ID: 997579139

View in Genome Browser
Species Human (GRCh38)
Location 5:135006218-135006240
Sequence GGACCCATGACAGCTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997579139_997579143 -6 Left 997579139 5:135006218-135006240 CCAACTCTAGCTGTCATGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 997579143 5:135006235-135006257 GGGTCCTTTATGGGGCTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997579139_997579147 29 Left 997579139 5:135006218-135006240 CCAACTCTAGCTGTCATGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 997579147 5:135006270-135006292 TTCCTCCACTGCTGCTCTAAAGG 0: 1
1: 0
2: 2
3: 21
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997579139 Original CRISPR GGACCCATGACAGCTAGAGT TGG (reversed) Intronic
900305260 1:2003697-2003719 GGACCCAGGCCAGCCAGAGGTGG - Exonic
906422261 1:45679481-45679503 GGACCCCTGGCAGCTAGAGCTGG - Intronic
1063806526 10:9649933-9649955 GGACTCATGACAGCTACTGTAGG - Intergenic
1064993718 10:21278495-21278517 GGACCCATAACTGCTAGGGCTGG + Intergenic
1067404661 10:46010714-46010736 GGACCCATGTAAGGTAGAGGAGG - Exonic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1085029095 11:73258793-73258815 TAACCGATGACAGCTGGAGTTGG + Intergenic
1086493062 11:87375221-87375243 GGACCCATGACAGCCTTAGGAGG + Intergenic
1090128423 11:124114943-124114965 CGACCCATGACAGGAAGACTTGG + Intergenic
1107612076 13:42125206-42125228 GGACAAATAACAGCTGGAGTAGG - Intronic
1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG + Intergenic
1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG + Intergenic
1126412924 15:48390584-48390606 GGACTCAAGACAGGAAGAGTAGG - Intergenic
1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG + Intergenic
1127405976 15:58646887-58646909 GTACCACAGACAGCTAGAGTTGG - Intronic
1128212275 15:65910992-65911014 GGACCCATACCAGGCAGAGTGGG - Intronic
1128809596 15:70561234-70561256 GGAGCCATGAAAGCTAGTGATGG + Intergenic
1132471636 16:107051-107073 GGACCCAAGACTGTTAGGGTGGG + Intronic
1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG + Intronic
1141008525 16:80375677-80375699 CCACCCATCTCAGCTAGAGTTGG + Intergenic
1141566787 16:84907763-84907785 GGCCTCATGACAGCGAGAGATGG + Exonic
1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG + Intergenic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145774283 17:27516775-27516797 TGACCCATGACAGCTTCAGGAGG + Intronic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1147383256 17:40068061-40068083 GCAGCCATGAGAACTAGAGTTGG - Intronic
1151562801 17:74879630-74879652 GGTCCCAGGACACCTGGAGTGGG - Intronic
1152656091 17:81519784-81519806 GGACCCCGGACATCTAGCGTGGG - Intronic
1155857975 18:30858738-30858760 TGCCCCAGGACAGGTAGAGTGGG + Intergenic
1157120100 18:44901159-44901181 GAACCCATCAAAGCAAGAGTTGG - Intronic
1163218213 19:15896316-15896338 GGACCCAAGAGAGATAGAGCAGG - Intronic
1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG + Intergenic
929772185 2:44901561-44901583 GAACCCATGTCAGCTAAAGATGG - Intergenic
936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG + Intergenic
937829414 2:126403302-126403324 GGGCCCATGACAGATGGAGCTGG + Intergenic
938682328 2:133704253-133704275 GGCCCCATGATAGCTACAATAGG + Intergenic
940392089 2:153144040-153144062 TGACCCATGAGAGCTAGAGGTGG - Intergenic
947475572 2:230444904-230444926 TGACCCATGACAGGTTGACTGGG - Intronic
1169528386 20:6455482-6455504 GGAGCATTCACAGCTAGAGTCGG - Intergenic
1170546566 20:17439897-17439919 GGACCCGTGACAGCTGTGGTTGG - Intronic
1172245425 20:33442752-33442774 GGAGCCCTGACAGCTGGATTTGG - Intronic
1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG + Intronic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1176046040 20:63093093-63093115 GCACCCATGACAGCTTCTGTGGG - Intergenic
1183293606 22:37017650-37017672 GGCCCCAGGAGAGCTAGATTTGG + Intronic
949543689 3:5054164-5054186 GGCCCCATGACAGGTAGGGCAGG - Intergenic
955483710 3:59414718-59414740 GAAACAATGACAGCTAGAGCAGG - Intergenic
956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG + Intergenic
972792623 4:42387552-42387574 GCACCCATGAAAGCCAGAGTGGG + Intergenic
981517397 4:145624814-145624836 GGACCCATGTAAGGTAGAGGAGG - Intronic
982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG + Intergenic
984026503 4:174549102-174549124 GATTCCATGACAGCTAGAGATGG - Intergenic
987130154 5:14852810-14852832 GAACCCAGGACAGCTTGAGTGGG - Intronic
988932167 5:36047290-36047312 GCACCCATGACAGCTTCAGGAGG - Intronic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
991994790 5:72376315-72376337 GGTCCCATCACAGCTGGATTGGG - Intergenic
995399129 5:111720720-111720742 AGACCCAGGAAAGCTAGTGTTGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999654028 5:153795184-153795206 GCACCCATGGCAGCTGGACTTGG + Intronic
1009237715 6:61144380-61144402 GGAACCCTGACTGATAGAGTTGG - Intergenic
1010705708 6:79106972-79106994 GGACTCATGAAAGCAATAGTTGG + Intergenic
1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG + Intronic
1019121004 6:169803358-169803380 GAACACAAGACAGCTAGAGAAGG + Intergenic
1019641681 7:2106775-2106797 GGACTCATGACAGCTGGGGAGGG - Intronic
1023036063 7:36132287-36132309 GGAACCATGACATTAAGAGTTGG - Intergenic
1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG + Intergenic
1027219788 7:76206595-76206617 GGCCCCATGTCATCTAGAATAGG + Intronic
1036388732 8:8306234-8306256 GGGTCCCTGACAGCTACAGTTGG - Intergenic
1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG + Exonic
1039708196 8:40028685-40028707 GAACCCATGACACGGAGAGTAGG - Intergenic
1040088040 8:43365745-43365767 GGAGGCAAGACAGCTAGGGTGGG - Intergenic
1048954852 8:139527169-139527191 GGAGCAAGGACAGCTACAGTGGG + Intergenic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1187969838 X:24648068-24648090 GGACCCACGACTGGTAAAGTAGG - Intronic