ID: 997579139 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:135006218-135006240 |
| Sequence | GGACCCATGACAGCTAGAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 997579139_997579143 | -6 | Left | 997579139 | 5:135006218-135006240 | CCAACTCTAGCTGTCATGGGTCC | No data | ||
| Right | 997579143 | 5:135006235-135006257 | GGGTCCTTTATGGGGCTCCCAGG | 0: 1 1: 0 2: 0 3: 10 4: 117 |
||||
| 997579139_997579147 | 29 | Left | 997579139 | 5:135006218-135006240 | CCAACTCTAGCTGTCATGGGTCC | No data | ||
| Right | 997579147 | 5:135006270-135006292 | TTCCTCCACTGCTGCTCTAAAGG | 0: 1 1: 0 2: 2 3: 21 4: 148 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 997579139 | Original CRISPR | GGACCCATGACAGCTAGAGT TGG (reversed) | Intronic | ||