ID: 997579139

View in Genome Browser
Species Human (GRCh38)
Location 5:135006218-135006240
Sequence GGACCCATGACAGCTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997579139_997579143 -6 Left 997579139 5:135006218-135006240 CCAACTCTAGCTGTCATGGGTCC No data
Right 997579143 5:135006235-135006257 GGGTCCTTTATGGGGCTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997579139_997579147 29 Left 997579139 5:135006218-135006240 CCAACTCTAGCTGTCATGGGTCC No data
Right 997579147 5:135006270-135006292 TTCCTCCACTGCTGCTCTAAAGG 0: 1
1: 0
2: 2
3: 21
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997579139 Original CRISPR GGACCCATGACAGCTAGAGT TGG (reversed) Intronic