ID: 997579143

View in Genome Browser
Species Human (GRCh38)
Location 5:135006235-135006257
Sequence GGGTCCTTTATGGGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997579135_997579143 23 Left 997579135 5:135006189-135006211 CCTGCGTGGATTGTGCTTAAAGA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 997579143 5:135006235-135006257 GGGTCCTTTATGGGGCTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 117
997579139_997579143 -6 Left 997579139 5:135006218-135006240 CCAACTCTAGCTGTCATGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 997579143 5:135006235-135006257 GGGTCCTTTATGGGGCTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997579143 Original CRISPR GGGTCCTTTATGGGGCTCCC AGG Intronic
900361712 1:2292375-2292397 CAGTCCTTCATGGGGCACCCAGG - Intronic
900429707 1:2595845-2595867 GGGTCCTGTCTGCGCCTCCCGGG + Intronic
900429721 1:2595885-2595907 GGGTCCTGTCTGCGCCTCCCGGG + Intronic
900714518 1:4135558-4135580 GGGGCTTTTATGGGGGTCCATGG + Intergenic
904662349 1:32094735-32094757 GAGGCCATTATGGGGATCCCAGG + Intronic
906273722 1:44500968-44500990 GGGGCCTCTATGGGGCCCCCAGG - Intronic
906318040 1:44800608-44800630 GGGTCCGTGATGAGGCGCCCGGG - Exonic
906689549 1:47783603-47783625 GTGTCCTTTATGTGGGACCCTGG - Intronic
911178583 1:94841796-94841818 GGGTCCTCTATGGGTTGCCCTGG + Intronic
915280762 1:154820640-154820662 GGCTCCTTTCTGGGGCTGACTGG + Intronic
916588047 1:166165628-166165650 CTGTGCTTTGTGGGGCTCCCCGG - Intronic
923325777 1:232878824-232878846 GGATCCTTCCTGGAGCTCCCTGG - Intergenic
1062921486 10:1283732-1283754 GTGTCCTTCATGTGGCTCACTGG + Intronic
1065518638 10:26551008-26551030 GGGCCCTCTGTGGGTCTCCCAGG - Intronic
1069156260 10:65034614-65034636 GGGGCGTTTATGGGCCTCACAGG - Intergenic
1069739253 10:70677138-70677160 GGGTCCTTCAGGGCCCTCCCTGG - Intronic
1073070554 10:100790751-100790773 GGGTCCTTTTCTGGGCTCCAGGG - Intronic
1073452536 10:103618288-103618310 GGGTCCTTGATCAGGCTTCCAGG + Intronic
1075616275 10:123892496-123892518 GGGTTCTTTATGCGGAGCCCAGG + Intronic
1076365125 10:129916705-129916727 GGGTCCATTATTGGGGGCCCTGG - Intronic
1077505877 11:2929772-2929794 GGGTGCTTCCCGGGGCTCCCCGG - Intergenic
1082810714 11:57477292-57477314 GGGTCCTGGGTGGGGCTCCCTGG - Exonic
1083328384 11:61885295-61885317 TGGTCTTGTCTGGGGCTCCCTGG - Intronic
1083719834 11:64598703-64598725 AGGTCCTTGGTGGGTCTCCCAGG - Intronic
1084469466 11:69348639-69348661 GGGGCTTTTATGGGCCTCACAGG + Intronic
1085509676 11:77081986-77082008 GGGTCCAATGTGGGGCTCCAGGG - Intronic
1086188080 11:84043826-84043848 AGGCCCTTTATTGGGTTCCCTGG + Intronic
1095727432 12:45469220-45469242 GGGTCCTTCCTGGGGCCCCCAGG - Intergenic
1097298982 12:57998075-57998097 GGGGCTTTTATGGGGCTCAGAGG + Intergenic
1097690737 12:62732265-62732287 GGGCCCTTCATGTGGCTCTCTGG - Intronic
1100707745 12:97220063-97220085 GGCTCCTTCAGGAGGCTCCCAGG + Intergenic
1103528107 12:121580686-121580708 GGGTCGTTTTTGGGGGTGCCAGG - Intronic
1104147400 12:126048540-126048562 GGGTCTTTAATGGAGATCCCTGG + Intergenic
1104150002 12:126073154-126073176 GGGTCCTTCTGGGGGCTCCGAGG + Intergenic
1117089843 14:52238563-52238585 GGCTCATTTATTGGGCTGCCTGG - Intergenic
1118810753 14:69271373-69271395 GGGCCCTTTCTTGGGCTCTCTGG - Intronic
1118875147 14:69778187-69778209 GGGTGCTTCTTGGGGCTACCTGG + Intronic
1119331099 14:73794398-73794420 TGTTCCTTTCTGGGGCTCCAGGG - Intergenic
1119618111 14:76111971-76111993 GGGTCCTTCCTGGAGCCCCCAGG - Intergenic
1121466674 14:94120072-94120094 TGGGCCTTTATGGGGGTCCAGGG - Intergenic
1123068241 14:105628759-105628781 TGGGCCTTTCTGGGCCTCCCTGG + Intergenic
1123072253 14:105647565-105647587 TGGGCCTTTCTGGGCCTCCCTGG + Intergenic
1123092257 14:105747083-105747105 TGGGCCTTTCTGGGCCTCCCTGG + Intergenic
1123097834 14:105774784-105774806 TGGGCCTTTCTGGGCCTCCCTGG + Intergenic
1124600227 15:31127793-31127815 GCCTCATTTCTGGGGCTCCCTGG - Intronic
1129888244 15:79053562-79053584 GGTTCCTTCATGGGGCTTTCTGG + Intronic
1141338610 16:83181402-83181424 GGTTCCTTTATGGGGCACCTGGG - Intronic
1141534232 16:84668139-84668161 GGGTCCCGTTTGGGGCTCACTGG - Intergenic
1141631843 16:85291965-85291987 GCCTCCTTTACGGGGCTCCCAGG - Intergenic
1141731681 16:85827223-85827245 GGGTCCATTCTGGGACTTCCTGG + Intergenic
1142426999 16:90006709-90006731 GGGTCTTTTCTGGTGCTCCCCGG + Intronic
1142666071 17:1464555-1464577 GTGGGTTTTATGGGGCTCCCTGG + Exonic
1147931362 17:43983575-43983597 GGGTCCTTGAGGGAGCCCCCAGG - Intronic
1149794124 17:59504152-59504174 GGGTGCTTTATGATACTCCCTGG - Intergenic
1153993293 18:10418884-10418906 AGGACCTTTCTGGGGCACCCAGG - Intergenic
1157310872 18:46552345-46552367 AGGTCCTTTATAGGAGTCCCAGG - Intronic
1160520959 18:79507663-79507685 GTGTCCTTTCTAGGGCTCCGGGG - Intronic
1162923975 19:13920446-13920468 TGGTCATTTAGTGGGCTCCCAGG - Intronic
1164736862 19:30548137-30548159 GGGGCCTTCAAGGGTCTCCCTGG + Exonic
1164912318 19:32022960-32022982 GGTTCCTTGAAGGGGCTGCCAGG - Intergenic
1165616920 19:37210286-37210308 GGGTCATTGATGGGGCTCTTTGG - Intronic
1167244488 19:48365228-48365250 GGGAGCTTTCTGGGGGTCCCAGG - Intronic
925123640 2:1438412-1438434 GGGTCCGTGATGGAGCTCCTTGG + Intronic
928194685 2:29206593-29206615 TGGACCTTTCTGGGGCTCTCAGG + Intronic
936734210 2:115420713-115420735 GGCTCCTTTCTGGGGATCCCTGG + Intronic
938728628 2:134129098-134129120 AGGTCCCTTATGGGTCTCACTGG + Intronic
943712217 2:191109843-191109865 GGTCCCATGATGGGGCTCCCTGG + Intronic
944586591 2:201178725-201178747 GGGTCCTTCCTGGGGCCCCCAGG - Intergenic
944668098 2:201973176-201973198 AGTTCCTTGATGGGTCTCCCAGG - Intergenic
946483009 2:220074719-220074741 GGGTCTTTTATGAGGTTCCCAGG + Intergenic
948280446 2:236743254-236743276 GGGACCTGTTTGGAGCTCCCTGG + Intergenic
948970204 2:241419709-241419731 GAGCCCTTTCTGGGGCTCCTGGG - Intronic
1172692167 20:36797444-36797466 GGGACCTTTATGGTGCAGCCAGG + Intronic
1173337023 20:42120539-42120561 GGTATCTTTATGGGTCTCCCAGG - Intronic
1175257227 20:57654851-57654873 AGGTCCTTGAGGGGTCTCCCAGG + Intronic
1176094324 20:63333018-63333040 GGGTCCTTTTAGGAGCCCCCAGG + Intronic
1180044047 21:45294628-45294650 GGGTCATGGATGGGGCTCACTGG + Intergenic
1180063866 21:45403285-45403307 GGGGCCTGTCTGCGGCTCCCAGG - Intergenic
1180225602 21:46390386-46390408 GTGTCCAGTCTGGGGCTCCCAGG - Intronic
1181823125 22:25491285-25491307 GGGCCCTTTAGGTGGCTCGCAGG - Intergenic
1182900852 22:33897092-33897114 GCCTCCTTTGTGGAGCTCCCTGG + Intronic
1183379054 22:37481683-37481705 GGGGCCTTTGAGGGCCTCCCCGG + Intronic
1184284997 22:43465531-43465553 GGGGCCTCGAAGGGGCTCCCAGG + Intronic
1184890642 22:47376905-47376927 GGCTCCCTGAAGGGGCTCCCGGG - Intergenic
950126803 3:10514662-10514684 GGGTTCCTTATGGGGCTAACAGG - Intronic
951963003 3:28349284-28349306 GTGTCCTTTTGGGGGGTCCCCGG + Intronic
953885446 3:46712293-46712315 GGGTCCTGGATGGGGCTGGCAGG + Exonic
954906928 3:54070976-54070998 GGGTCCTTTATGTGGTTCTGTGG + Intergenic
962517300 3:136164267-136164289 GAGTCCTTTAAGGTGCTCCATGG - Intronic
965927557 3:174000939-174000961 GAGTCCTTGACTGGGCTCCCGGG - Intronic
967688165 3:192441523-192441545 AGGTTCTTTCTGTGGCTCCCTGG - Intronic
968934567 4:3603162-3603184 GGGTCCTTTACAGAGCTTCCGGG + Intergenic
970077445 4:12240050-12240072 GTGTCCTTTATTATGCTCCCAGG + Intergenic
975098747 4:70488022-70488044 AGGTCCTTTCTGGAGCTTCCAGG + Intergenic
977340336 4:95749813-95749835 GGATCCCTTCTGGTGCTCCCTGG + Intergenic
977554614 4:98476157-98476179 GGGTCCTTTATGGATATCACAGG - Intronic
981651304 4:147061981-147062003 GGGACCTTCATGGTGCTCTCCGG + Intergenic
989315201 5:40070363-40070385 GTGTCCTTTAAGGGGCTTCATGG + Intergenic
994135791 5:96284480-96284502 GGCTCTATTTTGGGGCTCCCAGG + Intergenic
997579143 5:135006235-135006257 GGGTCCTTTATGGGGCTCCCAGG + Intronic
998792287 5:145778127-145778149 GGGTCTTTTATGGGCCTCAGAGG - Intronic
999306973 5:150525806-150525828 GGGTCATGTGTGGGGCCCCCAGG - Intronic
1006780107 6:36626836-36626858 AGGGCCTTTCTGGGGCTCACAGG + Intergenic
1018936429 6:168276796-168276818 GGGTCCTTTGTCCGGCTCCGTGG + Intergenic
1018952962 6:168391089-168391111 GGGCCCCTGAGGGGGCTCCCGGG - Intergenic
1021873728 7:25029253-25029275 GGGACCTTGATGGGCCTGCCTGG + Intergenic
1022105424 7:27193077-27193099 CGGGCCTTCGTGGGGCTCCCCGG - Intergenic
1025240382 7:57266862-57266884 GTGTTCTTCAAGGGGCTCCCAGG + Intergenic
1028713305 7:93935828-93935850 GAGTCTTTACTGGGGCTCCCTGG - Intergenic
1028722376 7:94048334-94048356 GGGTCCAGTCAGGGGCTCCCAGG + Intergenic
1038312616 8:26456104-26456126 GTGAACTTTAGGGGGCTCCCCGG + Intronic
1038451125 8:27639573-27639595 GTGTCCTTTATGGAGCACTCAGG - Intronic
1038697568 8:29819630-29819652 GGGACCTCTATGGGGCCCACAGG - Intergenic
1039898255 8:41731606-41731628 GGGACTGTGATGGGGCTCCCAGG - Intronic
1044962363 8:97543084-97543106 GGGGCTTTTATGGGGCTCAGAGG - Intergenic
1046108382 8:109692508-109692530 GCGTTCTTTATGGGGCTACCTGG - Intergenic
1048852214 8:138656098-138656120 GTGTTCTTTCTGTGGCTCCCAGG - Intronic
1049189992 8:141282015-141282037 GGGTCAGCCATGGGGCTCCCAGG + Intronic
1049482720 8:142834647-142834669 GGGTCCCCCTTGGGGCTCCCAGG - Intronic
1052533116 9:29713336-29713358 GGGACTTTCATGGTGCTCCCAGG + Intergenic
1053160661 9:35811317-35811339 TGGTTGTTTCTGGGGCTCCCAGG + Exonic
1057070901 9:92099195-92099217 GGGTCCTGTTAGGGGCACCCAGG + Intronic
1058625060 9:106926206-106926228 GGGCTCTTTCTGGGGCTCACTGG - Exonic
1060819020 9:126651072-126651094 AGGTCCTGGATGGGGCTCCAGGG + Intronic
1062566633 9:137166600-137166622 GGGTCCCTCTTGGGGCACCCTGG - Intronic
1062710434 9:137972386-137972408 AGGGCCTGTTTGGGGCTCCCTGG + Intronic
1185550459 X:979820-979842 CGGTGGTTTATGGGGCTCCGGGG + Intergenic
1189367162 X:40397663-40397685 GGGTCCTTTGTGGGTTTCCTTGG + Intergenic