ID: 997575014

View in Genome Browser
Species Human (GRCh38)
Location 5:134968124-134968146
Sequence ATGTGCTAGTAGAAGTGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997575011_997575014 -6 Left 997575011 5:134968107-134968129 CCATTGCCTGTTAAGAAATGTGC 0: 1
1: 0
2: 2
3: 48
4: 478
Right 997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997575014 Original CRISPR ATGTGCTAGTAGAAGTGTGA GGG Exonic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
905931451 1:41790816-41790838 ATATGCTAGGACAAGTGTTAGGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG + Intronic
908920349 1:69183545-69183567 TTGTGATAGTAGGTGTGTGATGG + Intergenic
909062905 1:70899678-70899700 TTATGCTAGTAGTTGTGTGAAGG + Intronic
911562575 1:99424452-99424474 ATGTTTTAGTAGAAATGTCATGG - Intergenic
912241198 1:107911115-107911137 ATGTGCTATTAGAAGTTGGGAGG - Intronic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG + Intergenic
922251582 1:223853943-223853965 ATGTGCTAGAGGAAGCATGAAGG - Intergenic
922365594 1:224860530-224860552 CTTTGTTAGTATAAGTGTGATGG - Intergenic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1070097627 10:73353340-73353362 ATGTGTTAGTGGAAGTGTGCAGG - Intronic
1071901690 10:90127394-90127416 ATGAGCTAGTAGAGGAGAGAAGG - Intergenic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG + Intronic
1081126154 11:39325137-39325159 TTGGGCTACTAGAAGTGTGTTGG - Intergenic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1091644498 12:2263532-2263554 CGGTGTTGGTAGAAGTGTGACGG + Intronic
1093532741 12:20186724-20186746 ATTTGGTAGTAGAAGACTGAGGG - Intergenic
1093859039 12:24140912-24140934 ATGTGCTATTTGGAGTGTTAGGG - Intergenic
1093886273 12:24465069-24465091 ATGTGCCAGTAATTGTGTGAAGG + Intergenic
1094285749 12:28791426-28791448 ATGTCCTAGTTCAAGTCTGAAGG - Intergenic
1096551473 12:52376333-52376355 ATGTCCCAGCAGAGGTGTGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1099635802 12:85209434-85209456 ATATGGTAGTAGAAATCTGATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101548486 12:105739439-105739461 ATGGACCAGTGGAAGTGTGATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107310316 13:39070419-39070441 ATGTGCAAGTGGAAATGTCAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1115963400 14:38861702-38861724 ACGAGCTAGTACAATTGTGATGG + Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG + Intergenic
1126883092 15:53120195-53120217 CTGTGCCACTAGAAGTGTGTAGG - Intergenic
1134908680 16:18004540-18004562 ATATTCCAGCAGAAGTGTGAGGG + Intergenic
1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG + Intronic
1138140555 16:54564799-54564821 ATGAGCTGGTGGAAATGTGAAGG - Intergenic
1140812664 16:78593397-78593419 ATGGGATAGTACAAGGGTGATGG - Intronic
1142436589 16:90062871-90062893 ATGTACTAGTTGACATGTGATGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1168049695 19:53819990-53820012 GTGTGCCAGTAGTAGTGTGCTGG - Intronic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
936382405 2:111998072-111998094 ATGTTCTAGTAGCATTCTGAAGG - Intronic
938539743 2:132276073-132276095 ATGTGACAGGAGAAGTGTCAAGG + Intergenic
939647245 2:144715810-144715832 ATGTTCCAGGAGAAGAGTGAGGG - Intergenic
939833115 2:147096258-147096280 ATGTGATAGATGAACTGTGATGG - Intergenic
943722241 2:191217263-191217285 ATGTACTAGTAGATGTGAAAGGG - Intergenic
1168734328 20:116787-116809 ACCTGCTGGTAGAAGTGTGTAGG + Intergenic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1179068254 21:38046793-38046815 AGGTTCTATAAGAAGTGTGATGG + Intronic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
949539142 3:5018617-5018639 GTGTTCTAGTAGAGGGGTGAAGG + Intergenic
949743557 3:7263711-7263733 TCGTGCTGGTAGCAGTGTGACGG + Intronic
950613878 3:14143944-14143966 ATGTGCTAGAAAAAGTGGAAGGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952093754 3:29923305-29923327 ATGTGCTAGTTTATCTGTGATGG - Intronic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962265163 3:133939517-133939539 GTTTGCTAGCAGAACTGTGATGG - Intronic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG + Intergenic
964912431 3:161799547-161799569 ATAGTCTAGTAGAAGTGGGAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG + Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
972889084 4:43532859-43532881 CTTTTCTAGTAGAAATGTGATGG + Intergenic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
979130268 4:117036118-117036140 GTGAGCTAGTAGAAGAGTAATGG + Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
987885102 5:23802331-23802353 ATTTGCTAGTAGAAATGGAAGGG - Intergenic
988459652 5:31422547-31422569 AAGTTTTAGGAGAAGTGTGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990490693 5:56300186-56300208 ATGTGCGAGTATGGGTGTGAGGG + Intergenic
992879979 5:81098150-81098172 ATGTGAGAGTAAAAGGGTGAAGG + Intronic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997258203 5:132445386-132445408 GTGTGGTAGTAGCAGTGTGGAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004506189 6:16248779-16248801 ATGTGTTAGTATAAAAGTGAGGG + Intronic
1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG + Intergenic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG + Intergenic
1013572552 6:111444114-111444136 ATCTGCCAGTAGATGTTTGAAGG - Intronic
1013706593 6:112842349-112842371 ACATGCTAGTAGAAGAGTCAGGG - Intergenic
1013952601 6:115802699-115802721 ATGAGCTAGTGGAAGAGTAATGG + Intergenic
1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG + Exonic
1014769699 6:125446612-125446634 ATTAGCAAGTAGGAGTGTGATGG - Intergenic
1016684178 6:146862947-146862969 ATACACTAGTAGAAGTTTGATGG - Intergenic
1024388291 7:48778674-48778696 ATGTTTTAGTACAAGTCTGAAGG + Intergenic
1026176647 7:68003423-68003445 ATGTAATAGTAATAGTGTGATGG - Intergenic
1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1033142583 7:138840724-138840746 ATGGGCTGGTAGAAGTGCGCAGG - Intronic
1042227575 8:66525920-66525942 ATGTACTAGAAGAAGTGAGCTGG + Intergenic
1045158883 8:99513381-99513403 ATGTGATATTAGAGGTGAGAGGG + Intronic
1045982979 8:108213755-108213777 AAGTGCTAATAAAACTGTGAAGG + Intronic
1048183423 8:132216850-132216872 ATGGGCAAGAAGAAGTGTGCTGG + Intronic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG + Intronic
1059416697 9:114166957-114166979 ATCTGCTATCAGAAGGGTGATGG - Intronic
1203370351 Un_KI270442v1:297900-297922 ATGGCCTAGTAGATCTGTGAGGG - Intergenic
1186225524 X:7395267-7395289 CTTTGCTAGTAGAAAAGTGAAGG - Intergenic
1188221495 X:27546558-27546580 ATGTCCTGGTAGAAGTCTGCTGG - Intergenic
1189723291 X:43942749-43942771 ATGTTCTGGTAGTAGTCTGATGG - Intergenic
1189746614 X:44174819-44174841 ATTTGCTAGCAGCCGTGTGAGGG - Intronic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1195842329 X:109187851-109187873 AGGTGGTAGTAGTAGTGTGTAGG - Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199081597 X:143582890-143582912 ATTTGCCAGTAGAAGTGAAATGG + Intergenic