ID: 997582954

View in Genome Browser
Species Human (GRCh38)
Location 5:135028655-135028677
Sequence CAGGTGTGAGGTCCGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997582945_997582954 9 Left 997582945 5:135028623-135028645 CCCGGAGTGGGAAGTGGGAGGAG 0: 1
1: 0
2: 7
3: 90
4: 828
Right 997582954 5:135028655-135028677 CAGGTGTGAGGTCCGCGGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 96
997582946_997582954 8 Left 997582946 5:135028624-135028646 CCGGAGTGGGAAGTGGGAGGAGG 0: 1
1: 0
2: 4
3: 79
4: 582
Right 997582954 5:135028655-135028677 CAGGTGTGAGGTCCGCGGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 96
997582943_997582954 13 Left 997582943 5:135028619-135028641 CCAACCCGGAGTGGGAAGTGGGA 0: 1
1: 0
2: 2
3: 14
4: 155
Right 997582954 5:135028655-135028677 CAGGTGTGAGGTCCGCGGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997582954 Original CRISPR CAGGTGTGAGGTCCGCGGCG CGG Exonic
900703660 1:4062907-4062929 CAGGTGTGAGGCCAGGGGAGAGG - Intergenic
914902890 1:151721399-151721421 GAGGGGTGAGCTCCGGGGCGGGG - Intronic
915315463 1:155026282-155026304 CAGGTGAGGGGTCCGGGGCTGGG - Exonic
916240226 1:162632105-162632127 GAGGTGTGGGGTAGGCGGCGGGG + Intronic
920401704 1:205680347-205680369 CAGGGGTGAGGGTCCCGGCGCGG - Intronic
921177598 1:212608079-212608101 CGGGTGTGACCTCTGCGGCGGGG - Intronic
1063511350 10:6647832-6647854 GAGGTCTGAGGGCCGCAGCGCGG + Intergenic
1064034528 10:11904520-11904542 CAGGTGTGAGGTTTGCGTCGAGG - Intergenic
1075483068 10:122798839-122798861 CAGATGTGAGGGCCGAGTCGAGG + Intergenic
1076995065 11:293782-293804 CAGGGGTGAGGCCCACTGCGTGG - Intronic
1079773701 11:24497037-24497059 CAGGAGTGATGTCACCGGCGAGG - Intronic
1083684539 11:64368599-64368621 CAGGTGGGAGGGCCCAGGCGCGG + Exonic
1084072310 11:66744573-66744595 CAGGTGGGAGGTTCGGGGCGGGG - Intronic
1084758366 11:71252701-71252723 GGGGACTGAGGTCCGCGGCGTGG - Intergenic
1085263865 11:75224847-75224869 CAGGTGTGAGGTGGGCAGAGAGG - Intergenic
1089139937 11:116276824-116276846 CGGGTGTGGGGCCCTCGGCGCGG - Intergenic
1091403809 12:196663-196685 CAGGTGTGTGGTCAGGGGAGTGG + Intronic
1091822566 12:3487238-3487260 CATGTGTGAGGTCCCCTGGGAGG + Intronic
1097021956 12:56026971-56026993 CAAGTGTGACGTCTGCGGCATGG + Exonic
1100474356 12:94922037-94922059 CAGGGGTGAGGTAGGTGGCGGGG - Intronic
1104015067 12:124956671-124956693 CAGGTGCGAGGTTGGCGGCTGGG - Exonic
1104893843 12:132152512-132152534 CAGATGTGAGGCCCTCGGCCTGG - Intergenic
1110240529 13:73261477-73261499 CAGATGTGAGGTCCTGGGTGAGG - Intergenic
1112507047 13:99981620-99981642 CAGGGGTGGGGGCTGCGGCGCGG + Intergenic
1113924540 13:113934040-113934062 CAGGTGTGAGGTGTGCCCCGCGG + Intergenic
1113952961 13:114081927-114081949 CAGGTGTGAGGTCCTGTGTGTGG - Intronic
1115769457 14:36655259-36655281 CAGCTGCGACCTCCGCGGCGTGG + Intergenic
1121342993 14:93116017-93116039 CGGGTGTGGGGTGCGGGGCGCGG + Intronic
1122745062 14:103892576-103892598 CAGGAGTGAGGGCCCAGGCGCGG + Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1129379715 15:75157296-75157318 CAGGTGTGGGGTCAGTGGTGTGG - Intergenic
1131257598 15:90872154-90872176 CAGGTGTGCGGGCGGGGGCGAGG - Intronic
1133222134 16:4323316-4323338 CAGGTGTGGGGGCTGCGGGGCGG + Intronic
1134549695 16:15133231-15133253 CAGATGTGAGGTCCCCTGCCAGG + Intronic
1138660884 16:58516167-58516189 CAGGTGTGAGCGCCCCGGCGCGG - Intronic
1140810523 16:78572771-78572793 CAGGTGTGAGGGACGGGGCATGG + Intronic
1141033537 16:80609670-80609692 CAGGTGTGAGTTACAAGGCGAGG + Intronic
1141741879 16:85898941-85898963 CAGGTGTGAGGAGCGGGGCTCGG + Exonic
1141861095 16:86716923-86716945 CAGGGGTGAGGCCAGAGGCGTGG + Intergenic
1142319846 16:89374054-89374076 CAAGTGTGAGGCCCGCAGAGAGG + Intronic
1147861471 17:43526403-43526425 CATGTGTGAGCTCCGCAGCTGGG + Intronic
1148767483 17:50047591-50047613 CAGGGGTGAGGTCAGCAGTGAGG + Intergenic
1148860504 17:50602019-50602041 CGGGTGTGAGGTCCCCAGTGCGG - Intronic
1152617032 17:81342797-81342819 CAGGTGTGCGGGCCGCGGTGGGG - Intergenic
1155061546 18:22233282-22233304 CAGGTGTGAGGCCAGAGGCTAGG - Intergenic
1157752832 18:50194337-50194359 CTGGGGTGGGGTCCACGGCGGGG + Intronic
1158695350 18:59698188-59698210 CAGCTCTGATGTGCGCGGCGTGG - Intergenic
1160774526 19:848842-848864 CAGAGGGGAGGTCCGAGGCGGGG + Intergenic
1160980239 19:1813274-1813296 CAGGGGTGAGTTCAGCGACGAGG + Intergenic
1161619132 19:5289212-5289234 CAGGCGTGAGGTCCTCTGCGAGG + Intronic
1163100612 19:15093890-15093912 CAGGTGTGAGGCACGGTGCGTGG - Intergenic
1164776318 19:30856466-30856488 CAGGGGTGAGGTCAGGGGCAGGG - Intergenic
1166698106 19:44865688-44865710 GAGGTGGGAGGGCCGCGGTGTGG + Intronic
1168137429 19:54360740-54360762 CAGGTGTGAGGGCAGAGGGGAGG + Intronic
1168160648 19:54508342-54508364 CAGGTGTGAGGGCAGAGGGGAGG - Intronic
929889115 2:45904936-45904958 CACGTGTGAGGTCCCGGGCGTGG + Intronic
934618429 2:95789719-95789741 CTGGTGTGAGGTGAGAGGCGCGG + Intergenic
934642464 2:96034840-96034862 CTGGTGTGAGGTGAGAGGCGCGG - Exonic
935592668 2:104856031-104856053 CTGGTGTGGGGGCGGCGGCGGGG - Exonic
937978649 2:127597421-127597443 CAGGTGTGAGGGAGGGGGCGTGG - Intronic
947127257 2:226882615-226882637 TAGGTGTGAGGTTCGGGGCGGGG - Intronic
948468755 2:238164370-238164392 CGGGTGTGGGGTCCGGGCCGGGG - Intronic
948920533 2:241064052-241064074 CCGGTGTGAGAGCGGCGGCGGGG + Exonic
1172106900 20:32522438-32522460 CAGGTGTCAGGTCCGAGGGATGG + Intronic
1172421950 20:34825452-34825474 CAGGTGAGGGGACGGCGGCGCGG - Intronic
1175199283 20:57266704-57266726 CAGGTGGGAGGCCGCCGGCGCGG - Intergenic
1176408667 21:6435992-6436014 CAGGTGTGTGCTCCTGGGCGTGG + Intergenic
1178089211 21:29143698-29143720 CAGGTGTGAGCTACCCCGCGTGG + Intronic
1178518268 21:33266512-33266534 CAGGTGAGGGGTCCGCGGGGAGG + Exonic
1179457203 21:41507953-41507975 CGGGTGTGAGGAGCGCGGCGCGG - Exonic
1179503633 21:41825272-41825294 CAGCTGTGAGGACCACGGCATGG + Intronic
1179684161 21:43044312-43044334 CAGGTGTGTGCTCCTGGGCGTGG + Intergenic
1179891325 21:44336495-44336517 CAGGGGTGAGGTGCCCGGGGTGG + Intronic
1180951866 22:19724079-19724101 CAGGTGTGCGGTGCGCAGCGCGG - Exonic
1182414929 22:30215291-30215313 CAGGTGTGAGACCCGCTGCCTGG + Intergenic
1183958621 22:41397551-41397573 CTGGGGTGAGGTCCACGGCTTGG - Exonic
1184371599 22:44085697-44085719 CAGGTGCGAGGTCGGCTGCTGGG + Intronic
1185366915 22:50441024-50441046 CAGGTGTGTGGGGCGTGGCGGGG + Exonic
951139813 3:19147271-19147293 CAGGTGTCAGAGCCGCGGCGAGG - Intergenic
953289965 3:41650548-41650570 CAGGTGTGCCGTCTGCGGCAGGG - Intronic
954318405 3:49813714-49813736 CAGCTGTGAGGCCCGAGGTGGGG - Exonic
958253484 3:91297102-91297124 CAGTTGTGAGGTCGGGGGAGGGG + Intergenic
961359316 3:126357217-126357239 CAGGTGGGAGAGGCGCGGCGGGG - Exonic
968081154 3:195847715-195847737 AAGGTGTGGTGTCCGGGGCGGGG - Intergenic
974237368 4:59199273-59199295 CAGGTGTGAGGTACCGGGCCTGG + Intergenic
976431348 4:84966311-84966333 CCGGCGCGACGTCCGCGGCGGGG + Exonic
978503487 4:109433620-109433642 CAGGTGTAAGTCCCGGGGCGTGG + Intergenic
985640972 5:1063380-1063402 GAGGTGTGAGGTCCTGGACGGGG + Intronic
990003970 5:50923677-50923699 CAGGTGTGGGCACCGAGGCGGGG - Intergenic
997582954 5:135028655-135028677 CAGGTGTGAGGTCCGCGGCGCGG + Exonic
998887997 5:146714835-146714857 GAGGTGTGAGGTCAGGGGAGAGG - Intronic
1019536266 7:1531176-1531198 CAGGTCTGGGGTCCGCGCCCTGG - Intronic
1020118787 7:5491466-5491488 CAGCTGTGAGGTCCGAGGGAGGG + Intronic
1020763773 7:12296500-12296522 CAGGTGTGGGATCTGGGGCGGGG + Intergenic
1021452955 7:20798575-20798597 CAGGTGTCAGGTCGGCGGCCCGG - Intergenic
1027690064 7:81333757-81333779 CAGGCGTGAGGTCCGCTGCGAGG + Intergenic
1029286325 7:99468518-99468540 CAGGTGTCAGGTCCTCCGTGGGG + Intergenic
1031899481 7:127392979-127393001 GAGGTGTGAGGCCCGCGATGCGG + Intronic
1034522731 7:151632613-151632635 CAGGTGTGGGCTCCGCGGCGCGG + Intronic
1035376785 7:158411703-158411725 CGGGTGTGAGTGCCGCGGGGCGG - Intronic
1035579484 8:731168-731190 GTGGTCTGAGGTCCGCGGCAGGG - Exonic
1036098861 8:5755638-5755660 CAGGTGTGAGGTCAGCTCTGGGG - Intergenic
1041423256 8:57692895-57692917 CAGGTGTGGGGTCGGAGGCATGG + Intergenic
1044666755 8:94640539-94640561 CAGAGGTGAGGCCCGGGGCGCGG - Intergenic
1046336394 8:112794336-112794358 CAGGTTAGAGGGCAGCGGCGCGG + Intronic
1048969573 8:139637846-139637868 CAGGGGTGAGGTCTGCTGCTGGG - Intronic
1056884432 9:90427527-90427549 CAGGTGTGCAGTCCATGGCGAGG - Intergenic
1062372190 9:136245705-136245727 CAGCCGTGCGGCCCGCGGCGGGG + Exonic
1062556621 9:137115803-137115825 CAGATGTGAGGGCCGTGGTGGGG - Intergenic
1200035003 X:153321273-153321295 CAGGTGTGGGGGGCGCGGAGGGG - Intergenic
1200092418 X:153642239-153642261 CAGGTGGGAGGAAGGCGGCGGGG + Intergenic