ID: 997575011

View in Genome Browser
Species Human (GRCh38)
Location 5:134968107-134968129
Sequence GCACATTTCTTAACAGGCAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 478}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997575011_997575014 -6 Left 997575011 5:134968107-134968129 CCATTGCCTGTTAAGAAATGTGC 0: 1
1: 0
2: 2
3: 48
4: 478
Right 997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 142
997575011_997575015 -2 Left 997575011 5:134968107-134968129 CCATTGCCTGTTAAGAAATGTGC 0: 1
1: 0
2: 2
3: 48
4: 478
Right 997575015 5:134968128-134968150 GCTAGTAGAAGTGTGAGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 130
997575011_997575013 -7 Left 997575011 5:134968107-134968129 CCATTGCCTGTTAAGAAATGTGC 0: 1
1: 0
2: 2
3: 48
4: 478
Right 997575013 5:134968123-134968145 AATGTGCTAGTAGAAGTGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 133
997575011_997575016 -1 Left 997575011 5:134968107-134968129 CCATTGCCTGTTAAGAAATGTGC 0: 1
1: 0
2: 2
3: 48
4: 478
Right 997575016 5:134968129-134968151 CTAGTAGAAGTGTGAGGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997575011 Original CRISPR GCACATTTCTTAACAGGCAA TGG (reversed) Exonic
901467688 1:9433200-9433222 GCCCAGTTCCTAACAGGCTATGG + Intergenic
901924466 1:12557089-12557111 GCCCATTTCCTAACAGGCCATGG - Intergenic
902104230 1:14020259-14020281 GCCCAGTTCCTAACAGGCCACGG + Intergenic
902365263 1:15968960-15968982 GCCCACTTCCTAACAGGCCACGG - Intronic
902703588 1:18189819-18189841 GCCCGTTTCCTAACAGGCCATGG + Intronic
903060784 1:20667108-20667130 GCCCAGTTCCTAACAGGCCAGGG - Intronic
903492802 1:23742786-23742808 GCACATTTCTGAACAGGTCGAGG - Intergenic
904086458 1:27912865-27912887 ACACATTTCTTAACTGGCTTGGG - Intronic
904564601 1:31421030-31421052 GCCCAGTTCTTAACAGGCCATGG - Intronic
905095065 1:35463105-35463127 GCCCAGTTCCTAACAGGCCACGG + Intronic
905246942 1:36621629-36621651 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
907064537 1:51467619-51467641 GCTCAGTTCCTAACAGGCCATGG - Intronic
907121913 1:52015479-52015501 GCCCAGTTCCTAACAGGCCATGG + Intergenic
908102449 1:60805515-60805537 GCCCATTTCCTAACAGACCATGG + Intergenic
908119649 1:60973905-60973927 GCACATGTCTCAGCAGGCACTGG - Intronic
908268310 1:62399536-62399558 TCACATTTTTTAACTGACAATGG + Intergenic
908328644 1:63048758-63048780 GCCCAGTTCCTAACAGGCCATGG + Intergenic
908420761 1:63956300-63956322 GCTCATTTCTAAAGAGGCCAGGG + Intronic
908664396 1:66473993-66474015 GCCCATTTCCTAACAGGCCATGG + Intergenic
909087437 1:71184536-71184558 GCACAGTTCTTAACAGGCCATGG - Intergenic
909423044 1:75487830-75487852 GCTCAGTTCCTAACAGGCCATGG - Intronic
909516026 1:76508345-76508367 GCCCAGTTCCTAACAGGCCAGGG + Intronic
909617394 1:77626604-77626626 GCCCAGTTCCTAACAGGCCATGG + Intronic
910162824 1:84292314-84292336 GGATAAATCTTAACAGGCAATGG - Intergenic
910315211 1:85874817-85874839 GCCCATTTCCTAACAGGCCTTGG - Intronic
910754902 1:90678693-90678715 GCCCAGTTCTTAACAGGCCATGG - Intergenic
911147075 1:94562755-94562777 GCCCAGTTCCTAACAGGCCATGG + Intergenic
911857308 1:102895728-102895750 TCATATTTCTAAACAGGGAAGGG + Intronic
911921650 1:103770427-103770449 ACACAATTCTTAACAAGCAGAGG + Intergenic
912975596 1:114327100-114327122 GCCCAGTTCCTAACAGGCCATGG - Intergenic
913230370 1:116736007-116736029 GCCCAGTTCCTAACAGGCCATGG - Intergenic
913325024 1:117620609-117620631 GCCCAGTTCCTAACAGGCCACGG - Intronic
913373025 1:118121420-118121442 GCCCAGTTCCTAACAGGCCATGG - Intronic
913670562 1:121094192-121094214 GCCCAGTTCCTAACAGGCCACGG - Intronic
914022328 1:143881631-143881653 GCCCAGTTCCTAACAGGCCACGG - Intergenic
914660811 1:149789572-149789594 GCCCAGTTCCTAACAGGCCACGG - Intronic
915708300 1:157868616-157868638 GCCCAGTTCCTAACAGGCCATGG + Intronic
916777827 1:167986757-167986779 GCTCACTTCCTAACAGGCTACGG + Intronic
916952136 1:169791136-169791158 GCTCAGTTCCTAACAGGCCACGG + Intronic
917066622 1:171101766-171101788 CCACATTTCTGAATAGGCCACGG + Intronic
917146054 1:171892959-171892981 GCCCAGTTCCTAACAGGCCATGG + Intronic
917348145 1:174049977-174049999 GCCCAGTTCCTAACAGGCCATGG - Intergenic
917987162 1:180332362-180332384 GCCCAGTTCCTAACAGGCCATGG - Intronic
918019585 1:180673527-180673549 GCCCAGTTCCTAACAGGCCATGG - Intronic
918225192 1:182474731-182474753 GCCCAGTTCCTAACAGGCCATGG - Intronic
918572200 1:186010078-186010100 GCCCAGTTCCTAACAGGCCATGG + Intronic
918631388 1:186723188-186723210 GCACATTTCAAGACAGGAAAAGG + Intergenic
919007750 1:191921509-191921531 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
919099058 1:193071233-193071255 GCCCAGTTCCTAACAGGCCACGG + Intronic
919265051 1:195252099-195252121 GCCCATTTCCTAACAGGCCATGG - Intergenic
919282041 1:195502797-195502819 GCCCAGTTCCTAACAGGCCATGG - Intergenic
919441715 1:197642626-197642648 GCACATTTCTAAATCTGCAAAGG + Intronic
919811540 1:201411943-201411965 GCCCAGTTCCTAACAGGCCACGG + Intronic
920215783 1:204360559-204360581 GCACATTCCTTTACAGATAAGGG + Intronic
920215865 1:204361312-204361334 GCACATTCCTTTACAGATAAGGG - Intronic
921006015 1:211094343-211094365 GCCCAGTTCCTAACAGGCCATGG + Intronic
921151840 1:212408913-212408935 GCCCAGTTCCTAACAGGCCATGG - Intronic
921425263 1:214994008-214994030 GCCCAGTTCTTAACAGGGCATGG - Intergenic
921701400 1:218272540-218272562 GCCCAGTTCCTAACAGGCCATGG - Intergenic
922093669 1:222422448-222422470 GCCCATTTCCTAACAGGCCACGG - Intergenic
922148295 1:222971696-222971718 GCTCATTTGTTAACAGGACAAGG - Intronic
922275242 1:224071441-224071463 GCCCAGTTCCTAACAGGCCATGG - Intergenic
922275340 1:224072404-224072426 GCCCAGTTCCTAACAGGCCATGG + Intergenic
924194136 1:241587351-241587373 GCCCAGTTCCTAACAGGCCATGG + Intronic
924907602 1:248473254-248473276 GCACATGTCTTACCAGAAAAAGG + Intergenic
924916507 1:248574834-248574856 GCACATGTCTTACCAGAAAAAGG - Intergenic
1064089032 10:12367828-12367850 GCCCAGTTCCTAACAGGCCATGG + Intronic
1064323921 10:14331069-14331091 GGACACTGCTTAACAGGAAAAGG + Intronic
1064449811 10:15431638-15431660 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1064688578 10:17890798-17890820 GCTCAGTTCCTAACAGGCCATGG - Intronic
1065138086 10:22692390-22692412 GCCCAGTTCCTAACAGGCCATGG + Intronic
1066124483 10:32326768-32326790 GGACATTTCCTAACAGGTATAGG + Intronic
1066147725 10:32578732-32578754 GCCCAGTTCCTAACAGGCCATGG + Intronic
1067250955 10:44586924-44586946 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1068250037 10:54426509-54426531 GCCCAGTTCCTAACAGGCCACGG + Intronic
1068590724 10:58850277-58850299 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1069358471 10:67614679-67614701 GCCCAGTTCCTAACAGGCCATGG + Intronic
1070222474 10:74463611-74463633 GCCCAGTTCCTAACAGGCCATGG + Intronic
1070353923 10:75620607-75620629 TCACATTGCTTAAAAGGAAAGGG - Intronic
1070407029 10:76106212-76106234 TCACATTTACTAACAGGCATTGG - Intronic
1070691697 10:78531920-78531942 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1073587828 10:104727696-104727718 GCCCAGTTCCTAACAGGCCACGG - Intronic
1073682525 10:105719630-105719652 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1074729039 10:116348909-116348931 GCTTACTTCTTAACAGGCCACGG - Intronic
1075917641 10:126182916-126182938 GCCCAGTTCCTAACAGGCCACGG - Intronic
1076188856 10:128469088-128469110 GCACATTGCTTTACAGACACTGG - Intergenic
1076304407 10:129454264-129454286 ACAGATTTCTTAAAAGGTAATGG + Intergenic
1076314249 10:129529524-129529546 GCCCGTTTCCTAACAGGCCACGG + Intronic
1077236387 11:1483947-1483969 GCACACTGCTTCACAGGCAGGGG + Intronic
1077400839 11:2356123-2356145 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1077559432 11:3249334-3249356 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1077565325 11:3295137-3295159 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1078009585 11:7562185-7562207 GCCCAGTTCCTAACAGGCCATGG + Intronic
1078630741 11:13001473-13001495 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1078826348 11:14934387-14934409 GCCCAGTTCCTAACAGGCCATGG + Intronic
1078849501 11:15151105-15151127 GCCCAGTTCCTAACAGGCTAAGG - Intronic
1079086887 11:17452627-17452649 GCTCAGTTCCTAACAGGCCATGG + Intronic
1079117302 11:17648068-17648090 GCACATTTCTAAATAATCAATGG + Intergenic
1080046101 11:27809892-27809914 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1080122333 11:28692059-28692081 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1080202133 11:29684438-29684460 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1080293507 11:30698523-30698545 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1083396734 11:62397830-62397852 GAACATTTCTTGGCAAGCAATGG - Intergenic
1084899805 11:72301085-72301107 GAAAAATTCCTAACAGGCAAGGG - Intronic
1084984894 11:72860202-72860224 GCTCAGTTCCTAACAGGCCATGG + Intronic
1085556836 11:77430866-77430888 GCCCAGTTCCTAACAGGCCATGG - Intronic
1086286536 11:85258079-85258101 GCACATTGCTTAAAAGGAAGAGG - Intronic
1086472637 11:87131774-87131796 GCCCAGTTCCTAACAGGCCACGG - Intronic
1086890426 11:92252105-92252127 ACACATTTCTTAACAGCTCAAGG - Intergenic
1087672072 11:101119197-101119219 GCCCACTTCCTAACAGGCCATGG + Intronic
1087691203 11:101322087-101322109 CCACATATCTTACTAGGCAAGGG + Intergenic
1087852327 11:103046437-103046459 GCCCATTTCCTAACAGGCCATGG - Intergenic
1088615096 11:111618298-111618320 GCCCGTTTCCTAACAGGCCACGG + Intronic
1092500585 12:9042575-9042597 GCACTTTTCTTCTCAGTCAAAGG + Intergenic
1092766095 12:11854349-11854371 GCCCAGTTCCTAACAGGCCATGG + Intronic
1093340630 12:17968667-17968689 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1095184328 12:39184464-39184486 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1095390026 12:41694966-41694988 GCCCATTTCCTAACAGGCTACGG - Intergenic
1096917598 12:55049980-55050002 GCCCAGTTCCTAACAGGCCAAGG + Intergenic
1097809935 12:64007503-64007525 GCCCAGTTCCTAACAGGCCACGG + Intronic
1099025058 12:77455082-77455104 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1099457316 12:82879534-82879556 GCTCAGTTCCTAACAGGCCATGG + Intronic
1100424386 12:94469788-94469810 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1101129646 12:101675470-101675492 GCACATTTCATCAGAGGTAAAGG + Intronic
1101159247 12:101956542-101956564 GCACAGTTCCTAACAGGCCACGG + Intronic
1101484143 12:105134562-105134584 GAATATTTCTTAACAAGAAAAGG - Intronic
1101658091 12:106742007-106742029 GCCCAGTTCCTAACAGGCCACGG + Intronic
1101734952 12:107456281-107456303 GCCCAGTTCCTAACAGGCCATGG - Intronic
1101807617 12:108078194-108078216 GATCATTTCTGAAAAGGCAAAGG + Intergenic
1101976712 12:109365847-109365869 GCCCAGTTCCTAACAGGCCACGG - Intronic
1102279774 12:111609705-111609727 GCACATTTATTAAATGGTAAAGG + Intergenic
1103046147 12:117736259-117736281 TTACATTTTTGAACAGGCAAGGG - Intronic
1103211115 12:119167159-119167181 GCACAATTTTTAAAAGGCAGTGG + Intergenic
1103455595 12:121062913-121062935 GCACATTTCTTGGCACACAATGG + Intergenic
1104510367 12:129372317-129372339 GCCCAGTTCCTAACAGGCCATGG - Intronic
1104708701 12:130969314-130969336 GCCCAGTTCCTAACAGGCTACGG - Intronic
1105989728 13:25606955-25606977 GCCCAGTTCCTAACAGGCCATGG - Intronic
1106062749 13:26310715-26310737 GCCCAGTTCCTAACAGGCCATGG + Intronic
1106552569 13:30784808-30784830 GGACATTTTTGAACAGGCAGGGG + Intergenic
1107067124 13:36226526-36226548 GCCCAATTCCTAACAGGCCATGG + Intronic
1107338395 13:39380368-39380390 GCCCATTTCCTAACAGACCATGG - Intronic
1107729337 13:43332437-43332459 GCCCAGTTCCTAACAGGCCATGG + Intronic
1108320129 13:49281627-49281649 GCCCAGTTCCTAACAGGCCACGG + Intronic
1108588900 13:51895146-51895168 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1109002918 13:56829664-56829686 GCCCGGTTCCTAACAGGCAATGG - Intergenic
1109856950 13:68142947-68142969 GCACGTATTTTAACAGACAAAGG + Intergenic
1110036840 13:70698001-70698023 CCACATGTCTTTACAGCCAAGGG + Intergenic
1111827066 13:93280971-93280993 GCCCAGTTCCTAATAGGCAACGG + Intronic
1112057848 13:95707263-95707285 GCCCAGTTCCTAACAGGCCATGG + Intronic
1112865518 13:103891805-103891827 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1113158269 13:107350140-107350162 GCCCAGTTCCTAACAGGCCACGG + Intronic
1114691163 14:24583146-24583168 AGACATTTCTTAACAGAAAATGG - Intergenic
1114882659 14:26806128-26806150 GCATAATTCTTAACAGACCAAGG - Intergenic
1115001785 14:28429991-28430013 GCTCAGTTCCTAACAGGCCACGG - Intergenic
1116268248 14:42725012-42725034 GCACATATTTTATCAAGCAATGG - Intergenic
1117401389 14:55361440-55361462 GCATAATTCTTAACAGGCCTAGG + Intronic
1117520662 14:56548384-56548406 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1117559164 14:56918166-56918188 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1117609548 14:57468111-57468133 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1118188007 14:63555016-63555038 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1118762418 14:68888630-68888652 GCCCAGTTCCTAACAGGCCACGG - Intronic
1118838046 14:69490464-69490486 GCCCAGTTCCTAACAGGCCATGG + Intronic
1120191425 14:81443557-81443579 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1122086432 14:99309987-99310009 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1123772513 15:23542666-23542688 GCATTATTCATAACAGGCAAAGG - Intergenic
1123996889 15:25725026-25725048 GCCCAGTTCCTAACAGGCCATGG - Intronic
1124096845 15:26656527-26656549 GCCCAGTTCCTAACAGGCCACGG - Intronic
1124382563 15:29178839-29178861 GAACATTTTTTAAAAGGGAAAGG + Intronic
1124576453 15:30913084-30913106 GCCCAGTTCCTAACAGGCAATGG - Intronic
1125443858 15:39732245-39732267 GCCCAGTTCCTAACAGGCCATGG + Intronic
1126616542 15:50587621-50587643 GGACATTTCTTAATGGGAAAAGG - Intronic
1126721129 15:51581093-51581115 GCCCAGTTCCTAACAGGCCATGG - Intronic
1127011266 15:54632231-54632253 GCACATTTCATATCTGACAAAGG - Exonic
1127014271 15:54665769-54665791 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1127300714 15:57651019-57651041 GCTCATATCTGATCAGGCAATGG - Intronic
1127568227 15:60214462-60214484 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1128483540 15:68061335-68061357 GCACAATTTTTAACATGGAAGGG - Intronic
1131695421 15:94872077-94872099 GCACTATTCATAACAGCCAAAGG - Intergenic
1131933619 15:97475541-97475563 GCCCAGTTCCTAACAGGCCAGGG - Intergenic
1132209253 15:100008126-100008148 CCACGTTTCTTAAGAGGCATTGG - Intronic
1133849027 16:9484640-9484662 CCACATTTCGTGCCAGGCAAGGG - Intergenic
1133863753 16:9621810-9621832 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1135144576 16:19950274-19950296 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1135679273 16:24442965-24442987 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1135693490 16:24565436-24565458 GCCCAGTTCCTAACAGGCCAAGG - Intronic
1138366004 16:56477945-56477967 AAACATTTCTTAACTGGCTAGGG - Exonic
1138459621 16:57140472-57140494 GCCCATTTCATAAGAGGAAATGG - Intronic
1139247096 16:65455747-65455769 CCACAATTTTTAACACGCAATGG - Intergenic
1139777852 16:69328338-69328360 GCCCAATTGTTAACAGGAAAGGG + Exonic
1140534559 16:75697730-75697752 GCCCAGTTCCTAACAGGCCATGG - Intronic
1140679000 16:77365540-77365562 ACACTTTTCATAACTGGCAAAGG + Intronic
1140910710 16:79449272-79449294 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1142822782 17:2485025-2485047 GCACAAGTCCTAACAGGCCAGGG - Intronic
1144523895 17:15973492-15973514 GCCCAGTTCCTAACAGGCCACGG - Intronic
1145850650 17:28092378-28092400 ACACATTTCTTTACAGCAAATGG + Intronic
1146422428 17:32700406-32700428 GCCCAGTTCCTAACAGGCCACGG + Intronic
1148033361 17:44638595-44638617 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1148391872 17:47278661-47278683 GCCCAGTTCCTAACAGGCCATGG - Intronic
1149040992 17:52187881-52187903 GCACAGTTCCTAACAGGCCATGG + Intergenic
1149953540 17:61019111-61019133 GCTCAGTTCCTAACAGGCCAGGG - Intronic
1150006619 17:61473728-61473750 GCCCTTATTTTAACAGGCAAGGG - Intronic
1151737797 17:75955815-75955837 GAACAGTTCTTACCTGGCAAAGG + Exonic
1152107251 17:78337826-78337848 TCTCATTTCTGAACAGGGAAGGG - Intergenic
1152585030 17:81185339-81185361 GCACAGTTCTAAACAGCCTATGG + Intergenic
1153497614 18:5716281-5716303 GGATATTTATTATCAGGCAATGG + Intergenic
1153845207 18:9043184-9043206 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1153867057 18:9280362-9280384 GCCCAGTTCTGAACAGGCCATGG + Intronic
1155261019 18:24042525-24042547 GCCCAGTTCCTAACAGGCCATGG + Intronic
1155401830 18:25447803-25447825 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1155695951 18:28686868-28686890 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1155923217 18:31626520-31626542 GCCCAGTTTTTAACAGGCCATGG - Intronic
1156034100 18:32747661-32747683 GCCCAGTTCCTAACAGGCCATGG + Intronic
1156697670 18:39786687-39786709 GCACATGTCTAGACAAGCAATGG - Intergenic
1157474038 18:48009963-48009985 GCCCACTTCCTAACAGGCCATGG - Intergenic
1157994536 18:52539397-52539419 GCTCAGTTCTTAACATGCCATGG - Intronic
1158142199 18:54267820-54267842 GCATGGTTCTTAACAGGCCAGGG - Intergenic
1159196171 18:65118504-65118526 ACACCTTTATTAACAGGCAAGGG + Intergenic
1159356679 18:67345502-67345524 GCCCATTTCCTAACAGGCCAGGG - Intergenic
1159428976 18:68326319-68326341 ACACAATTCTTGATAGGCAATGG + Intergenic
1159647464 18:70936141-70936163 GCCCAGTTCTTAACAGGCAATGG - Intergenic
1159664241 18:71138297-71138319 GCACATTTGCTAACAGGGCAAGG + Intergenic
1160281338 18:77493655-77493677 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1160609803 18:80076089-80076111 GCCCAGTTCCTAACAGGCCATGG - Intronic
1161570563 19:5028505-5028527 GCACAATTCCCAACAGCCAAAGG - Intronic
1162676809 19:12305347-12305369 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1164693919 19:30229363-30229385 CCACTTTCCTTATCAGGCAAGGG - Intronic
1164888769 19:31805319-31805341 GAACATTTCTAAAGTGGCAAAGG + Intergenic
1164945119 19:32286953-32286975 GCCCATTTCCTAACAGGCCACGG + Intergenic
1166017191 19:39991229-39991251 GCCCAGTTCCTAACAGGCCATGG + Intronic
1166018359 19:40001222-40001244 GCACAGTTCCTAACAGGCCGTGG + Intronic
1166034036 19:40154409-40154431 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1166092872 19:40521661-40521683 GCCCAGTTTTTAACAGGCGATGG + Intronic
1168402750 19:56095266-56095288 GCCCAGTTCCTAACAGGCCACGG + Intronic
925590975 2:5508982-5509004 GCCCAGTTCCTAACAGGCCATGG - Intergenic
926823570 2:16880136-16880158 GCCCAGTTCCTAACAGGCCATGG + Intergenic
926972374 2:18479831-18479853 TCACATTTCCTCACAGGCCAGGG - Intergenic
927064835 2:19460847-19460869 GCACAGTTCCTAACAGGCCATGG - Intergenic
927406172 2:22770511-22770533 GCACACTTCTAAACAGTCAATGG + Intergenic
927803952 2:26128346-26128368 GCCCCGTTCTTAACAGGCCACGG + Intronic
927817619 2:26233182-26233204 GCCCAGTTCCTAACAGGCTATGG + Intronic
928622381 2:33104055-33104077 GCCCTTTTCTTAACTGGAAAGGG + Intronic
929104066 2:38346764-38346786 GCCCAGTTCCTAACAGGCCACGG + Intronic
929239898 2:39643263-39643285 GGACAGTTCCTAACAGGCCACGG - Intergenic
929485629 2:42351636-42351658 GTGCATTTTTTAAAAGGCAAAGG + Intronic
930252996 2:49056898-49056920 GCACATTTCTGAATAATCAATGG + Intronic
930600986 2:53442946-53442968 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
930799322 2:55426156-55426178 GCACAGTTCCTAACAGGCCATGG + Intergenic
931094815 2:58927184-58927206 GCCCAGTTCCTAACAGGCCATGG + Intergenic
931955055 2:67413935-67413957 GCACATTTGTTAACATCTAATGG - Intergenic
932250890 2:70242684-70242706 GCCCAGTTCCTAACAGGCCATGG - Intronic
932540785 2:72650006-72650028 GCCCAGTTCCTAACAGGCTATGG - Intronic
933006118 2:76997726-76997748 GCCCAATTCCTAACAGGCCATGG - Intronic
934885808 2:98023284-98023306 GCCCAGTTCCTAACAGGCCACGG - Intergenic
935108708 2:100072153-100072175 GCCCAGTTCCTAACAGGCCATGG - Intronic
936098342 2:109551971-109551993 GCCCAGTTCCTAACAGGCCATGG - Intronic
937196471 2:120161682-120161704 GCCCAGTTCCTAACAGGCCATGG - Intronic
937836719 2:126478615-126478637 GCCCAGTTCCTAACAGGCCATGG - Intergenic
938409138 2:131049329-131049351 GCAAATGTGTTCACAGGCAATGG - Exonic
938740817 2:134230330-134230352 GCCCAGTTCCTAACAGGCCAAGG + Intronic
939243943 2:139598829-139598851 GCACATGTCTTAAGAGAGAAGGG - Intergenic
940453313 2:153867952-153867974 GCCCAGTTCCTAACAGGCCATGG + Intergenic
940503225 2:154520813-154520835 GCACTGTTCATAACAGCCAAGGG - Intergenic
940680330 2:156777179-156777201 GCACATTTCTAAGCAGCCAGTGG + Intergenic
940969564 2:159880920-159880942 GCCCAATTCTTAACAGGTAATGG + Intronic
941027528 2:160475135-160475157 GCAGATTTTTAAAAAGGCAATGG + Intronic
941075965 2:161007123-161007145 GCTCAGTTCCTAACAGGCCACGG + Intergenic
941398694 2:165003830-165003852 GCCCAGTTCCTAACAGGCCACGG - Intergenic
945149820 2:206778711-206778733 GCCCAGTTCCTAACAGGCCACGG - Intronic
945279564 2:208023466-208023488 GCCCAGTTCCTAACAGGCCATGG - Intronic
945933496 2:215880219-215880241 GCCCAGTTCCTAACAGGCCACGG + Intergenic
946150406 2:217762400-217762422 GCTCAGTTCCTAACAGGCCATGG + Intergenic
946209951 2:218139487-218139509 ACACATATCTTATCAGGCAGGGG + Intergenic
946739820 2:222790468-222790490 GCCCAGTTCCTAACAGGCCATGG + Intergenic
946927055 2:224636478-224636500 GCCCGTTTCCTAACAGGCCACGG - Intergenic
947676245 2:231983419-231983441 GCCCAGTTCCTAACAGGCCACGG - Intronic
948250131 2:236520896-236520918 GCCCAGTTCCTAACAGGCCACGG + Intergenic
948274203 2:236695601-236695623 GCAGATTTCTAAAAGGGCAAAGG + Intergenic
948612597 2:239179316-239179338 GCCCATTTCCTAACAGGCCAGGG - Intronic
1168926569 20:1586519-1586541 GCCCAGTTCATAACAGGCCACGG - Intronic
1169481741 20:5988888-5988910 GCACTTTTATTCACAGCCAAAGG - Intronic
1169527425 20:6445181-6445203 GCCCAGTTCTTAACAGGCCACGG - Intergenic
1170789742 20:19497904-19497926 GCCCAGTTCCTAACAGGCCAGGG - Intronic
1171083710 20:22215855-22215877 TCATATTCCTTGACAGGCAATGG - Intergenic
1171301423 20:24064194-24064216 GCCCAATTCCTAACAGGCCAAGG - Intergenic
1172626679 20:36351300-36351322 GCCCAGTTCCTAACAGGCCACGG - Intronic
1172804927 20:37604895-37604917 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1172850571 20:37960006-37960028 GCTCATTTCCTAACAGGCCATGG - Intergenic
1173466722 20:43288817-43288839 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1173725554 20:45294754-45294776 GCCCAGTTCCTAACAGGCCATGG - Intronic
1173802815 20:45905256-45905278 GCACATCTCTTAAAAGGCATTGG + Intronic
1174290264 20:49503454-49503476 GCCCATTTCTTAATAGGCCAAGG + Intergenic
1174501114 20:50985411-50985433 GCCCATTTATTAAAAGGCACCGG - Intergenic
1177501620 21:21964203-21964225 TCACATTTCTTAGGAGGCATAGG + Intergenic
1177597537 21:23265437-23265459 GCCCATTTCCTAACAGGTCATGG - Intergenic
1179058252 21:37955721-37955743 GTACAGTTCCTAACAGGCCATGG + Intronic
1179385600 21:40938855-40938877 GGAAGTTTCTTAACAGGCATAGG + Intergenic
1179554874 21:42166085-42166107 GCACATTTCAGAAAAGGCCATGG + Intergenic
1179949491 21:44701792-44701814 GCTCAGTTCCTAACAGGCCACGG + Intronic
1180750656 22:18122120-18122142 GCACATTGCTTCACAGCCAGGGG + Intronic
1181480624 22:23196879-23196901 GCCCAGTTCCTAACAGGCCACGG + Intronic
1181624112 22:24111320-24111342 GCCCAGTTCCTAACAGGCCACGG - Intronic
1181972292 22:26700117-26700139 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1184250470 22:43257400-43257422 GCACATTTTTTAACTGAGAAAGG - Intronic
1184591589 22:45487440-45487462 GCCCAGTTCCTAACAGGCCACGG + Intergenic
949361617 3:3238078-3238100 GCCCAGTTCCTAACAGGCCACGG - Intergenic
949514063 3:4791550-4791572 GCCCAGTTCATAACAGGCTATGG + Intronic
950347083 3:12306342-12306364 GCCCAGTTCCTAACAGGCCATGG + Intronic
950511907 3:13434457-13434479 GCACGTTTATTAACATGCATGGG - Intergenic
950761705 3:15235769-15235791 GCCCAGTTCCTAACAGGCCATGG + Intronic
951423812 3:22518957-22518979 GCTCAATTCCTAACAGGCCATGG + Intergenic
952162976 3:30714269-30714291 GCCCAGTTCCTAACAGGCCATGG - Intergenic
952459033 3:33504889-33504911 GCCCAGTTCCTAACAGGCCATGG + Intronic
952643821 3:35631436-35631458 GCCCTGTTCTTAACAGGCCAGGG - Intergenic
952852285 3:37739370-37739392 GCTCATTTCTTTTCAGGCATTGG + Intronic
953501693 3:43442684-43442706 GCAAACTTCTTAAAAGGCCACGG + Intronic
955022238 3:55132605-55132627 GCCCAGTTCCTAACAGGCCACGG - Intergenic
955048040 3:55378192-55378214 GCGCATTACTCAACAGTCAAAGG + Intergenic
955718976 3:61862036-61862058 GCCCAGTTCCTAACAGGCCAGGG - Intronic
955905570 3:63804181-63804203 GCCCAGTTCCTAACAGGCCATGG + Intergenic
956273793 3:67476196-67476218 GCCCAGTTCCTAACAGGCCATGG - Intronic
956695206 3:71912940-71912962 GCCCAGTTCTGAACAGGCCATGG + Intergenic
957553181 3:81733012-81733034 ACACAATTCCTAACAGGCCATGG - Intronic
957752546 3:84440537-84440559 GCCCAGTTCTTAACAGGCTATGG + Intergenic
958261456 3:91386255-91386277 GCCCAATTCCTAACAGGCCACGG - Intergenic
959890904 3:111555121-111555143 CCCCATTCCTTAACAGGCCACGG + Intronic
960301641 3:116009871-116009893 GCAAATTTCTTATCTGGGAAAGG - Intronic
960729010 3:120703328-120703350 ACACATTTCTAAACAGCCTATGG + Intronic
960796283 3:121491825-121491847 GCCCAGTTCCTAACAGGCCATGG - Intronic
963118387 3:141753636-141753658 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
963820930 3:149892538-149892560 GCCCATTTCCTAACAGGTACGGG - Intronic
964499108 3:157328641-157328663 GCACATATCTTAACAGTCCTAGG - Intronic
964737463 3:159931375-159931397 GCCCAGTTCCTAACAGGCCATGG + Intergenic
964764596 3:160167566-160167588 GCCCAGTTCCTAACAGGCCACGG - Intergenic
966813052 3:183865433-183865455 GCCCAGTTCCTAACAGGCCACGG - Intronic
969120869 4:4910114-4910136 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
969544740 4:7818312-7818334 GCAGATTTCTTAGAAGGCATTGG - Intronic
969739639 4:9014992-9015014 GCACAGTTGTCAACAGGAAAGGG + Intergenic
970700104 4:18726544-18726566 GCACATTCCTGAACAGCTAATGG + Intergenic
970900458 4:21152686-21152708 GCCCAGTTCCTAACAGGCCACGG - Intronic
971743874 4:30553580-30553602 GCCCAGTTCCTAACAGGCCATGG - Intergenic
971870413 4:32229124-32229146 GCATATTTCTTTAGAGGTAAGGG - Intergenic
971917400 4:32890759-32890781 GCCCAGTTCCTAACAGGCCATGG + Intergenic
972556462 4:40186520-40186542 GCCCAGTTCCTAACAGGCCACGG + Intergenic
973307420 4:48668440-48668462 GCACATTGCTCAGTAGGCAATGG - Intronic
974035352 4:56813442-56813464 GCCCAGTTCCTAACAGGCCATGG - Intronic
974488507 4:62534187-62534209 GCCCAGTTCCTAACAGGCCATGG - Intergenic
974677415 4:65111466-65111488 GCATATTTGTTAACTGGTAAGGG - Intergenic
974747594 4:66095362-66095384 GCACATTTTTTCAGAGCCAAAGG - Intergenic
975249326 4:72159863-72159885 GCCCAGTTCCTAACAGGCCACGG - Intergenic
976165262 4:82247781-82247803 GCCCAATTCCTAACAGGCCATGG - Intergenic
976566872 4:86561219-86561241 GCCCAGTTCTTAACAGGCCATGG + Intronic
976705498 4:88015198-88015220 GCCCAGTTCCTAACAGGCCATGG - Intronic
977173348 4:93789854-93789876 GCCCAGTTCCTAACAGGCCATGG - Intergenic
977817503 4:101431880-101431902 GCCCAGTTCCTAACAGGCCATGG + Intronic
978055826 4:104264837-104264859 GCCCAGTTCCTAACAGGCCATGG - Intergenic
978471661 4:109074245-109074267 GCCCAGTTCCTAACAGGCCAAGG + Intronic
978479675 4:109174841-109174863 GCCCAGTTCCTAACAGGCCATGG - Intronic
978664532 4:111166454-111166476 GCACATTACATAACAGTAAAGGG + Intergenic
978671010 4:111247131-111247153 GCCCAGTTCCTAACAGGCCATGG - Intergenic
979114963 4:116812044-116812066 GCCCATTTCCTAACAGGCCAGGG - Intergenic
979598131 4:122556852-122556874 GCAGAGTTCCTAACAGGCCACGG + Intergenic
979977769 4:127218262-127218284 GCCCAGTTCCTAACAGGCCACGG - Intergenic
980280904 4:130718245-130718267 GCCCAGTTCCTAACAGGCTATGG + Intergenic
980394766 4:132197363-132197385 GAACATTTCTGAACAAGTAAAGG - Intergenic
980711362 4:136572928-136572950 GCCCAGTTCCTAACAGGCAAGGG - Intergenic
981088652 4:140709935-140709957 GCCCAGTTCCTAACAGGCCACGG + Intronic
981527682 4:145722689-145722711 GCCCACTTCCTAACAGGCCATGG - Intronic
982560035 4:156918485-156918507 GCCCAGTTCCTAACAGGCCAAGG - Intronic
982719185 4:158841598-158841620 GCACAATTCCATACAGGCAAAGG + Intronic
983071235 4:163270211-163270233 GTACCTTTCTTGCCAGGCAAGGG + Intergenic
983420442 4:167508896-167508918 GCCCAGTTCCTAACAGGCCATGG - Intergenic
983439780 4:167766561-167766583 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
983479960 4:168260738-168260760 GCACAATTCCTAACAGACCATGG + Intronic
986112270 5:4731054-4731076 GCCCAGTTCCTAACAGGCCATGG - Intergenic
988144697 5:27291252-27291274 GCCCAGTTCCTAACAGGCCACGG - Intergenic
988315794 5:29625855-29625877 CCATAGATCTTAACAGGCAAAGG - Intergenic
988452504 5:31357352-31357374 GCCCAGTTCCTAACAGGCCATGG + Intergenic
988584384 5:32496034-32496056 GCACATTTCTGTACAGAGAAGGG - Intergenic
988641768 5:33048558-33048580 GCCCAGTTCCTAACAGGCCACGG + Intergenic
989091805 5:37741691-37741713 GCTCAGTTCCTAACAGGCCATGG + Intronic
990152584 5:52836258-52836280 GCACATCTCTGAAGAGGCAATGG + Intronic
990443163 5:55866605-55866627 GCCCAGTTCCTAACAGGCCATGG + Intronic
991230689 5:64329902-64329924 GCCCAGTTCCTAACAGGCCATGG + Intronic
991286499 5:64982828-64982850 GCTCAGTTCCTAACAGGCCATGG - Intronic
991316209 5:65309549-65309571 GCCCAGTTCCTAACAGGCCATGG + Intronic
991444649 5:66686057-66686079 GCTCACTTCCTAACAGGCCACGG + Intronic
991575554 5:68099629-68099651 GCACAGTTCCTAACAGGCCACGG + Intergenic
991735394 5:69627278-69627300 GCAGTTTTTTTAAGAGGCAAAGG - Intergenic
991779525 5:70118905-70118927 GCAGTTTTTTTAAGAGGCAAAGG + Intergenic
991811882 5:70482913-70482935 GCAGTTTTTTTAAGAGGCAAAGG - Intergenic
991858817 5:70994378-70994400 GCAGTTTTTTTAAGAGGCAAAGG + Intronic
991871977 5:71119262-71119284 GCAGTTTTTTTAAGAGGCAAAGG + Intergenic
992227077 5:74629369-74629391 ACAAACTTCTTAACAGCCAAGGG + Exonic
993467357 5:88265555-88265577 GCCCAGTTCCTAACAGGCCATGG + Intronic
993923061 5:93831163-93831185 GCCCAGTTCCTAACAGGCCATGG + Intronic
994323638 5:98423193-98423215 GCCCAGTTCCTAACAGGCCACGG + Intergenic
994643495 5:102440258-102440280 GCTTGTTTCCTAACAGGCAATGG - Intronic
994740933 5:103618126-103618148 GCACTTTTCTTACCAGACCAGGG + Intergenic
995563634 5:113410176-113410198 CCATATTTCTTAACACGGAAAGG - Intronic
996859902 5:128053490-128053512 GCCCAGTTCCTAACAGGCCATGG + Intergenic
997150672 5:131491556-131491578 GCCCAGTTCCTAACAGGCCATGG - Intronic
997575011 5:134968107-134968129 GCACATTTCTTAACAGGCAATGG - Exonic
997898418 5:137740910-137740932 TCCCAATTCTTAACAGGCCATGG + Intergenic
998008142 5:138671220-138671242 GCCCAGTTCCTAACAGGCCAGGG + Intronic
998737362 5:145157781-145157803 GCACATGAGTTATCAGGCAAAGG - Intergenic
998915842 5:147010716-147010738 GCCCAGTTCTTAACAGGCCACGG + Intronic
1003035672 6:2638656-2638678 CCACCTTTCTTAGAAGGCAAAGG - Intergenic
1004033141 6:11892747-11892769 GTACATTTCTTAACTTACAATGG + Intergenic
1004444439 6:15685148-15685170 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1004523211 6:16381683-16381705 GCACCTGTCTTAACTTGCAATGG - Intronic
1004597550 6:17114767-17114789 GCCCAGTTCCTAACAGGCCACGG + Intronic
1004645651 6:17558408-17558430 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1005660529 6:27994264-27994286 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1005932759 6:30496186-30496208 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1009051432 6:58281491-58281513 ACACATTTCTTAAAAACCAATGG + Intergenic
1009052236 6:58290051-58290073 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1009482167 6:64172650-64172672 GCTCATTTCCTAACAGGTCATGG + Intronic
1009517781 6:64641697-64641719 GCCCAGTTCCTAACAGGCCATGG - Intronic
1010274639 6:73955288-73955310 GCATTTTGCTTAACAAGCAAGGG - Intergenic
1011570641 6:88730653-88730675 GCCCAGTTCCTAACAGGCCATGG + Intronic
1012483056 6:99689595-99689617 GGACATTTCTAGACAGGAAATGG + Intergenic
1013227099 6:108127739-108127761 GCCCAGTTCCTAACAGGCCATGG + Intronic
1013547541 6:111173479-111173501 GCCCAATTCCTAACAGGCCATGG - Intronic
1014010476 6:116469785-116469807 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1014541009 6:122676387-122676409 GCCCAGTTCCTAACAGGCCATGG + Intronic
1015201223 6:130583519-130583541 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1015973898 6:138769862-138769884 GCCCAGTTCCTAACAGGCCACGG + Intronic
1016025886 6:139286587-139286609 GCCCAGTTCCTAACAGGCCACGG - Intronic
1017444311 6:154493536-154493558 GCACTTTAGTTAACAGGCAATGG + Intronic
1018211502 6:161487130-161487152 GCACAGTGTTTATCAGGCAATGG - Intronic
1018329107 6:162708841-162708863 GCCCAGTTCCTAACAGGCCACGG - Intronic
1018977590 6:168577041-168577063 GCATAGTTTTCAACAGGCAAGGG - Intronic
1020663343 7:11008371-11008393 GCCCAGTTCCTAACAGGCCAAGG - Intronic
1021109709 7:16679583-16679605 CCACCTTTCTTAGCAGGCATAGG - Intronic
1022192455 7:28029891-28029913 ACACATTTCTTGAAAGTCAAGGG + Intronic
1022293007 7:29022126-29022148 GCACATATCTTAACAGGGCCTGG + Intronic
1023742574 7:43293807-43293829 GCCCAGTTTTTAACAGGCCATGG - Intronic
1023941363 7:44770331-44770353 ACACACTTTTTAACAGCCAAAGG + Intergenic
1024281599 7:47723567-47723589 GCCCAGTTCTTAACAGGCCATGG - Intronic
1024725360 7:52188812-52188834 GCACATTCATTTACAGGGAAGGG - Intergenic
1026024737 7:66735420-66735442 ACACATTTATTAAGAGGCAAAGG - Intronic
1026367028 7:69658950-69658972 GCATATTCCTTAACAGTCAATGG - Intronic
1026426885 7:70303697-70303719 GCTCATTTCTTAAAGGGAAATGG - Intronic
1026893116 7:73994318-73994340 ACACATTTATTAAGAGGCAAAGG - Intergenic
1028057213 7:86261293-86261315 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1028327841 7:89549067-89549089 TAACATTTAATAACAGGCAAAGG - Intergenic
1029355508 7:100048946-100048968 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1029491036 7:100870274-100870296 GCCCAGTTCCTAACAGGCCATGG + Intronic
1030182110 7:106721038-106721060 GCTCATTTCCTAACAGGCCATGG - Intergenic
1030199183 7:106885110-106885132 GCCCAGTTCCTAACAGGCCATGG + Intronic
1030282647 7:107792648-107792670 GCCCAGTTCTTAACAGGCCACGG + Intronic
1030291890 7:107880959-107880981 GCCCAGTTCCTAACAGGCCAAGG + Intergenic
1030300195 7:107966819-107966841 GCACAATTCTAAACAAGGAATGG + Intronic
1030399820 7:109034361-109034383 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1030613756 7:111716618-111716640 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
1030702080 7:112651566-112651588 ACACATTTCTGAACAACCAATGG + Intergenic
1030845183 7:114400781-114400803 GCCCAGTTCCTAACAGGCCATGG + Intronic
1030937513 7:115603623-115603645 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1031135802 7:117882784-117882806 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1031574753 7:123401527-123401549 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1032247145 7:130222694-130222716 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1032587838 7:133164032-133164054 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1032654808 7:133916308-133916330 GCCCAGTTCCTAACAGGCCATGG + Intronic
1033135454 7:138780426-138780448 GCCCAGTTCCTAACAGGCCATGG + Intronic
1033340114 7:140485347-140485369 ACACATTTATTAACATGCACGGG - Intergenic
1033878351 7:145850783-145850805 GCCCTTTTCCTGACAGGCAATGG - Intergenic
1034518353 7:151599772-151599794 GCCCATTTCCTAACAGGCCAGGG + Intronic
1036110067 8:5888762-5888784 GCACATTTTTTATTAGGGAATGG - Intergenic
1037498669 8:19464567-19464589 GCACAGTTCTGAACAGGCCACGG - Intronic
1037923346 8:22824898-22824920 GCCCAGTTCCTAACAGGCCATGG + Intronic
1038745900 8:30254495-30254517 GCCCAGTTCTTAACAGGCCATGG + Intergenic
1039618830 8:38978202-38978224 GCCCAGTTCCTAACAGGCCATGG - Intronic
1040948325 8:52908805-52908827 GAACATTTCTACACAGGCAAGGG + Intergenic
1041333620 8:56755192-56755214 GCTCAGTTCCTAACAGGCCAAGG + Intergenic
1041944834 8:63429102-63429124 GCAAATTTATAAACAGGAAAAGG + Intergenic
1044014108 8:87029870-87029892 GTACATTTCCTAAAATGCAAAGG + Intronic
1044395790 8:91709892-91709914 GCACATTTCTAAACAGCCCATGG + Intergenic
1044442106 8:92234996-92235018 GCAAGCTCCTTAACAGGCAAGGG + Intergenic
1045078139 8:98593489-98593511 GCCCAGTTCATAACAGGCCAAGG - Intronic
1045140911 8:99281272-99281294 GCCCAGTTCCTAACAGGCCACGG + Intronic
1045531479 8:102989208-102989230 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1046313496 8:112469736-112469758 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1046349296 8:112985572-112985594 GCCCAGTTCCTAACAGGCGAAGG - Intronic
1047662534 8:127053095-127053117 GCACATTTCCTGATATGCAAAGG + Intergenic
1048098228 8:131317825-131317847 CCATGTTTCTTAACAGGAAAGGG + Intergenic
1048258468 8:132924324-132924346 GCCCAGTTCCTAACAGGCCATGG + Intronic
1048434309 8:134401752-134401774 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1048587028 8:135783610-135783632 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1048724218 8:137363310-137363332 ACACAGTTCCTAACAGGCCACGG + Intergenic
1049125678 8:140785357-140785379 GAACATGTCTTTACATGCAATGG + Intronic
1050164153 9:2746821-2746843 GCCCAGTTCATAACAGGCCATGG - Intronic
1050424098 9:5496235-5496257 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1051332068 9:16033270-16033292 GCCCATTTCCTAACGGGCCACGG - Intronic
1051831908 9:21288715-21288737 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1052699463 9:31920566-31920588 GCCCACTTCCTAACAGGCCATGG - Intergenic
1053136690 9:35655316-35655338 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1053201728 9:36156616-36156638 GCCCAGTTCTTAACAGGCCATGG - Intronic
1055354930 9:75428064-75428086 GCCCAGTTCCTAACAGGCTAAGG - Intergenic
1055965413 9:81860924-81860946 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1056260843 9:84846882-84846904 GCTCATTTCTTCATAGGCATGGG + Intronic
1056670666 9:88625263-88625285 GCACATTTGTTATCAGGCCAAGG - Intergenic
1056833093 9:89932298-89932320 GCCCATTTCCAAAAAGGCAAAGG + Intergenic
1057062772 9:92020283-92020305 GCACAGATCCTAACAGGCCAGGG - Intergenic
1057562528 9:96139740-96139762 ACACATTACTTAACAGAAAATGG - Intergenic
1057774247 9:97993063-97993085 GCCCATTTCTTATCAGAAAAGGG + Intronic
1058000126 9:99856488-99856510 GCCCAGTTCCTAACAGGCCATGG + Intronic
1058155579 9:101511277-101511299 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1058168020 9:101642613-101642635 GGCCAGTTCTTAACAGGCCATGG - Intronic
1059018959 9:110552749-110552771 GCCCAGTTCCTAACAGGCCATGG + Intronic
1059051594 9:110932592-110932614 GCCCGATTCTTAACAGGCTATGG - Intronic
1059601226 9:115781600-115781622 GCAAGTCTCTTACCAGGCAAGGG - Intergenic
1059996242 9:119913158-119913180 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1060576591 9:124701337-124701359 GAACATTTCATCACATGCAAAGG - Intronic
1062516058 9:136936942-136936964 ACACAATTCTTAAAAGGCACTGG - Intronic
1185840925 X:3390527-3390549 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1185920292 X:4083949-4083971 ACACATTTATTAACAAGCATGGG + Intergenic
1186577416 X:10781007-10781029 GCCCAGTTCCTAACAGGCCATGG + Intronic
1187013902 X:15307596-15307618 GCCCAGTTCCTAACAGGCCATGG + Intronic
1189344231 X:40228387-40228409 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1189749855 X:44209688-44209710 GCCCAGTTCCTAACAGGCCACGG - Intronic
1190813417 X:53906973-53906995 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1192365787 X:70472003-70472025 GCACTTCTCTTACTAGGCAATGG - Intronic
1192556525 X:72094380-72094402 GCACATTTCAAAACATGCAGGGG + Intergenic
1194592443 X:95815889-95815911 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1195892136 X:109707571-109707593 GCACAGCTCCTAACAGGCCATGG + Intronic
1197840849 X:130744806-130744828 GCCCAGTTCCTAACAGGCCACGG - Intronic
1200738929 Y:6832023-6832045 GCACATTTTTTAAGAGATAAGGG - Intergenic
1201326447 Y:12765468-12765490 GCCCAGTTCTTAACAGGCCAGGG - Intronic
1202095465 Y:21244652-21244674 GCAGATTTCCTAGCAGGCAGAGG + Intergenic