ID: 997579139 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:135006218-135006240 |
Sequence | GGACCCATGACAGCTAGAGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997579139_997579143 | -6 | Left | 997579139 | 5:135006218-135006240 | CCAACTCTAGCTGTCATGGGTCC | No data | ||
Right | 997579143 | 5:135006235-135006257 | GGGTCCTTTATGGGGCTCCCAGG | 0: 1 1: 0 2: 0 3: 10 4: 117 |
||||
997579139_997579147 | 29 | Left | 997579139 | 5:135006218-135006240 | CCAACTCTAGCTGTCATGGGTCC | No data | ||
Right | 997579147 | 5:135006270-135006292 | TTCCTCCACTGCTGCTCTAAAGG | 0: 1 1: 0 2: 2 3: 21 4: 148 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997579139 | Original CRISPR | GGACCCATGACAGCTAGAGT TGG (reversed) | Intronic | ||