCTGCTGG - Intergenic
1041281790 8:56217868-56217890 CAGGTGGGTGGAGCAGTGGTGGG + Exonic
1044156273 8:88851455-88851477 CAGGTGGGTAGAGCCACTCCTGG - Intergenic
1045298560 8:100892397-100892419 GAGGTGGGGGGGTCAGCCCCCGG - Intergenic
1045926587 8:107583431-107583453 CAGGTGGGGGGAACACCGCCTGG - Intergenic
1048920309 8:139223765-139223787 CAGGGGGATGGATCAGCCACAGG + Intergenic
1048944718 8:139433883-139433905 CTGGAGGGTGGGGCAGCCACAGG - Intergenic
1049341519 8:142115032-142115054 CAGGTGGGTGTGGCAGCTTCAGG + Intergenic
1049343975 8:142128696-142128718 CTGGTGGCTGGAACAGCTCCTGG - Intergenic
1049573714 8:143381114-143381136 ATGGTGGGAGGAGCTGCCCCAGG - Intronic
1049587961 8:143440656-143440678 CGGGTGGGAGGCCCAGCCCCGGG - Intronic
1050643453 9:7693428-7693450 CATGGGGGTGGAGCAGCCCAAGG + Intergenic
1052324578 9:27203694-27203716 CATGTGGGTGGAGCTGCAGCAGG + Intronic
1052858261 9:33420567-33420589 CAGGTGTGTGGGGTAGCCCCAGG + Intergenic
1055282475 9:74690363-74690385 CAAATGGGTGAAGCAGCCCAGGG + Exonic
1055798658 9:80005682-80005704 CAGGTGAGCAGAACAGCCCCTGG - Intergenic
1056048830 9:82746732-82746754 CTTGTGGATGGAGCAGCACCAGG - Intergenic
1056152727 9:83804568-83804590 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1056285952 9:85088338-85088360 CAGGTGGGTGGAGCAGAGAGAGG - Intergenic
1056445968 9:86666547-86666569 CAGGTAGGGGGAGCAGTCCCAGG - Intergenic
1056468675 9:86884254-86884276 CAGTTGGGCAGAGCTGCCCCAGG + Intergenic
1057155050 9:92831535-92831557 GAGGTGGGGGGATCAGCCCCTGG - Intergenic
1057190408 9:93084080-93084102 CAGGTGGGTGATCCAGCTCCTGG + Intronic
1058985798 9:110207604-110207626 CAGCTGGGTGGGGCAGGACCTGG + Exonic
1061145174 9:128793436-128793458 CAGGTGGGTGGAGTGGCCAAGGG + Intronic
1061404313 9:130385126-130385148 CAAGTGAATGGACCAGCCCCGGG - Intronic
1062090706 9:134677333-134677355 CAGGGTGGTGGAGCTGCCCTTGG + Intronic
1062097014 9:134708737-134708759 CAGTTGGTTGCAGCAGTCCCAGG - Intronic
1062192542 9:135255319-135255341 GGGGTGGGAGGTGCAGCCCCAGG + Intergenic
1062277654 9:135738328-135738350 CAGCTGGGCTGAGCAGCCCCTGG + Intronic
1062321624 9:135993120-135993142 CTGGTGGGTGGAGCAGCCTCGGG - Intergenic
1062418581 9:136466937-136466959 CAGGTTGGTGGAGCACCCCTGGG - Exonic
1062429792 9:136521827-136521849 CAAGGGGGTGGGGCAGCCCTTGG + Intronic
1062438840 9:136560006-136560028 CAGAGGGGTGGAGCTGCCCAAGG + Intergenic
1062460325 9:136660181-136660203 CAGGGGGTTGGGGCTGCCCCCGG - Intronic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1186751323 X:12623899-12623921 CAGGTGGGTGTCACTGCCCCTGG - Intronic
1187784027 X:22864129-22864151 GAGGTGTTGGGAGCAGCCCCAGG - Intergenic
1189025298 X:37388131-37388153 CAGAGGGGTGGAGCTGCCCAAGG - Intronic
1189042123 X:37553749-37553771 CAGGTGGGAGGAGGTCCCCCAGG - Intronic
1189669688 X:43394921-43394943 CACAGGGGTGGAGCTGCCCCAGG - Intergenic
1189809060 X:44764091-44764113 CAGGTGTGAGGAACAGCGCCTGG + Intergenic
1190014682 X:46816743-46816765 GATGTGGGTGGACCAGCCCCAGG - Intergenic
1190298001 X:49039846-49039868 CAGGTGATAGGAGAAGCCCCAGG + Intronic
1190596718 X:52059475-52059497 CAGGTGGGTGTATCACCCCCAGG + Intergenic
1190612106 X:52194598-52194620 CAGGTGGGTGTATCACCCCCAGG - Intergenic
1190779042 X:53578478-53578500 GAGGTGGGGGGGTCAGCCCCCGG + Intronic
1190929556 X:54935794-54935816 CAGGTGGGTTTATCACCCCCAGG - Intronic
1191740730 X:64433518-64433540 GGAGTGGGTCGAGCAGCCCCTGG - Intergenic
1192434795 X:71136569-71136591 GTACTGGGTGGAGCAGCCCCCGG - Exonic
1193943863 X:87708608-87708630 CAGAGGGGTGGAGCTGCCCAAGG - Intergenic
1194397477 X:93403780-93403802 CACATGGGTGGAGCTGCCCAAGG - Intergenic
1194542341 X:95190074-95190096 CACATGGGTGGAGCTGCCCAAGG - Intergenic
1197089907 X:122523844-122523866 CAGGTGGTTGGGTCAGCCCTGGG - Intergenic
1197223214 X:123932760-123932782 CATGGGGGTGGAGCTGCCCAAGG + Intergenic
1198534813 X:137575013-137575035 CAGGTGGGTGGGGAGGCCTCTGG - Intronic
1199748304 X:150790382-150790404 CAGGTGGGTGGGGGACTCCCAGG + Intronic
1200054735 X:153454344-153454366 CCTGTGCGTGGGGCAGCCCCAGG + Intronic