ID: 997583609

View in Genome Browser
Species Human (GRCh38)
Location 5:135031922-135031944
Sequence CCTGAGGAGAAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 568}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997583609_997583618 -2 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583618 5:135031943-135031965 GGGGTGTATGGGAGCCCCACTGG 0: 1
1: 0
2: 1
3: 8
4: 140
997583609_997583620 3 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583620 5:135031948-135031970 GTATGGGAGCCCCACTGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 147
997583609_997583626 25 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583626 5:135031970-135031992 GCACAACACAGCCGGGTTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 97
997583609_997583625 18 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583625 5:135031963-135031985 TGGGCAGGCACAACACAGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 304
997583609_997583619 -1 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583619 5:135031944-135031966 GGGTGTATGGGAGCCCCACTGGG 0: 1
1: 0
2: 1
3: 11
4: 150
997583609_997583624 17 Left 997583609 5:135031922-135031944 CCCTCCACTTTCTTCTCCTCAGG 0: 1
1: 0
2: 6
3: 53
4: 568
Right 997583624 5:135031962-135031984 CTGGGCAGGCACAACACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997583609 Original CRISPR CCTGAGGAGAAGAAAGTGGA GGG (reversed) Intronic
900348600 1:2224225-2224247 CCTGAGGAGGAGAGAGTGGGTGG + Intergenic
900661026 1:3783784-3783806 CCTGACGTGAGGGAAGTGGAAGG - Intronic
901765809 1:11499333-11499355 CCTTAGAAGAAGAAAGCTGATGG - Intronic
902304646 1:15526843-15526865 CCTGGGGAGGGGAAAGAGGAGGG - Exonic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903189302 1:21647858-21647880 CCTGTGGAAATGGAAGTGGAGGG + Intronic
903959901 1:27050356-27050378 CCTGAGGATAAGAATGTGCTGGG - Intergenic
904581404 1:31546836-31546858 TCTGAGGAGAAGAGACTTGAAGG + Intergenic
905547097 1:38808507-38808529 CCTGAGGCAGAGGAAGTGGAAGG + Intergenic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905861034 1:41351605-41351627 CCTGATTAGAACAAAGAGGAGGG + Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907769324 1:57444149-57444171 CCTGGGGAGAAGCCATTGGAGGG - Intronic
907858389 1:58326453-58326475 CTTGAGGAGGAGAAAGATGAAGG + Intronic
908074364 1:60497807-60497829 CCAAAGGAGAAGAAAGAGAAAGG + Intergenic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908477260 1:64501970-64501992 TCTATGGAGAAGAAAGTGAAGGG - Intronic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909615041 1:77598370-77598392 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
910526227 1:88181731-88181753 CATGAGGAAAAGAAAGGGAAAGG - Intergenic
910716451 1:90236338-90236360 CTTAAGGAGAGGAAAGTGAAGGG - Intergenic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
911345537 1:96692484-96692506 ACTGAGGAGAAGGAAGTAAAGGG + Intergenic
911812763 1:102304618-102304640 GCAGAGGAGAAGGAAGAGGAGGG - Intergenic
912500261 1:110116980-110117002 CATGGGTAGAAGGAAGTGGAGGG + Intergenic
915098842 1:153484155-153484177 CCTCAGGAGAACCAAATGGAAGG + Intergenic
915165542 1:153946150-153946172 CCTGGGGAAGTGAAAGTGGAGGG - Intronic
916086350 1:161272804-161272826 CCTGAGGAGGAGAAGGGTGATGG + Intronic
916350414 1:163843264-163843286 CATGAAGAAAAGAGAGTGGAAGG + Intergenic
916385666 1:164264975-164264997 CCTGATGACTAGAAAGTTGAGGG - Intergenic
916726861 1:167531432-167531454 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
917336464 1:173928808-173928830 CCTGAGGTGTGGAAACTGGAAGG - Intergenic
917533182 1:175855279-175855301 ACTGAGGAGAAGTAAGAGAATGG + Intergenic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
918708624 1:187700192-187700214 CCAGGGCTGAAGAAAGTGGAGGG + Intergenic
918824577 1:189307124-189307146 ACTTAGGACAAGAAAGTGGTGGG - Intergenic
919761688 1:201102155-201102177 CCTGAAGACAAGAAAGGGGGAGG + Intronic
919948540 1:202341158-202341180 CCTAAGGAGAAGAAACTGTCAGG - Intronic
919975345 1:202607140-202607162 CCTGAGGAGCAGAAAGAGCTTGG - Intronic
920181467 1:204134514-204134536 CCTGAGGAAATCAAAGTCGATGG + Exonic
920865137 1:209745790-209745812 CCTGAGGGGAAGAAATTGGAAGG + Intergenic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
921294364 1:213688232-213688254 CTTGGGGAGAAGGAAGTGGGAGG - Intergenic
922291459 1:224212391-224212413 CCTCTGGAGAGGAAAGGGGATGG - Intergenic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
922901316 1:229138904-229138926 CCAGAGGAGAGGGAAGGGGAGGG - Intergenic
924508540 1:244709490-244709512 CCAGTGGAGGAGAAAGGGGAAGG - Intergenic
1063868110 10:10389086-10389108 GCTGAGGAGAGGTATGTGGATGG - Intergenic
1064125257 10:12654068-12654090 TATGAGGATAAGTAAGTGGAAGG - Intronic
1064542844 10:16422796-16422818 GAAGAGGAGAAGAAAATGGAAGG - Intergenic
1064728590 10:18306265-18306287 CTTGAGGAGAAGTGAGTTGAGGG + Intronic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1067056203 10:43053100-43053122 CTAGAGGAGAGGAAGGTGGAGGG - Intergenic
1067090689 10:43264630-43264652 CCTCAGGAGAAAAAGGGGGAAGG + Intronic
1067226802 10:44382102-44382124 CCTGGGGACAAGGAAGTGGGGGG - Intronic
1067542900 10:47169044-47169066 GTTGAGGAGAAGGAAGGGGAAGG - Intergenic
1067776047 10:49165601-49165623 CCAGAGGAGGAGAGAGTGTAAGG + Intronic
1068964225 10:62895616-62895638 CATGAGGAAAAGAAATAGGAAGG + Intronic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069500734 10:68950740-68950762 ACTGGGGAGAAGCAAGTGCAGGG + Intergenic
1070012107 10:72485785-72485807 AGTGGGGAGAAGAAAGTGAAAGG + Intronic
1070261886 10:74864518-74864540 CCTGAGGGGAAAAAAGTGGATGG - Intronic
1070679970 10:78442080-78442102 CCCCAGGAGAAGACACTGGATGG + Intergenic
1070819689 10:79347657-79347679 CCGGAGGAGGAGGAAGAGGACGG - Exonic
1071042899 10:81336072-81336094 CCAGAGTAGAAGAAAAGGGATGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1073075465 10:100823504-100823526 GCTGATGAAAAGAAAGTGAACGG + Intronic
1074869992 10:117568803-117568825 ACTGAGGCCAAGAAAGTGGAGGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1074966725 10:118497292-118497314 GAAGAGGAGAAAAAAGTGGAGGG + Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1076230153 10:128813554-128813576 ACTTAGGAGAAGAAAGTAAAAGG - Intergenic
1076777681 10:132707137-132707159 GCTGAGGAGATGAAAGCAGATGG - Intronic
1077199029 11:1296393-1296415 TCTGAGGGGAAGAGAGAGGATGG + Intronic
1077609344 11:3634898-3634920 TCTGGGGAGAAGAAAGAGGCTGG + Intergenic
1077816021 11:5686046-5686068 CCAGAAGAGAAGAGAGAGGAAGG - Intronic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1078476720 11:11636460-11636482 CCTGAGCAGACCAGAGTGGAGGG + Intergenic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078888906 11:15535671-15535693 CCTGAGGGGAAGCGAGAGGAAGG - Intergenic
1080090265 11:28339836-28339858 CATGAGGAGGAGAAAGTAGGGGG + Intergenic
1080197419 11:29628752-29628774 CCTGAGGAGAGGAGAGAGGGGGG + Intergenic
1080879185 11:36303094-36303116 TGTGTGGAGAAGGAAGTGGAGGG + Intronic
1081599671 11:44484344-44484366 CCTGAGGGGAAGAAAGAGCAGGG + Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082757158 11:57088874-57088896 CCGGAGGAGAAGGAAGGGAAGGG + Intergenic
1082980529 11:59116588-59116610 ACTGAGGAGAAGGCAGTTGAGGG + Intronic
1083167852 11:60902465-60902487 CCTGAAGAGAAGAAAGGTGAGGG + Exonic
1083173897 11:60937765-60937787 TCTGGGGAGAAGCAAGTAGAGGG - Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1084074990 11:66767412-66767434 AGTGAGGAAAGGAAAGTGGATGG + Intronic
1084750586 11:71202261-71202283 CCTGAGGGGAGGAATGAGGAGGG - Intronic
1085205013 11:74726475-74726497 CCTGAGTACAAGAATGAGGATGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1087079159 11:94153022-94153044 CCTGAGGAAGAGAAAGCTGAAGG - Intronic
1087849600 11:103012786-103012808 CCTGATGAGAACAAACTGGAAGG + Intergenic
1088340230 11:108757074-108757096 CCTGTGGAGAGGACAGGGGAAGG + Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089041888 11:115459664-115459686 CCTGAAGAGACTAAATTGGAAGG + Intronic
1089364834 11:117915349-117915371 CCGGAGGAGAAGCAAGGGGTGGG - Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090168716 11:124579370-124579392 CCTGAGGAGGAGGAAGAAGAGGG + Intergenic
1090435876 11:126685982-126686004 CCTGAGAAGAAGCAGGTGAAGGG - Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1092909639 12:13135582-13135604 ACAGAGGAAAAGAAATTGGAAGG - Intronic
1093785290 12:23185452-23185474 CCTGGGGAGAAAGAAGGGGAAGG - Intergenic
1094066412 12:26365203-26365225 CCTGAGGAAAGGAAAATGAACGG + Intronic
1094461584 12:30702310-30702332 CCTCTGGAGAAGAAAGTTGCTGG - Intergenic
1094658652 12:32444769-32444791 CCTGAGGTGAAGATAAAGGATGG + Intronic
1096262018 12:50098925-50098947 CCTAAGGAGAAAATAGTGAAGGG - Exonic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1097325663 12:58273519-58273541 CCTGGGGAGAAGAAAAACGAGGG + Intergenic
1098061041 12:66563001-66563023 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
1098105697 12:67068228-67068250 CTTGCGGAGAGGAAAGTTGAAGG - Intergenic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099133274 12:78863513-78863535 CCTGTGGAGCAGATAATGGACGG + Intergenic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1099611691 12:84880408-84880430 CATGGAGAGAAGAAAGTGGTTGG - Intronic
1099752102 12:86788404-86788426 CCCAAGGAGAAAAAAATGGAAGG + Intronic
1099833220 12:87872799-87872821 CCTAATGAGATGAAAATGGATGG - Intergenic
1100259048 12:92914415-92914437 CCTAAGCAGAACAAAGTGGGAGG - Intronic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101085695 12:101233634-101233656 ACTTAGGAGAAGAAAGTAGGGGG - Intergenic
1101223006 12:102659984-102660006 CATGAGGAGTACAAAGTGGCTGG - Intergenic
1101549434 12:105748403-105748425 CCTATGGAGAAGAAAGTCTAGGG - Intergenic
1101572017 12:105962332-105962354 CAGGAGGAGAAGAAAGGGTAGGG + Intergenic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103183397 12:118934879-118934901 CCTGAGGATAGGAAAGGGGGTGG + Intergenic
1103321961 12:120097373-120097395 TCTGTGGAGAGGAAAGAGGAAGG + Exonic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103477239 12:121227650-121227672 CTTGAGGGGAAGAACCTGGAAGG + Intronic
1103513506 12:121491197-121491219 CCTTAGGAGAAGAAAGGCGTTGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1106483339 13:30153264-30153286 TCTGGGGAGAAGACACTGGAAGG + Intergenic
1106706893 13:32290485-32290507 CCTGATGGGAAGAAAGAGAAAGG + Intronic
1106951883 13:34893440-34893462 ACAGAGGAGTAGAAAGTGAATGG + Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107437346 13:40391735-40391757 TCTGAGGTGGAGAAAGTAGAGGG - Intergenic
1108105559 13:47004813-47004835 CCTGAGGTGAAGTAAGTAAATGG + Intergenic
1108518338 13:51222749-51222771 CCCGGGGGGAGGAAAGTGGAAGG + Intronic
1108678720 13:52761073-52761095 CCTGAGGAGAAGAGAGAGAAAGG + Intergenic
1108743661 13:53366564-53366586 ACTGAGGAGAGGAACGTGGGAGG - Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111094877 13:83499990-83500012 CATGAGGAGAGGAAAATGGGAGG + Intergenic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113734055 13:112664486-112664508 GCTGAGGAGAAAGAAGAGGAAGG - Intronic
1113792622 13:113037262-113037284 CCCTAGGAGTAGAAGGTGGAGGG + Intronic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116592159 14:46791426-46791448 ACTGAGGAGTAGAAAATGGGTGG - Intergenic
1116798129 14:49413584-49413606 CCTGAGGAGGTGAAAGGGGCAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1118123117 14:62868215-62868237 CCTGGTGGGAAGAATGTGGAAGG - Intronic
1118602892 14:67482737-67482759 CCAGAAGGGAAGCAAGTGGAGGG + Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118656387 14:67954499-67954521 CCAGAGGAGAAGACAGATGAAGG + Intronic
1118710899 14:68518574-68518596 CCTGAGGGGATGAAAGTGGATGG - Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1118959583 14:70516698-70516720 CCTAAGGAGATGGTAGTGGAAGG + Intergenic
1118959835 14:70518889-70518911 CCTTAGGAGAAGGAAGTTAATGG - Intergenic
1119557606 14:75565702-75565724 CCTGTGGAGAAGACAGTCTATGG - Intergenic
1119768864 14:77207778-77207800 CCTCAGGAGAAGAAAGGGGCAGG - Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1121643130 14:95499724-95499746 GCTGGGGAGAAGAAAGGGGCAGG - Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122124531 14:99571953-99571975 CCTCAGGGGAAGGAACTGGAGGG + Intronic
1123576960 15:21680230-21680252 GCTGAGGAGAAGGAAAAGGAAGG - Intergenic
1123613582 15:22122698-22122720 GCTGAGGAGAAGGAAAAGGAAGG - Intergenic
1124104566 15:26725348-26725370 TCTGAGGAGGGGAAGGTGGAGGG - Intronic
1124901587 15:33828239-33828261 CCTGAGGAGAAGGAGGGAGATGG - Intronic
1125541027 15:40470392-40470414 CATGAGGAGAAGGCAGAGGAGGG + Intergenic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1125894768 15:43293330-43293352 TCCCAGGACAAGAAAGTGGAGGG + Intronic
1126440490 15:48683251-48683273 CCTGAGGAGAAGAGAGGGAAAGG + Intergenic
1126538999 15:49801639-49801661 CCTGAAGGGAAGCCAGTGGAGGG - Intergenic
1126915111 15:53457716-53457738 GCTGAGGAGGTGAAAGAGGAAGG + Intergenic
1126944016 15:53797840-53797862 CTTGAGGAGAAGAAAGAGAGGGG + Intergenic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128291530 15:66482015-66482037 CCTGAGGAGATGAAGTTGAATGG + Intronic
1128984044 15:72206499-72206521 CCAGAGCAGAAGGAAATGGAGGG + Intronic
1130379217 15:83357393-83357415 CCTAAGGACAGGAAACTGGAAGG + Intergenic
1130520820 15:84659306-84659328 CCTGGGGAGAACAAAGTGCCAGG - Intergenic
1130563079 15:84973917-84973939 CTTGAAGAGAAGACTGTGGAGGG - Intergenic
1130691634 15:86086373-86086395 CCTGAAATAAAGAAAGTGGAGGG + Intergenic
1131374457 15:91912171-91912193 CCTGAGGAAGAGCATGTGGAAGG - Intronic
1131927131 15:97397314-97397336 ATTCAGGAGAAGAAAGTGCAAGG + Intergenic
1132215180 15:100057157-100057179 CATATGGAGAAGCAAGTGGAAGG + Intronic
1202985828 15_KI270727v1_random:414475-414497 GCTGAGGAGAAGGAAAAGGAAGG - Intergenic
1132669398 16:1096483-1096505 CCTGAGGAGAAGCAGGCAGATGG + Intergenic
1132790720 16:1685815-1685837 ACTGAGGACACAAAAGTGGACGG + Exonic
1133121607 16:3611923-3611945 CCTGTGGAGCGGAGAGTGGACGG + Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133785049 16:8967011-8967033 ACTGAGGAGTGGATAGTGGAGGG + Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134439016 16:14286359-14286381 CCTGTGCAGAAGAATGTGGATGG - Intergenic
1134562013 16:15219040-15219062 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1134922551 16:18130666-18130688 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1137680165 16:50335385-50335407 CTTGAGGAGAAGACAGTTGGTGG + Intronic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1138563514 16:57816146-57816168 GCTGGGGAGAGGAAAGGGGAGGG + Intronic
1138890450 16:61137691-61137713 GCTGAGGAGTAGGAAGAGGAGGG - Intergenic
1139292169 16:65868904-65868926 TCTGGGGACAAGAATGTGGATGG + Intergenic
1139868125 16:70080073-70080095 ACTGGGGAGAAGAAAGAGAAGGG - Intergenic
1139930147 16:70519841-70519863 TCTAAGGAGAACATAGTGGAAGG - Intronic
1140387210 16:74551780-74551802 ACTGGGGAGAAGAAAGAGAAGGG + Intronic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1141168129 16:81674154-81674176 CCTGATCAGAAGGAAGTGCAGGG + Intronic
1141381094 16:83577651-83577673 GCTGAGGAGGAGAAAGGGGTAGG + Intronic
1141575345 16:84959832-84959854 CCTCCTGATAAGAAAGTGGAAGG + Intergenic
1141774390 16:86112692-86112714 GAGGAGGAGAAGAAAGTGCAAGG + Intergenic
1142546387 17:706757-706779 CCTGAGGGCATGAAAGTAGAGGG - Intronic
1142567408 17:849625-849647 CCAGAGGACAAGGACGTGGAGGG - Intronic
1142765551 17:2062139-2062161 CCTGAGGAGAGGAGAGGGTAAGG + Intronic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1145398226 17:22512396-22512418 ACTGAGGAGAAGATAGAGCAGGG - Intergenic
1145911234 17:28544456-28544478 AATGAGGACAAGAATGTGGAAGG - Intronic
1146507034 17:33414403-33414425 CCAGGGGAGAAGGAAGTAGAGGG + Intronic
1146600059 17:34206267-34206289 TCTGGGGGTAAGAAAGTGGAAGG - Intergenic
1146913893 17:36665790-36665812 CCGGAGGAGGAGATCGTGGATGG + Intergenic
1147168466 17:38605323-38605345 GGTGAGGAGAAGAAGGGGGATGG - Intronic
1147450725 17:40502266-40502288 CCTGAGGGGAGGACATTGGAGGG + Intergenic
1147465256 17:40605914-40605936 ACTGAGGTTAAGAAAGTGAAGGG + Intergenic
1147710917 17:42463991-42464013 GCTGAGGAGGAGGAAGGGGAGGG + Intronic
1147716898 17:42514576-42514598 CCTGAGGTGAAGCTAGTGCAGGG - Intronic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1150403641 17:64880779-64880801 CCTGTGTAGAAGAATTTGGAGGG - Intronic
1150465838 17:65391929-65391951 TCTGGAGAGAAGAGAGTGGAGGG + Intergenic
1150550311 17:66203861-66203883 CCTGGGGAGAGGAGAGAGGAGGG + Intergenic
1151300830 17:73224055-73224077 GGGGAAGAGAAGAAAGTGGAGGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1153276829 18:3375928-3375950 CCTAAGGAGAGGGAAGAGGATGG - Intergenic
1153821430 18:8835340-8835362 CAGGAGGAGAAGCAAGTGGGAGG + Intergenic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1155066432 18:22273167-22273189 ACTGTGGCGAAGAAAGTGCAAGG - Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156368509 18:36451604-36451626 CCGGAGGAGAAGGAAGAGGAGGG - Intronic
1156613274 18:38752318-38752340 CATGAGGGGGAGAAAGTGTAGGG + Intergenic
1156709230 18:39922468-39922490 AATGTGGAGAAAAAAGTGGAAGG + Intergenic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1158357775 18:56639577-56639599 GCTGGGGAGATGAAATTGGAGGG + Intronic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158849300 18:61478632-61478654 CATGAGGAGTAAACAGTGGATGG + Intronic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159591502 18:70340057-70340079 CCTGAGCCAAAGAATGTGGATGG - Intronic
1160864633 19:1251278-1251300 CCAGAGGAGGAGAAAGTGCCTGG + Intronic
1161037103 19:2091056-2091078 CCTGTGGGGAAGAAAAGGGAGGG + Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1162017131 19:7851905-7851927 CCTCAGGGGAACAGAGTGGATGG - Intronic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163169016 19:15517856-15517878 GCTGAGGAAAGGAATGTGGATGG + Intronic
1163267383 19:16229153-16229175 CCTGAGGTGAAGACAGAGGCTGG - Intronic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1163901395 19:20103405-20103427 CCTGTTGAGAAAAAAGTTGAGGG - Intronic
1164729129 19:30488754-30488776 CAAGGGGAGAAGAAAGGGGAGGG - Intronic
1164738864 19:30561983-30562005 CCTGTGGAGAGGGAAGTGCATGG + Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166666125 19:44681454-44681476 CCTAAGGAAAAGAGACTGGAAGG + Intronic
1166672452 19:44719035-44719057 GAAGAGGAGAAGAAAGAGGAAGG + Intergenic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1167695163 19:51010814-51010836 TGTGAGCAGGAGAAAGTGGAAGG - Intergenic
924988385 2:289983-290005 CCTCAGGAGGAGAAAGTGTCCGG + Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925323588 2:2997645-2997667 CCAGAGGAGGAGGAAGTGAAGGG - Intergenic
927410386 2:22818212-22818234 CCTTTGCAGAAGAAAATGGAAGG - Intergenic
927446180 2:23163954-23163976 CCTGAGGAGTAGGAAGAGGGGGG - Intergenic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
929124519 2:38511068-38511090 CCTTGGAAGAAGAAAGTCGAGGG + Intergenic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929425225 2:41838265-41838287 CCTGGGGACGAGCAAGTGGAGGG - Intergenic
929765380 2:44839687-44839709 CCAGGGGAGGAGAAAATGGAAGG - Intergenic
930057926 2:47266108-47266130 ACAAAGGAGAAGGAAGTGGATGG + Intergenic
930511309 2:52348968-52348990 CATGAGGAGAAGCAAGTAAAGGG - Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
932828304 2:74961593-74961615 CCTGGGGAAAATAAACTGGAGGG + Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936560177 2:113531230-113531252 CATGGGGAGAAGAAACTGAAAGG - Intergenic
937082922 2:119153353-119153375 CCTGAGGAGAGGAGACTGGAGGG + Intergenic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937472191 2:122183658-122183680 CCTGAAGAGGAGAAGGTGAATGG + Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
937937292 2:127256447-127256469 ACTGAGGAGAAGAAAGTATTAGG - Intergenic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
939163683 2:138617641-138617663 GCTGTGGAGAATAAATTGGAGGG - Intergenic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941160950 2:162033193-162033215 CCTGAGCAGAGCAAAATGGATGG - Intronic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
941696761 2:168561195-168561217 CCTGATGAAAAGAGATTGGAAGG + Exonic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942944393 2:181657049-181657071 CCTTTGGAGAAGGAGGTGGAGGG + Intronic
944366777 2:198930195-198930217 CTTGAGGATTAGTAAGTGGAAGG - Intergenic
945213726 2:207411690-207411712 CCTGAGGAGAGGAAAAGAGACGG - Intergenic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945491036 2:210455501-210455523 ACTGAGGACAAGTAAGTGGTTGG - Intronic
946077648 2:217088260-217088282 CATGAGGAGATGAAAGCAGATGG - Intergenic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
947044968 2:225971387-225971409 CCTGAGAAGGAGAAAGTTAATGG + Intergenic
948727939 2:239946163-239946185 GCTGAGGAGGAGCAAGTGGGAGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169025274 20:2365493-2365515 CTGGAGGAAAAAAAAGTGGATGG - Intergenic
1169524266 20:6406314-6406336 CCTGAGAAGAATAAAGTTGGAGG - Intergenic
1169597253 20:7214279-7214301 CCTGAGGAGAGGAGAGGAGAGGG + Intergenic
1170286391 20:14714389-14714411 ACTGTGGAGAACAGAGTGGATGG - Intronic
1170376730 20:15708523-15708545 AGTGAGGAGAAGATAGTGGGAGG + Intronic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1171933538 20:31250933-31250955 GCTGAGGAGGAGAAAAAGGAGGG - Intergenic
1172057035 20:32161254-32161276 CCTGAGGAGGAAACAGAGGAAGG - Exonic
1172903100 20:38349204-38349226 CCTGTGTAGAAGAAACTGGAAGG - Intronic
1172957591 20:38771947-38771969 CCTGGGGAGAACAAAGTTAAGGG + Exonic
1173334467 20:42101531-42101553 CCTGATGACAAGAAAGTGGGGGG + Intronic
1174400250 20:50272154-50272176 TCTGAGCAGAAGGAAGTGGGTGG - Intergenic
1175060143 20:56234445-56234467 TATGATGAGAAGAAAATGGAAGG - Intergenic
1175076648 20:56380564-56380586 CTTAAGGAGTAGAGAGTGGATGG - Intronic
1175396039 20:58662387-58662409 TCTGAGGGGAAGAAAAAGGAGGG - Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1175979812 20:62732862-62732884 CCCGAGGAAAAGCAAGCGGAGGG - Intronic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1179712439 21:43271148-43271170 CCTGCGGAGGAGGATGTGGAGGG + Intergenic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1179936316 21:44606864-44606886 CCAGAGGAGAGGAATGGGGAAGG + Intronic
1180579954 22:16824738-16824760 CCAAAGGAGAAGGAAGTGGTTGG - Intergenic
1181853339 22:25765589-25765611 ACTGAGGCCAAGAAAGGGGAAGG - Intronic
1182045463 22:27270732-27270754 GGTGAGGAGAAGGGAGTGGAGGG + Intergenic
1182584313 22:31335146-31335168 CCTTGAGAGAGGAAAGTGGAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183328161 22:37205484-37205506 TGTGAGGAGAAGGAAGAGGAAGG - Exonic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1184244828 22:43230672-43230694 CCTGAGGAGAAGACAGGGCCAGG + Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184961368 22:47931218-47931240 CCTGAGTAGAAGAGATAGGATGG + Intergenic
1185091590 22:48778635-48778657 CAGGAGGAGAGGGAAGTGGAGGG + Intronic
1185311772 22:50160067-50160089 GCTGAGGAGCAGAGAGTGGGAGG + Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950583039 3:13875159-13875181 ACTGAGGAGAAGCCACTGGAGGG + Exonic
950710419 3:14809951-14809973 CCTGAGGAGGTGACATTGGAAGG - Intergenic
950725850 3:14916498-14916520 CCTGAGGACAGGGAAGTGGTGGG - Intronic
950973043 3:17209060-17209082 TCTGGGGAGAAAGAAGTGGAGGG - Intronic
951276728 3:20696520-20696542 TATGAAGAGAATAAAGTGGATGG + Intergenic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
952655983 3:35785935-35785957 GGTGAGGAAAAGAAAGAGGATGG + Intronic
953237222 3:41117435-41117457 CCATAGGAGAAAAAAATGGATGG + Intergenic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
955167439 3:56528215-56528237 CATCAGGAGAGGAAAGTGAAAGG + Intergenic
955176053 3:56613886-56613908 ACTGAGGAGACCAAGGTGGAAGG - Intronic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
956483394 3:69695751-69695773 CCTGAGGATAAGTCAGAGGAAGG + Intergenic
956739741 3:72266547-72266569 CCTGGGGAGAAGATAGGGGAAGG - Intergenic
956789969 3:72672924-72672946 TCTGTGGAAAAGAAAGGGGAGGG + Intergenic
956825264 3:72992143-72992165 CTTGAGGACAAGAAAGTGTTTGG + Intronic
957423053 3:79996872-79996894 TCTGAGGAGAAAACAATGGAAGG - Intergenic
957923809 3:86781438-86781460 TCTAAGGAGAAGGAAGTGAAAGG + Intergenic
958683265 3:97357924-97357946 GCTGAGGAGAAGAAAGAAGAGGG + Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958936430 3:100260890-100260912 CCAGAGGGGAAGAAAGAGGGAGG - Intergenic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959811494 3:110625435-110625457 CCTTATGAGAAGAAAGTCTAGGG + Intergenic
960271185 3:115676307-115676329 TCCGAGGAGAAGAAGGGGGAGGG + Exonic
960775200 3:121242844-121242866 CCTGTGGAGAACAAAGTCTAGGG - Intronic
960953232 3:123012992-123013014 CATGAGGAGGAGACAGTGTAAGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962662100 3:137612619-137612641 CCTGGGGAGAATGTAGTGGAGGG - Intergenic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
963941012 3:151096386-151096408 CCTGAGGAAAAAAAAGGGGGTGG - Intronic
964126039 3:153234653-153234675 CCTGAGGAAAAGAAAGATGAAGG - Intergenic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
966123607 3:176549895-176549917 CCTGGTGAGAATAAACTGGAGGG - Intergenic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966450185 3:180050241-180050263 CCTGAGGAGATAAAAGAGGGTGG - Intergenic
967166414 3:186783688-186783710 CCAGGGGAGATGATAGTGGATGG + Intronic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
968356119 3:198108942-198108964 CCTGAGGAGGAGAAAGACGCGGG - Intergenic
969324442 4:6432895-6432917 GCTGAGGAGAAGGAAGAGGACGG - Intronic
969643839 4:8414617-8414639 CATCAGGAAAAGACAGTGGAAGG + Intronic
969777615 4:9369521-9369543 CCTGTGAAGAAATAAGTGGAAGG + Intergenic
970200651 4:13601215-13601237 GGTTAGGAGAAGAAAGTGAAGGG - Exonic
970513230 4:16801454-16801476 CCAGAGGAGAAGGAAATTGAAGG + Intronic
971468890 4:26997810-26997832 CCTGTGGAGAAGATAAAGGAAGG + Intronic
971482591 4:27127634-27127656 CCTGATGAGAAGAAACGGGGTGG - Intergenic
972079288 4:35130108-35130130 TCTGAGGAGAAGACAGTGATTGG - Intergenic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972279511 4:37588548-37588570 GATGAGGAGAAGAAGGTGGAAGG - Intronic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972383713 4:38543339-38543361 CCTGAGGAGAAGGAGGGAGATGG + Intergenic
972457990 4:39272810-39272832 GTTGAAGAGAAAAAAGTGGAGGG + Intronic
972620420 4:40743280-40743302 GGAGAGGAGAAGAAAGTGGCTGG - Intergenic
972655861 4:41063177-41063199 CCTATGTAGAAGAAAGTTGAAGG - Intronic
972697293 4:41459909-41459931 CCTGAGGCGAAGATAGGGAAGGG + Intronic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973832489 4:54775599-54775621 GGTGAGGAGAAGAAAGTCAAAGG + Intergenic
973849528 4:54947455-54947477 CCTGAAGAGAACAAAGAGGCTGG - Intergenic
975663048 4:76706530-76706552 GCTGAGGAGGAGTAAGAGGATGG + Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975794243 4:77989394-77989416 GCTGGGGAGAATGAAGTGGAAGG - Intergenic
975985122 4:80195991-80196013 GCTGAGGAGAAACAAGTGCAAGG - Exonic
977489800 4:97697890-97697912 CCTCACGAGAAGAAAAGGGATGG - Intronic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
979068488 4:116169587-116169609 CCATAGGAGAAGAAAGAGAAAGG - Intergenic
979456306 4:120929417-120929439 GCTGAGGAGAAGGAAGAGAAGGG + Intergenic
979469832 4:121082342-121082364 CCAGAGGAGAAGCAAATAGAAGG - Intergenic
979523033 4:121690040-121690062 CCAGAGGAGAAGGAAAGGGAAGG + Intronic
980487524 4:133478526-133478548 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
980723581 4:136728190-136728212 CTTGAGGAGAAGAAAGAGTGGGG - Intergenic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
982691573 4:158553431-158553453 CCTGAGTAGGAGAGAGGGGATGG + Intronic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983701113 4:170595117-170595139 CTTGTGTAGAAGACAGTGGAAGG + Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
986314747 5:6579136-6579158 CCTGAAGAGAAAAATGTGGATGG - Intergenic
986845033 5:11742251-11742273 CCTGAAGAGAAGGAACAGGACGG - Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987027253 5:13939963-13939985 CCTGGACAGAAGAAAATGGATGG - Intronic
987028418 5:13951739-13951761 GCTGTGGAAAGGAAAGTGGAGGG + Intergenic
987072954 5:14355021-14355043 ACTGAGGAGAGGAAGTTGGAAGG + Intronic
987243592 5:16026274-16026296 CCTGAGAACAAGAAAGCTGATGG + Intergenic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987726660 5:21709404-21709426 CCTGAGGAGAAGGAAAGAGATGG - Intergenic
988976972 5:36525467-36525489 TAGGAGGGGAAGAAAGTGGATGG - Intergenic
988977281 5:36527754-36527776 TAGGAGGGGAAGAAAGTGGATGG - Intergenic
989051708 5:37326953-37326975 GCTGAGGAGTAGGAAGAGGAAGG - Intronic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
989948955 5:50274263-50274285 GTTGAGGAGAAGGAAGTGAAGGG + Intergenic
991186009 5:63808550-63808572 TCTGAGGAAAAGAAAGAGAATGG - Intergenic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994313257 5:98301728-98301750 TCTGTGGAGAAGAAAGTGGGGGG + Intergenic
994815964 5:104589065-104589087 CATGAGGAGTAGTAAGTAGATGG + Intergenic
994938381 5:106286566-106286588 GCTGAGGAGAGGGAAGAGGAGGG - Intergenic
995078063 5:108011499-108011521 TCTCAGGAGAAGAAAGTTAATGG + Intronic
995367003 5:111373645-111373667 CCTCAGGAGAAGTAACTGAAAGG + Intronic
995425294 5:112014613-112014635 TTTAAGGAAAAGAAAGTGGAGGG - Intergenic
995907502 5:117143111-117143133 CCAGGGGAGAGGGAAGTGGAGGG - Intergenic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997835455 5:137188601-137188623 CCTGAGGAGAGGAAAACAGATGG - Intronic
998503391 5:142652866-142652888 CCAGGGCAGAAGGAAGTGGAGGG - Intronic
998512126 5:142722374-142722396 TCTGAGGCCAAGAAATTGGATGG + Intergenic
999284464 5:150386002-150386024 ACTGAGGATCAGAAAGTTGAGGG + Intronic
999322860 5:150625620-150625642 CCAGAGGTGAAGTTAGTGGAGGG + Intronic
999383795 5:151140243-151140265 CCTGTGGAGAAAAAAGTAGAGGG + Exonic
1000922083 5:167150161-167150183 AGTAAGCAGAAGAAAGTGGATGG - Intergenic
1001073436 5:168606298-168606320 CCTGATGAGAAGGAAGAGGTAGG - Intergenic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1001426097 5:171623691-171623713 GCTGGGGAGAAGACAGAGGAGGG + Intergenic
1001455358 5:171855950-171855972 GCTGAGGAGAAGGAAGTAGTGGG + Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002862905 6:1095766-1095788 CATGAGGACATGAAAGTGGAGGG + Intergenic
1002985067 6:2181770-2181792 CCTGAGGAGAGGGAAGAGGGAGG - Intronic
1003616408 6:7658980-7659002 GCTGAGAAGACGAAAGTCGAGGG + Intergenic
1003775165 6:9352280-9352302 CCAGAGCAGGAGAAAGAGGAGGG - Intergenic
1003897175 6:10618143-10618165 TCTGAGGCGCAGAAAGTGGCAGG - Intronic
1006396468 6:33790460-33790482 CCTGAGGTGGAGCAAGTGGCAGG - Intergenic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008142267 6:47845636-47845658 CGTGAAGAGAAGAGAGTGGCAGG - Intergenic
1008296750 6:49787294-49787316 AGTGAGGAGAAGAAAGGGGCGGG - Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1010515924 6:76772519-76772541 CCTGAGGATGACAAAGTGTATGG - Intergenic
1011149099 6:84249350-84249372 CCTGAGGGTAAGAGAGTGGAGGG - Intergenic
1011650876 6:89505082-89505104 CCTGCAGAGAAGAAAGGGCAAGG - Intronic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1012564890 6:100636429-100636451 CCTGAGGAGAAGGAAAGAGATGG - Intronic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1017191709 6:151661339-151661361 CCAGATGAGAGGCAAGTGGAGGG + Intronic
1017213371 6:151881277-151881299 ACTGAGGTTAAGAAAGTGGCTGG - Intronic
1017657604 6:156645169-156645191 CCAAAGGAGGAGAAAGTGAATGG + Intergenic
1017728578 6:157294234-157294256 GCTGATGAGAAAAAATTGGAAGG - Intronic
1018426267 6:163685520-163685542 CCAGAGGAAAAGAAACTGGTAGG - Intergenic
1018787665 6:167121075-167121097 CCAGAGGGGAAGGTAGTGGATGG - Intergenic
1019357268 7:587219-587241 CCTCAGGAGAAGAAAGTTTGGGG - Intronic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1020733120 7:11909662-11909684 CCTGAGTAGAACAAAATGGCTGG + Intergenic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021668270 7:23010259-23010281 CCTGAGGAGATAGAAGTGAATGG - Intronic
1021842207 7:24729866-24729888 CCTGTGGAGAATCAACTGGAAGG + Intronic
1021849754 7:24795874-24795896 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022441462 7:30436617-30436639 CCTGAGGACAAGGAAGGGGCAGG + Intronic
1023178452 7:37456629-37456651 ACTGAGGAGATTAAAATGGAAGG - Intergenic
1023229985 7:38017369-38017391 CCTGATGAAATGAAATTGGATGG - Intronic
1023548991 7:41348643-41348665 TCTGAAGTGAAAAAAGTGGATGG + Intergenic
1024413058 7:49069458-49069480 GCTGAGGAGAAGGAAGAGAAGGG - Intergenic
1026037122 7:66837746-66837768 CCTGAGGAGAGGCCCGTGGAGGG - Intergenic
1026858826 7:73771543-73771565 TCTGAGGGGAAGAGAGGGGATGG - Intergenic
1027419406 7:78004976-78004998 CATGAGGAGGAGAAAGTCCAGGG + Intergenic
1027456700 7:78401226-78401248 CATGAGGAAAACAAAATGGAAGG + Intronic
1030061029 7:105621451-105621473 ACTAAGGAGAAGGAAGAGGATGG - Intronic
1030098737 7:105925415-105925437 CCTGAGGAGAGGAAAGAGATGGG + Intronic
1030347856 7:108454928-108454950 CCTGATGCGAAGAAAAGGGAAGG + Intronic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1030863615 7:114670297-114670319 CCTTAGGAGAAGAAAATAAAAGG + Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031418237 7:121518642-121518664 GATGAAGAGAAGAGAGTGGAAGG + Intergenic
1032917510 7:136509331-136509353 TCTGAGGAGATGAGAGTGGCAGG - Intergenic
1033512118 7:142069479-142069501 TCTGAGGAGAACATAGTTGAGGG + Intronic
1033520822 7:142158702-142158724 CCTGTGGAGAAGAAAAGGGAGGG + Intronic
1033734879 7:144212226-144212248 TCTGAGGAGAAGAAAGTACCAGG - Intergenic
1033748176 7:144338743-144338765 TCTGAGGAGAAGAAAGTACCAGG + Intergenic
1034531901 7:151701085-151701107 CCTGAGGAGTGGGAGGTGGAAGG - Intronic
1035521866 8:281061-281083 GATGAGGAGAAGAAAGAAGACGG + Intergenic
1035989912 8:4478024-4478046 ACAGAGGAGATGAAAGTGAATGG - Intronic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1037219352 8:16499027-16499049 CATGAGGACAAGAAAGTGAGAGG - Intronic
1037525547 8:19720692-19720714 TCTGAGAACAAGCAAGTGGATGG - Intronic
1038152216 8:24952847-24952869 GAGGAGGAGAAGAAAGTTGAAGG - Exonic
1039163438 8:34648816-34648838 CTGGAGGAGAAGAAAATTGAGGG - Intergenic
1041303478 8:56437139-56437161 TCTTAGGAGAAGATAGGGGAGGG - Intronic
1041581783 8:59469168-59469190 CCTGAGGAAATAGAAGTGGAAGG - Intergenic
1043614025 8:82103372-82103394 AGTGGGCAGAAGAAAGTGGAAGG + Intergenic
1043715439 8:83479228-83479250 CATGAGGAAAATAAAGTGGTGGG + Intergenic
1043783809 8:84371090-84371112 CGTGAGGAGGAGCAAGAGGATGG - Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045292551 8:100846352-100846374 TCAGAGGAGAAAAAAGTGGCAGG - Intergenic
1045462335 8:102436365-102436387 CCAGAAGAGAGGAAAATGGATGG + Intergenic
1046304448 8:112345539-112345561 ACTCAGGAGTAGAAAGTAGAAGG + Intronic
1046530600 8:115440283-115440305 CCTGAGAAGTAGAAAATGTAAGG + Intronic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1047741470 8:127810183-127810205 CCTGGGGAGAGGAAAGAAGAGGG - Intergenic
1048103222 8:131378302-131378324 CCTCAGGGGATGAGAGTGGAGGG + Intergenic
1048234472 8:132675944-132675966 ACTGAGGAGAAGGAAGTGTAAGG - Intergenic
1048433384 8:134391477-134391499 CCTGAGGATAGGGAAGTAGATGG - Intergenic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049816680 8:144606350-144606372 GCCGAGGAGAAGGAAGAGGAAGG - Intergenic
1049892689 9:85134-85156 CATGGGGAGAAGAAACTGAAAGG + Intergenic
1050098015 9:2087641-2087663 TCTTAAGAGAAGACAGTGGAAGG - Intronic
1050867373 9:10519891-10519913 CCTGAGGAGAGGGAAATTGATGG - Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1051669292 9:19494177-19494199 CCTCAGGAGAAGAAATTGTCAGG - Intergenic
1051831391 9:21282211-21282233 CCTTAGGAGAAGTGAGTGAAGGG - Intergenic
1052572476 9:30244238-30244260 CCTTAGGAAAATAAAGTGCAGGG + Intergenic
1052825046 9:33167915-33167937 CCTGCGGCAAAGAAAGTGGACGG + Intergenic
1052946846 9:34175521-34175543 CCTGAGGAGTAGAGAGGAGAGGG - Intergenic
1053347400 9:37387876-37387898 CCTGAGGAGAGGAGAGGGGCAGG - Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053501094 9:38592881-38592903 TCTGTGGAGACAAAAGTGGATGG + Intergenic
1053733918 9:41085189-41085211 CATGGGGAGAAGAAACTGAAAGG + Intergenic
1054694488 9:68346359-68346381 CATGGGGAGAAGAAACTGAAAGG - Intronic
1057969142 9:99536637-99536659 CCTGGAAAGAAGAAAGTAGAAGG + Intergenic
1058001281 9:99868628-99868650 CCTGAGGTAAAGAAATGGGAAGG - Intergenic
1058373284 9:104294538-104294560 CCTGAAGATTAGAAAGTAGAAGG - Intergenic
1058604332 9:106704634-106704656 CCAGAGGAGATGAAAATGGGAGG + Intergenic
1058759283 9:108114566-108114588 GCTGAGGAGAAGGAAGAGAAAGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059002793 9:110367563-110367585 CCAGAAGAAAAGAAAGTGGGAGG - Intronic
1059501173 9:114755559-114755581 ACTCAGGAGAAGAAATTGGTCGG - Intergenic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1060447838 9:123707941-123707963 CTTGAGTAGACGAAAGGGGATGG + Intronic
1061074707 9:128334012-128334034 CCTGAGAAGAGAGAAGTGGAGGG + Exonic
1061087722 9:128409130-128409152 CCTGAGGTCAAGAATGTGGCTGG + Intergenic
1062300219 9:135862466-135862488 CCAGAGCAGATGAAACTGGATGG - Exonic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186612696 X:11153709-11153731 ACTTAGGAGAAGAAAGTGTTTGG - Intronic
1187620089 X:21042959-21042981 GCTGAGGAGTAGGAAGAGGAGGG + Intergenic
1188411252 X:29874440-29874462 GCTGAAGAGAAGAGAGTGGGAGG - Intronic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1190178421 X:48170570-48170592 CATGAGGAGAGGAGAGTAGAGGG + Intergenic
1190726092 X:53191868-53191890 CTTGAGGAGGATAAACTGGAGGG + Intronic
1190894104 X:54598910-54598932 TATGAGGAGAAGAAAGAGAATGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192539931 X:71959165-71959187 CCAGAGGATAGGAAAGAGGATGG + Intergenic
1192733323 X:73823473-73823495 CCTGAGGATAAGAGAGATGAGGG - Intergenic
1193867787 X:86757714-86757736 CAGGAGGAGGAGAAAGTGAAGGG - Intronic
1195513468 X:105744731-105744753 CCTGAGAATAAGGAAGTGGTAGG - Intronic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1197161190 X:123324083-123324105 CCTGAGGAAAAGAATGTTAAAGG + Intronic
1197807848 X:130414599-130414621 CCTCTGGAGAAGAAATAGGAAGG + Intergenic
1197962958 X:132025011-132025033 CCTGAGAGGAAGAAAGTTTAAGG - Intergenic
1198606073 X:138339220-138339242 ACAGAGGAGAAGGAAGTGAAAGG - Intergenic
1198636142 X:138702865-138702887 GATGAGGAGAAGAATGTTGATGG - Intronic
1198757403 X:139995837-139995859 CCTGAGGAGGAGATAGCTGAGGG + Intergenic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1199614090 X:149641592-149641614 GCTGAGGAAAAGGAAGAGGAGGG + Intergenic
1199893385 X:152110042-152110064 CCTGAGGGAAAGAAGGGGGAAGG - Intergenic
1200826494 Y:7650211-7650233 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201060854 Y:10045400-10045422 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202073279 Y:21014724-21014746 CATCAGGAGTAGAAAATGGAAGG - Intergenic
1202077979 Y:21056578-21056600 CATCAGGAGTAGAAAATGGAAGG - Intergenic
1202106793 Y:21379280-21379302 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202200088 Y:22337126-22337148 CCTGAGGAGAAAAATGAGCAAGG - Intronic