ID: 997575639

View in Genome Browser
Species Human (GRCh38)
Location 5:134974845-134974867
Sequence TGTTAGGTATAGGACTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997575632_997575639 16 Left 997575632 5:134974806-134974828 CCACAAATCCAGAGATTGGTTAT 0: 1
1: 0
2: 0
3: 17
4: 151
Right 997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 79
997575634_997575639 8 Left 997575634 5:134974814-134974836 CCAGAGATTGGTTATGGACTGTG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 79
997575630_997575639 21 Left 997575630 5:134974801-134974823 CCACACCACAAATCCAGAGATTG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997575639 Original CRISPR TGTTAGGTATAGGACTTGGC AGG Intronic
907806286 1:57823665-57823687 TGTTGGGTAGATGACTTGCCAGG + Intronic
909503589 1:76362671-76362693 TGTTGGGTTTAGGACTTGCCTGG - Intronic
913531943 1:119739785-119739807 AGTTATGTCTAGGACCTGGCTGG - Intronic
916023045 1:160810949-160810971 TGTTAGGTTTTGGACTTGTTTGG - Intronic
916384908 1:164256080-164256102 TGCTAGGTTTTGGACTTGGATGG + Intergenic
917138887 1:171814867-171814889 GTTTAGGCAGAGGACTTGGCTGG + Intergenic
1070036174 10:72726839-72726861 TGTTAGTTATAGGATTTTTCTGG + Intronic
1072728567 10:97829748-97829770 TGGTAGGTATGGGACCTGGGAGG - Intergenic
1072910938 10:99500081-99500103 TGGTAGGTAAAGGCCATGGCAGG - Intergenic
1085117429 11:73942182-73942204 TGGCAGGTGTAAGACTTGGCAGG + Intergenic
1085928377 11:81050871-81050893 TGTTATATTTAGGACTTGGATGG + Intergenic
1086160350 11:83715482-83715504 TGTCAGGTATAGGCCTCAGCTGG - Intronic
1086258692 11:84911884-84911906 TATTACGTAGAGGTCTTGGCTGG + Intronic
1089120389 11:116130325-116130347 TGCAGGCTATAGGACTTGGCTGG + Intergenic
1089187493 11:116629375-116629397 TGCTGGGTTTTGGACTTGGCTGG - Intergenic
1096116371 12:49057893-49057915 TCTTAGGTATAGGACTGAGGGGG - Intronic
1096374725 12:51099187-51099209 TGTTAAGAATAGTACCTGGCTGG + Intronic
1105590134 13:21785169-21785191 TGCTGGGCACAGGACTTGGCAGG + Intergenic
1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG + Intronic
1111461955 13:88556720-88556742 TGCTAGGTTTTGGACTTGGTTGG - Intergenic
1111807784 13:93059442-93059464 TGTTAGAGGTAGGACCTGGCAGG + Intergenic
1114873995 14:26692694-26692716 TGTTACCCATAGGACTAGGCAGG + Intergenic
1118787272 14:69056297-69056319 TGTTAGCTATAGGAGTAGGTAGG + Intronic
1120257980 14:82143121-82143143 TGTTGGGTAAAGGACCTGGAAGG + Intergenic
1121025454 14:90612816-90612838 AGTTGGCTATAGGAATTGGCTGG - Intronic
1126710539 15:51450676-51450698 TGTACGGTACAGCACTTGGCTGG - Intronic
1130642437 15:85691298-85691320 TGTTTGGCAGAGTACTTGGCTGG - Intronic
1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG + Intergenic
1138499285 16:57429116-57429138 TGTGAGGGACAGGAGTTGGCTGG + Exonic
1139072269 16:63397226-63397248 TGTTGGGAATTGGACTTGGAGGG + Intergenic
1141963614 16:87426177-87426199 GGTGAGGTAGAGGGCTTGGCTGG - Intronic
1142281526 16:89150671-89150693 TGTGAGGGACAGGACTGGGCAGG + Intronic
1143626222 17:8111588-8111610 TGATAAGCAAAGGACTTGGCAGG - Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1162778211 19:12992785-12992807 TGCTTGGTATAGGACCGGGCAGG + Intergenic
1168038690 19:53740660-53740682 TTTTAAGTATAGGACAAGGCTGG + Intergenic
925069202 2:952825-952847 TGTTAAGTATTGGTGTTGGCAGG + Intronic
926156628 2:10458488-10458510 TGTTGGATATAGGATTTTGCAGG + Intergenic
926924791 2:17976598-17976620 TGTTAGAGATAGGGCTTGGTAGG - Intronic
932279381 2:70476512-70476534 TGTTAGGTAAAGTGGTTGGCAGG + Intronic
934093693 2:88578161-88578183 TGGTAGGTACAGGAATTGGATGG - Intronic
938260115 2:129889541-129889563 TGCTAGGTTTTGGACTTGCCTGG - Intergenic
946037301 2:216754387-216754409 TGTTGGTGATAGGACTTGGTGGG + Intergenic
952114852 3:30166514-30166536 TTTTGGGTTTTGGACTTGGCGGG + Intergenic
958475024 3:94569412-94569434 TGTTAGGTTTTGGACTTGCATGG + Intergenic
959022499 3:101203586-101203608 TGCTAGAAATATGACTTGGCGGG + Intergenic
961985192 3:131124502-131124524 TGTTAGGTAAAGGAAGTGGGGGG - Intronic
962165880 3:133047358-133047380 TGTCAGAAATAGCACTTGGCTGG + Intronic
972429308 4:38965018-38965040 TGTTGGGTAAAGCACTAGGCCGG - Intergenic
977201712 4:94123995-94124017 TCTTAGGTTTAAGATTTGGCCGG - Intergenic
986221126 5:5770053-5770075 TGTTAGCTCTAGGAATTGCCTGG - Intergenic
992387203 5:76296171-76296193 TATTAGGTAGTGGACTTGACTGG + Intronic
995626879 5:114089335-114089357 TCTTAGGAATAGGACTAAGCCGG - Intergenic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
995735693 5:115296970-115296992 TGACAGGTATGGGACTGGGCTGG - Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
997888017 5:137648724-137648746 TCTCAGGGAAAGGACTTGGCTGG + Intronic
999713538 5:154340152-154340174 TGATGGGAATAGGACTTGGCTGG - Intronic
1009527258 6:64763502-64763524 TGTTGGGGAAAGGACTTGGTGGG - Intronic
1011080955 6:83489813-83489835 TGCTAGGTTTTGGACTTGCCTGG - Intergenic
1014918650 6:127185152-127185174 GGTTACATATAGGACTTGGAGGG - Intronic
1014961737 6:127695146-127695168 TGGTAGGTTTTGGACTTGCCTGG - Intergenic
1018276095 6:162133180-162133202 TGATAGGAATAGGACTGGGCAGG + Intronic
1018692312 6:166356920-166356942 TGTTAGGTACAGGAGGTGGGAGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1032326424 7:130933243-130933265 TGTCAGGTAGTGTACTTGGCAGG + Intergenic
1035387457 7:158483839-158483861 TTTAAAGTATAGGAGTTGGCCGG + Intronic
1038006085 8:23431616-23431638 GGTTAGGAAGAGGACTCGGCAGG + Exonic
1039462340 8:37755579-37755601 AGATGGGTATAGGAGTTGGCGGG - Exonic
1040296901 8:46154548-46154570 TTTTATCTATAGGCCTTGGCGGG + Intergenic
1041841133 8:62272755-62272777 TGTTATTTATACCACTTGGCAGG - Intronic
1045182817 8:99804445-99804467 TGTTTGGTATAGTAATTGCCTGG + Intronic
1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG + Intergenic
1048623841 8:136163327-136163349 TGTTAGGTAGAGGGGTTGGCAGG - Intergenic
1048897054 8:139001533-139001555 TGCTGGGAAAAGGACTTGGCTGG + Intergenic
1050652899 9:7792089-7792111 TGTTAGGGAGTGGACTTGACTGG + Intergenic
1051487610 9:17625731-17625753 GCTTAGGTACAGGAATTGGCAGG + Intronic
1057087367 9:92224028-92224050 TGGTAGGTATGAGACTAGGCTGG + Intronic
1186498369 X:10031032-10031054 TGTTAAGAATAGAAGTTGGCTGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188519335 X:31020460-31020482 TGTTAGGTTTTGGACTTGCTTGG + Intergenic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1193813312 X:86077122-86077144 GGTTTGGTATATGAATTGGCTGG - Intergenic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1195849735 X:109270305-109270327 AGGTAGGTCTGGGACTTGGCTGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic