ID: 997584788

View in Genome Browser
Species Human (GRCh38)
Location 5:135037870-135037892
Sequence TACTGGGTAAGTGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 355}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997584775_997584788 17 Left 997584775 5:135037830-135037852 CCTCCCCAATAAAAGCTCCCGTT 0: 1
1: 0
2: 2
3: 9
4: 70
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584776_997584788 14 Left 997584776 5:135037833-135037855 CCCCAATAAAAGCTCCCGTTTCT 0: 1
1: 0
2: 0
3: 11
4: 102
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584774_997584788 18 Left 997584774 5:135037829-135037851 CCCTCCCCAATAAAAGCTCCCGT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584773_997584788 19 Left 997584773 5:135037828-135037850 CCCCTCCCCAATAAAAGCTCCCG 0: 1
1: 0
2: 2
3: 9
4: 104
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584779_997584788 0 Left 997584779 5:135037847-135037869 CCCGTTTCTTTGAATACAGCAAT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584772_997584788 20 Left 997584772 5:135037827-135037849 CCCCCTCCCCAATAAAAGCTCCC 0: 1
1: 0
2: 1
3: 18
4: 287
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584777_997584788 13 Left 997584777 5:135037834-135037856 CCCAATAAAAGCTCCCGTTTCTT 0: 1
1: 0
2: 0
3: 14
4: 143
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584778_997584788 12 Left 997584778 5:135037835-135037857 CCAATAAAAGCTCCCGTTTCTTT 0: 1
1: 0
2: 0
3: 11
4: 204
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355
997584780_997584788 -1 Left 997584780 5:135037848-135037870 CCGTTTCTTTGAATACAGCAATT 0: 1
1: 0
2: 4
3: 52
4: 719
Right 997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997584788 Original CRISPR TACTGGGTAAGTGGGGAGGA GGG Intronic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900706435 1:4083067-4083089 TCTTGGGGAAGTGGGCAGGAGGG + Intergenic
900718594 1:4160715-4160737 TGCTGGGTAAGTCGGCAGGCTGG + Intergenic
901148935 1:7087472-7087494 CCCTGGGTCAGTGGGGAGCAGGG + Intronic
901863202 1:12087849-12087871 GAGAGGGGAAGTGGGGAGGAGGG - Intronic
902381876 1:16056558-16056580 GACTGGGGAGGTGGGGAGGTGGG + Intronic
903174091 1:21570369-21570391 TATTGGGTAAGTGGAGGGGGTGG + Exonic
903563064 1:24243462-24243484 GCCAGGCTAAGTGGGGAGGATGG + Intergenic
903703976 1:25271593-25271615 TACATGGTAAGTGTCGAGGAAGG - Intronic
906647537 1:47486498-47486520 TGCTGTGTGAGTGAGGAGGAGGG + Intergenic
906661964 1:47589429-47589451 TTCTGGGTAAGAGGATAGGATGG - Intergenic
907372511 1:54012374-54012396 GGCTGGGGCAGTGGGGAGGATGG + Intronic
907478475 1:54724995-54725017 TACTGTGGAACTGGAGAGGAGGG - Intronic
910021543 1:82596010-82596032 TCCTGGGTAGGTGGCGGGGAGGG + Intergenic
911390336 1:97233354-97233376 TACTGCAGAAGGGGGGAGGACGG + Intronic
911764799 1:101661548-101661570 TCCTGGGTCAGTGGGAAGGCAGG + Intergenic
912114991 1:106394745-106394767 TGCTGGAGAAGAGGGGAGGAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912510054 1:110183453-110183475 TACTGGGCTTGTGGGGAGGTTGG + Intronic
914351479 1:146843700-146843722 TCCTGGTTAAGAGGGGAAGACGG + Intergenic
916429741 1:164715996-164716018 TAGTGGGGAGGTGGTGAGGAGGG + Intronic
917185080 1:172344554-172344576 CACTGGGAAAGTGGGTGGGAAGG - Intronic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917495100 1:175533443-175533465 TGTCGGGTGAGTGGGGAGGAAGG - Intronic
918214785 1:182384153-182384175 TAGTGCATTAGTGGGGAGGAGGG - Exonic
920231902 1:204476224-204476246 AATTGGGGAAGTGGGGAGGCAGG - Intronic
920374261 1:205498849-205498871 TACTAGGTAAGTGGTGAAGGAGG + Intergenic
920729702 1:208471645-208471667 TAGTGGCCAAGTGGGGAGGGAGG + Intergenic
920867814 1:209767978-209768000 TAGGGGGTTGGTGGGGAGGAGGG - Intronic
921133527 1:212239763-212239785 TACAGCATAAGTAGGGAGGAAGG - Intergenic
922448472 1:225717667-225717689 TACTGGGTTAGTGGTCAGGAGGG - Intergenic
922788280 1:228294556-228294578 TCCTGGATAAGAAGGGAGGAGGG - Intronic
922876099 1:228940863-228940885 TACTGGGGTGGTGGGGAGCAAGG + Intergenic
1063169491 10:3494814-3494836 TAGGGGGAAGGTGGGGAGGATGG + Intergenic
1063260986 10:4389237-4389259 TGGTGGGGAGGTGGGGAGGAGGG + Intergenic
1064957705 10:20929739-20929761 GACTTGGAAAGTGGGGAGGGTGG + Intronic
1065874110 10:29982398-29982420 TAAGGGGTACGTGGGGAGGAGGG + Intergenic
1066298219 10:34074755-34074777 AGCTGGACAAGTGGGGAGGAAGG + Intergenic
1067779350 10:49188277-49188299 TCCTGGGTAAGTGGGGACTGCGG - Exonic
1068244743 10:54350269-54350291 TACTGGCTGACAGGGGAGGATGG + Intronic
1069466736 10:68646633-68646655 CACTGGTTAGGTGGAGAGGAGGG - Exonic
1069855371 10:71437868-71437890 TGCTGGGTGGGTGGGGATGATGG - Intronic
1070326342 10:75391886-75391908 TTCTGGGTTACTGGGGAGAAGGG - Intergenic
1072431110 10:95371154-95371176 AACTGGGTAGGTGTGGGGGAAGG + Intronic
1072445970 10:95498989-95499011 CACTGGGGAAGTGGGGTGAAGGG + Intronic
1072633220 10:97161201-97161223 TGCTGGGAAGGAGGGGAGGAGGG - Intronic
1073244676 10:102081318-102081340 CAGTGTGTTAGTGGGGAGGATGG - Intergenic
1073331732 10:102674393-102674415 CACGGGGTAGGTCGGGAGGAGGG + Exonic
1074067712 10:110032475-110032497 GACTGGGGAAGTGGGCAGCAGGG + Intronic
1075494900 10:122911578-122911600 TAGTGGCTGTGTGGGGAGGAAGG + Intronic
1076566763 10:131404317-131404339 TATTGGGTGAGTGGGCAGAATGG - Intergenic
1077271989 11:1685719-1685741 GACTGAGCAGGTGGGGAGGAAGG - Intergenic
1079123190 11:17699476-17699498 TACTTGGTAGGTGAGGAGCAGGG + Intergenic
1079309939 11:19356265-19356287 TATAGGGTCAGGGGGGAGGATGG + Intronic
1080191346 11:29552895-29552917 GACTGGGTGTGTGGTGAGGAGGG + Intergenic
1081488739 11:43550576-43550598 TTCTGGGTAACTGGGGCTGAAGG - Intergenic
1081644710 11:44781655-44781677 TGCTGGGTAAGTGTGTATGAAGG - Intronic
1083348939 11:62013523-62013545 TATTTGGCAGGTGGGGAGGAAGG - Intergenic
1084719197 11:70893323-70893345 TGCTGGGTATGTGGTGGGGAGGG - Intronic
1085029781 11:73264198-73264220 TTCTGGGATAGTGGGGAGGAGGG - Intergenic
1085043599 11:73340991-73341013 TGCTGGGCATGTGGGGAGAAGGG + Intronic
1086088395 11:82980169-82980191 TGCTGGCTTAGTGGAGAGGATGG + Exonic
1086233934 11:84604352-84604374 TCCTGGGGCAGTGGGGAGTAGGG + Intronic
1086391918 11:86374398-86374420 AGCTGGAGAAGTGGGGAGGAGGG - Intergenic
1087137971 11:94739700-94739722 AACAGGGTCAGTGGGAAGGAAGG - Intronic
1088827729 11:113509829-113509851 AACTAGGAAAGTGGGGAGGAGGG - Intergenic
1088904240 11:114142278-114142300 TACTGGGGAAGGGGGTGGGAAGG - Intronic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089502409 11:118940343-118940365 GGCTGGGGAAATGGGGAGGAAGG + Intronic
1090472825 11:126995584-126995606 TACTGGAGGAGTGAGGAGGAGGG - Intronic
1090521649 11:127486271-127486293 CACTGGGGAAGAGGGTAGGAAGG + Intergenic
1090909874 11:131109642-131109664 TTCTGGGTGCGTGGGGAGGGTGG + Intergenic
1091146573 11:133285213-133285235 CACAGGGTATGTGGGGAGGAGGG + Intronic
1092085601 12:5756673-5756695 TGCTGGGTATGTGGGCAGGTGGG + Intronic
1092283355 12:7114017-7114039 TACTGGCAGAGTAGGGAGGATGG - Intergenic
1095658994 12:44706940-44706962 AACTGGAAAAGAGGGGAGGATGG + Intronic
1095724349 12:45435532-45435554 TGCAGGGTAGGTGGGAAGGAAGG - Intronic
1095976346 12:47943138-47943160 TCCTGGCGCAGTGGGGAGGAGGG - Intergenic
1096498800 12:52053509-52053531 GACAGGGCAAGGGGGGAGGAAGG - Intronic
1096622792 12:52874798-52874820 TTCTGGGGAAGTGGGGTGTAGGG - Intergenic
1097479104 12:60098896-60098918 TACTTGGTATGTGGGGAGGAAGG + Intergenic
1097978397 12:65712084-65712106 TACTGGGTAGGTGGGAGAGAGGG + Intergenic
1099960397 12:89391614-89391636 TTCTGGGTAAGTGGTTTGGATGG - Intergenic
1100407305 12:94282898-94282920 TACTGGGTGAGTGCCGAGGGCGG + Intronic
1100788976 12:98109550-98109572 GTTTGGGTGAGTGGGGAGGAGGG + Intergenic
1100867319 12:98870613-98870635 TACCAGTTAATTGGGGAGGATGG - Intronic
1102795289 12:115683874-115683896 GAATGGGTCAGTGGGGAGGTAGG + Intergenic
1102987969 12:117294112-117294134 AACTGGGTATGTAGGGAGAATGG - Intronic
1103457866 12:121080285-121080307 TACTGGGGCAGTAGGGAGCAGGG - Intergenic
1104396401 12:128437429-128437451 TCCTGGGTAAGTACAGAGGAAGG - Intronic
1105578238 13:21672290-21672312 TACAGAGAAAGAGGGGAGGAGGG - Intronic
1107578853 13:41759899-41759921 TAATGGGTATTTGGGGAGGGAGG - Intronic
1107898917 13:44992946-44992968 GACTGGGTCAGAGGGGAGAATGG - Intronic
1108396107 13:49993426-49993448 GTCTGGGTAGGTGGGGAGGAAGG + Intergenic
1108561328 13:51646932-51646954 TTTGGGGGAAGTGGGGAGGAAGG + Intronic
1108690735 13:52857181-52857203 AATGGGGCAAGTGGGGAGGAAGG + Intergenic
1109043177 13:57369403-57369425 GACTGGGGGAGTGGGAAGGATGG + Intergenic
1109423337 13:62142296-62142318 TACTGGGTAAGTCAGGATGGTGG - Intergenic
1111464769 13:88594641-88594663 GACTGCGTAAGTGGGATGGAAGG - Intergenic
1111634552 13:90887185-90887207 TACTGGGGAATGGAGGAGGAGGG + Intergenic
1112204336 13:97309197-97309219 TATTTGGTAAGTGGGGACAATGG + Intronic
1113374196 13:109748985-109749007 TAATGGGTGAGTGGGGAGGAAGG + Intergenic
1113569022 13:111339951-111339973 TACTGGGAGGGTGGGGAGGAGGG + Intronic
1114288565 14:21269281-21269303 TTCTTGGTAAGTGGAGAGGGCGG - Exonic
1114371486 14:22093941-22093963 TGATGGGTAAGTAGGAAGGACGG + Intergenic
1114612891 14:24053811-24053833 CACTGGGCATGTGGGGAGGGAGG + Intronic
1116701701 14:48252862-48252884 TACTGGGTAACAGGTGAGGTTGG - Intergenic
1117028054 14:51641847-51641869 TATGGGGAAAGCGGGGAGGAGGG - Intronic
1118289953 14:64510597-64510619 TACTGGATGTGTGTGGAGGAGGG + Intronic
1119759704 14:77141725-77141747 TAGCGGGGATGTGGGGAGGAGGG + Exonic
1119955467 14:78794057-78794079 TACTGGGTAAATTTGCAGGAGGG + Intronic
1120762001 14:88293430-88293452 GACTGAGTAACTTGGGAGGATGG - Intronic
1121037947 14:90722272-90722294 TACTAGGAAGGTGGGGATGATGG - Intronic
1125489683 15:40137238-40137260 TGCTGGGCAAGTGGGGAGTCTGG + Intergenic
1126047045 15:44651608-44651630 TACTTGGGAAGTGGAAAGGATGG - Exonic
1126111305 15:45176449-45176471 TGCCGGGTCCGTGGGGAGGATGG - Intronic
1126231048 15:46325486-46325508 AACTGGGTAAGTAGCCAGGAAGG + Intergenic
1127295801 15:57607727-57607749 AACTGGGGTAGAGGGGAGGAGGG + Intronic
1127313822 15:57776461-57776483 TGCTGGGAGGGTGGGGAGGAGGG + Intronic
1127494289 15:59495198-59495220 GACTGGGGAACTGGGGAGGCTGG - Intronic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1128233581 15:66052106-66052128 TAATGGGAAAGTGGGGATGATGG - Intronic
1128498309 15:68210617-68210639 TCCTGGGTAAGATGGGAGGGTGG + Intronic
1129940799 15:79495250-79495272 TGCTGGGGAAGTGGGAAGCAGGG + Intergenic
1130821768 15:87503340-87503362 CCCTGGGTGAGTGGGGAGCAGGG + Intergenic
1131563208 15:93462269-93462291 TACAGGGAAAGAGGGAAGGAGGG - Intergenic
1132575377 16:661496-661518 CACTGGGTCAGTGGGAGGGAGGG + Exonic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1135276508 16:21117863-21117885 AACTGGGTAGTAGGGGAGGAGGG - Intronic
1135904664 16:26500189-26500211 AACTGGGTACATGGGGAGGGAGG + Intergenic
1136140284 16:28283930-28283952 TGCTGGGGCAGTGGGGAGGAGGG - Intergenic
1136281026 16:29211452-29211474 GACTGGGAGAGTGGGGAGCAGGG - Intergenic
1136361065 16:29780083-29780105 GACTGAGGAAGAGGGGAGGAAGG - Exonic
1138307913 16:55995109-55995131 TGTTGGGTGGGTGGGGAGGAGGG + Intergenic
1139470062 16:67173633-67173655 GACTTAGTAAGTGGTGAGGATGG + Intronic
1139552150 16:67680003-67680025 TACTTGGAAAGCTGGGAGGAAGG - Intronic
1139587987 16:67916613-67916635 TTCTGGGTAATGGAGGAGGAAGG + Intronic
1139982556 16:70871838-70871860 TCCTGGTTAAGAGGGGAAGACGG - Intronic
1141223559 16:82093855-82093877 TTCTGGGAAAGTGGGAGGGATGG + Intronic
1142085384 16:88177375-88177397 GACTGGGAGAGTGGGGAGCAGGG - Intergenic
1142435608 16:90055041-90055063 TACTAGGGCAGTGGAGAGGAGGG + Intergenic
1143137197 17:4718503-4718525 TACTGCTTCAGTGGGGAGCATGG + Intronic
1143673928 17:8416745-8416767 TACAGGGGAAATGAGGAGGAAGG - Intronic
1144945320 17:18966784-18966806 TCCTGGGTCACTGGGGAGGGAGG + Intronic
1145924061 17:28632908-28632930 GCCTGGGGCAGTGGGGAGGAAGG - Intronic
1147025496 17:37579263-37579285 AACTGGCCAAGTGGGGTGGAGGG + Intronic
1147845462 17:43401349-43401371 GACTGGGGAAGTGGGGAGGATGG - Intergenic
1148058605 17:44818337-44818359 TTCTTGGTAGCTGGGGAGGAAGG + Intronic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1150229809 17:63543815-63543837 GACTGGGAGACTGGGGAGGAAGG - Intronic
1151104816 17:71600569-71600591 TACCGTGTCAGTGAGGAGGACGG - Intergenic
1153723297 18:7929752-7929774 TCCTGGGCAAGAGGGCAGGAAGG - Intronic
1153946638 18:10023793-10023815 GGCTGGGCAAGTGGGGAGCAGGG + Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1155356733 18:24960649-24960671 TGCTGTGTGAGTGGGGAGGGTGG + Intergenic
1155766170 18:29635737-29635759 TACTGGGTAGGTTGAGAAGATGG + Intergenic
1156062409 18:33096219-33096241 CACTGGGTAAATGGGGACTAGGG + Intronic
1156488073 18:37479173-37479195 CACCGGGTAGGTGGGGAGTACGG - Intronic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157383671 18:47245405-47245427 TAGTGGGTAGGTGAGGAGGCTGG + Intronic
1159005381 18:63005638-63005660 TGCTGAGGGAGTGGGGAGGAGGG - Intergenic
1159032597 18:63246674-63246696 TAGGGTGTAACTGGGGAGGATGG - Intronic
1161225307 19:3141999-3142021 TGCTGGGGAAGTGGGGAGCCAGG - Intronic
1161339273 19:3731916-3731938 AACTCTGTAAGGGGGGAGGAGGG - Exonic
1161659859 19:5539492-5539514 GACTGGGGAAGAGTGGAGGATGG - Intergenic
1163588512 19:18177119-18177141 CACTGGGTGGGTGGGGAGCAGGG - Exonic
1166287210 19:41838522-41838544 GGCTGGGTAAGTGGGTAGAATGG - Intronic
1166703205 19:44893946-44893968 TGCTGGGTCTGTGGAGAGGAGGG - Exonic
1166994684 19:46714466-46714488 TCCTGGGAAAGTGGGGGGGGGGG + Intronic
1167100072 19:47399233-47399255 TTCTGGGAAAAGGGGGAGGAGGG + Intergenic
1167793028 19:51692452-51692474 TCCTGGGTCTGTGGTGAGGAAGG + Intergenic
925955843 2:8963127-8963149 TACTGGGGAGGTGAGGTGGAAGG + Intronic
926217841 2:10916007-10916029 AGCTGGGAAAGAGGGGAGGAGGG + Intergenic
926223425 2:10951171-10951193 TGCTGGGTAAGTGAGGAGTGAGG + Intergenic
927083161 2:19650232-19650254 AACTGGGGAAGTGGGGAGGAGGG + Intergenic
927275373 2:21258054-21258076 TACAGGGGGAGTGGGGTGGAAGG - Intergenic
928509586 2:31990006-31990028 TACTAGGAAAGTGAGTAGGAAGG + Intronic
928696813 2:33857585-33857607 TACTTGTTAACTGGTGAGGATGG + Intergenic
930167963 2:48221880-48221902 TGTTGGGTAAGTGGAAAGGAAGG - Intergenic
930222222 2:48756176-48756198 TACTGGGGTAGTTGGGAGGATGG - Intronic
930251030 2:49034178-49034200 AACTGGGGAAGGGGAGAGGAAGG - Intronic
931913801 2:66931192-66931214 TTCTGGGTGGGTGGCGAGGAAGG - Intergenic
933581568 2:84132611-84132633 TACAGGCTATGTGGGGAAGAAGG - Intergenic
934503781 2:94877076-94877098 TGGTGGGGAAGTGGGGAGGGAGG - Intergenic
935461926 2:103347046-103347068 AAATGGGTAAATGGGGAAGAGGG - Intergenic
936286968 2:111188262-111188284 TACAGAGTGAGTGGGGAGGAGGG + Intergenic
936456832 2:112681654-112681676 TACTTGGGAAGTGAGGAGGGAGG + Intergenic
937094269 2:119225277-119225299 TAATGGGTAAGTGGGCGGGGTGG + Intronic
937097612 2:119245900-119245922 CACTGTGCAAGTGGGGAAGAGGG - Exonic
937248498 2:120509417-120509439 TCCTGCGTAAGTGTGGAGGCTGG + Intergenic
937966316 2:127514372-127514394 TGCTGGGTAAGCGGGAGGGAGGG - Intronic
939313467 2:140515461-140515483 TACTGGGTAGAAGGGGAGGCTGG - Intronic
939724204 2:145694911-145694933 TTCTGGGTCAGTTGGGAGAAAGG - Intergenic
939775680 2:146384694-146384716 CACAGTGTAAGAGGGGAGGAAGG + Intergenic
940948666 2:159647047-159647069 GACTGGGTAAGTGTAGAGGCTGG - Intergenic
941036563 2:160575340-160575362 TAGTGGGAAGGTGGGGATGATGG - Intergenic
941199102 2:162487468-162487490 TGGGGGGTGAGTGGGGAGGAGGG + Intronic
944814669 2:203363515-203363537 TAGGGGGAAAGTGGGGAGGTAGG - Intronic
946204042 2:218090393-218090415 TGCTGGGTGAGTGGGGAGTGTGG - Exonic
947541871 2:230985442-230985464 CACTGGGGGAGAGGGGAGGAAGG + Intergenic
948362488 2:237432851-237432873 TAGTGAGTAAGTGGGGAGGCAGG + Intergenic
948392904 2:237625608-237625630 AACAGGGAAAGTGGGGAGGAGGG + Intergenic
948512129 2:238475539-238475561 GACTGGGTAAGGGAGGAGGTTGG + Intergenic
948650992 2:239443784-239443806 TAAGGGGTGAGTGGGCAGGATGG - Intergenic
948842171 2:240657167-240657189 TTCTGGGGAGCTGGGGAGGAGGG + Intergenic
1168851545 20:980452-980474 TACTGGGGGTGAGGGGAGGATGG - Intronic
1168918269 20:1509633-1509655 TCAGGGGTAAGTGGTGAGGAAGG - Intergenic
1169055058 20:2613785-2613807 TACCAGGTAGGTGGGGAAGAGGG - Intronic
1169360949 20:4948432-4948454 TACTGGACTAGTGGGGAGCAGGG - Intronic
1169664063 20:8014959-8014981 TCCTTAGTAAGTGGGGAGCAAGG - Intronic
1169802946 20:9530037-9530059 TGCTGGGGAGGAGGGGAGGAGGG + Exonic
1170059369 20:12243530-12243552 TCTTGGGGAAGTGGGGAGCAGGG - Intergenic
1172599413 20:36173600-36173622 GACAGAGGAAGTGGGGAGGAGGG - Intronic
1172980866 20:38940565-38940587 TACTGTGGAAATGGGGAGGAAGG + Intronic
1174348933 20:49952852-49952874 TTATCCGTAAGTGGGGAGGAGGG + Exonic
1174441502 20:50558973-50558995 TACTGGGAAAAGGGGGAGCATGG + Intronic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1174806669 20:53609576-53609598 TACTGGGTAAGAGAGGATTAGGG - Intronic
1175610785 20:60349455-60349477 TGATGGGTAGGTGGTGAGGAGGG - Intergenic
1175898438 20:62350511-62350533 TACAGGGGAGGTGGGGAGGCGGG - Intronic
1176199721 20:63854889-63854911 CAGTTGGAAAGTGGGGAGGAAGG - Intergenic
1176265393 20:64206546-64206568 TGCTGGGTGAGTGGTGGGGATGG - Intronic
1178456045 21:32752443-32752465 GACTGGGTGAGAGGGGAGGGAGG + Intronic
1180855640 22:19043078-19043100 TGCTGGGTGAGTAGGCAGGAGGG + Intronic
1182575568 22:31270756-31270778 GATTGGGAGAGTGGGGAGGAGGG + Intronic
1182673865 22:32021735-32021757 TAGGGGCTAAGTGGGGAGGATGG + Intergenic
1183018391 22:35008258-35008280 TCCTGGGTCACTGGAGAGGAGGG - Intergenic
1183487106 22:38094490-38094512 TACTGGGTTACTGTGGTGGAGGG + Intronic
1183561034 22:38573077-38573099 TTGTGGGTAAGTGGGGAACATGG + Intergenic
1184428996 22:44430286-44430308 GACTGGGTGGGTGGGGAGCAGGG + Intergenic
1184521124 22:44994806-44994828 TACTGCGGAAGTGGGGACGTTGG - Intronic
1184532720 22:45066665-45066687 TACCAGCTAAGTGGGGAGGAGGG - Intergenic
1185302199 22:50087716-50087738 CAGTGGGCAAGTGGTGAGGAGGG + Intergenic
950389005 3:12681788-12681810 GACTGGATAAGTGGGAAGGGAGG + Intergenic
950571130 3:13800769-13800791 AACTTGGGAAGTGGGGAGAAGGG - Intergenic
951091047 3:18574197-18574219 TCCTGAGTCAGTGAGGAGGAAGG + Intergenic
951501308 3:23390264-23390286 TACAGGATAAGTGGGGAGGGAGG - Intronic
951549067 3:23858784-23858806 TTGTGAGAAAGTGGGGAGGAGGG - Intronic
953232854 3:41079933-41079955 TTGTAGGTAAGAGGGGAGGAAGG + Intergenic
955618327 3:60833263-60833285 TCCTGGGGAAGTAGGGAGGGAGG + Intronic
955777701 3:62451166-62451188 CACTGGCTAAGTGAGGTGGAGGG - Intronic
956008547 3:64806038-64806060 TTCTGCTTAAGTGGAGAGGATGG - Intergenic
956527202 3:70178236-70178258 TGCTGGGGATGTGTGGAGGAAGG + Intergenic
961009192 3:123424638-123424660 TTCTGGGTAAGGCTGGAGGAAGG - Intronic
961057036 3:123798006-123798028 CCCTGGGAAGGTGGGGAGGAGGG + Intronic
961635720 3:128331244-128331266 TACTGAGGAAGGGGGGAAGAGGG - Intronic
961883460 3:130079918-130079940 CACTGAGTCACTGGGGAGGATGG - Intergenic
961968361 3:130930528-130930550 TAAGTGGTTAGTGGGGAGGAAGG + Intronic
962215295 3:133515720-133515742 TACTGAGTAAGTCAGAAGGATGG + Intergenic
962755930 3:138465412-138465434 TCCTGGGCAGGTGAGGAGGAGGG + Exonic
966800453 3:183758769-183758791 TAGTGCGAAAGAGGGGAGGATGG + Intronic
967663542 3:192143943-192143965 AAATGGGTAAATGGGAAGGAAGG + Exonic
967996187 3:195168541-195168563 TGCTGGGTGACTGGGGAGCAGGG - Intronic
968426700 4:528460-528482 TCCTGGCTGAGTGGGGAGTAAGG + Intronic
969079295 4:4606160-4606182 CAATGGGCAAGTGGGGAGAAGGG + Intergenic
969079303 4:4606193-4606215 CAATGGGCAAGTGGGGAGAAGGG + Intergenic
972347207 4:38202482-38202504 CTCTGGGTAAGTGTGGAGCAAGG + Intergenic
974841328 4:67302828-67302850 GAGTGTGAAAGTGGGGAGGATGG - Intergenic
976442687 4:85093730-85093752 TTCAGGGTAATTGGTGAGGAAGG + Intergenic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977593517 4:98852545-98852567 TGAGGGGAAAGTGGGGAGGAAGG - Intergenic
977655505 4:99516689-99516711 TATGGGGCATGTGGGGAGGAGGG + Intronic
980159407 4:129141252-129141274 TACATGGTAGGTGGGGAGGGAGG + Intergenic
981330522 4:143503344-143503366 TATGGAGTAAGTGGGGAGTAGGG - Intergenic
982320346 4:154070780-154070802 AAGTGGGGAAGTGTGGAGGAAGG + Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984485928 4:180369358-180369380 CACTTGGCGAGTGGGGAGGAAGG - Intergenic
984907248 4:184640113-184640135 AACTGGGAGAGAGGGGAGGAAGG - Intronic
986844674 5:11738772-11738794 TACTGGAAAATTGGAGAGGAGGG - Intronic
987043265 5:14083049-14083071 TGCTGGGTTAGTGGGAAGAAAGG - Intergenic
987211919 5:15692383-15692405 TAGTGTTTAAGTGGGGAGAATGG - Intronic
987272006 5:16319742-16319764 TCCTGGTAGAGTGGGGAGGAAGG + Intergenic
987904444 5:24057769-24057791 GAAAGGGTAATTGGGGAGGAGGG + Intronic
988783060 5:34541119-34541141 TCCTGGGTAAGTGAGGGTGATGG + Intergenic
988887747 5:35577346-35577368 CCATGGGTTAGTGGGGAGGAAGG - Intergenic
989643684 5:43606247-43606269 ACTTGGGTAAGTGGGGAGGTTGG + Intronic
990301970 5:54458456-54458478 TAGTGGGCAAGAGGGGAGAATGG + Intergenic
991436790 5:66604411-66604433 TACTGGGGAAGGGGGAATGATGG + Intronic
993929259 5:93917767-93917789 TACTGGGGGAATGGGGAGGGAGG + Intronic
994013878 5:94942189-94942211 CACTGGGTAAGTGAGGAAGATGG + Intronic
994663302 5:102678938-102678960 TACTGGTAAAGTGGGGTGAAGGG + Intergenic
995328712 5:110922041-110922063 TAATGAATAAGTGGGGAAGAAGG - Intergenic
996413271 5:123182042-123182064 ATCTGGCTAAGTGGGCAGGATGG + Intronic
997271400 5:132541255-132541277 TAGTGGGGATGTGGGGAGCAGGG - Intergenic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
997723724 5:136102724-136102746 TACTCGGAAGGTGGGTAGGATGG - Intergenic
998106424 5:139471903-139471925 TTCTGTGTGAGTGGGGAGTAAGG + Intergenic
998902001 5:146865876-146865898 AAGTGGTTAAGTGGGGAGGTGGG - Intronic
999007211 5:147996282-147996304 GAGTGGTTGAGTGGGGAGGAGGG + Intergenic
999661581 5:153869456-153869478 CACTGGGTGGGTGGAGAGGAAGG - Intergenic
1000355716 5:160392617-160392639 AAATGGGTAATTGGGCAGGAAGG + Intergenic
1000369951 5:160525596-160525618 AATTGGGTAGGTGGAGAGGAGGG - Intergenic
1001273675 5:170334581-170334603 CACTGGGAAAGTGGGGATGAGGG - Intergenic
1002968949 6:1994744-1994766 CACTGGATAGGTTGGGAGGAAGG + Intronic
1004650417 6:17602027-17602049 TAGGGGGAAAGTGGGGAGGGTGG + Intronic
1004755289 6:18603801-18603823 TACTGGGCAAGTGTGGGGGTGGG - Intergenic
1005028493 6:21487246-21487268 TGCTGGGGAAGTGCTGAGGAGGG + Intergenic
1005440381 6:25861085-25861107 TACTGGGGAAGTGTGGAAAATGG - Intronic
1006335059 6:33416064-33416086 ACCTGGTTGAGTGGGGAGGAGGG + Exonic
1006518501 6:34557619-34557641 TTCTGTGAGAGTGGGGAGGAGGG - Intergenic
1007885899 6:45229982-45230004 GACAGGGTAAGTTGGGAGGGTGG - Intronic
1007957418 6:45930137-45930159 TGGGGGGTAGGTGGGGAGGAGGG - Intronic
1009856907 6:69276461-69276483 TACAGGGCAGGTGGGGAGGAAGG + Intronic
1010124933 6:72420643-72420665 CCCTGGTTAAGTGGGAAGGATGG + Intergenic
1012124546 6:95411595-95411617 TACAGAGTAAGTGGGCATGATGG + Intergenic
1013294801 6:108749493-108749515 TACTGGGTGGGTGGGGAAGGGGG + Intergenic
1013586226 6:111581382-111581404 TACTGCTTATGTGGGTAGGAGGG - Intronic
1015550095 6:134402946-134402968 TCCTGGGAAAGAAGGGAGGAAGG - Intergenic
1016275933 6:142352456-142352478 AACTGCTTGAGTGGGGAGGATGG + Intronic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017980560 6:159397726-159397748 TAGTGGGTAAGTGGGTAGGGAGG - Intergenic
1019344722 7:523629-523651 TCCTGGGCAGGTGGGCAGGAGGG - Intergenic
1019532948 7:1512745-1512767 TACAGGGAAACTGGGGAGGAGGG + Intergenic
1019845352 7:3494132-3494154 TGTTGGGGCAGTGGGGAGGAGGG - Intronic
1020183605 7:5941879-5941901 AACTAAGGAAGTGGGGAGGATGG - Intronic
1020299308 7:6782891-6782913 AACTAAGGAAGTGGGGAGGATGG + Intronic
1021519365 7:21523752-21523774 TGCTGGGTAAGTGGTGATGGTGG + Intergenic
1022344505 7:29501351-29501373 AACTGGGTAAGAGGAAAGGAGGG + Intronic
1022991430 7:35712027-35712049 TGAGGGGGAAGTGGGGAGGAGGG + Intergenic
1023883534 7:44335086-44335108 GACTGGGAAAGGGGGCAGGAGGG - Intergenic
1026996184 7:74618204-74618226 TACTGGGTCAGAAAGGAGGAGGG - Intergenic
1027577427 7:79947658-79947680 TATTGGGGAAGTGGGGAAAATGG + Intergenic
1032396915 7:131597127-131597149 CACTGAGTAAGAGGGGAGAATGG - Intergenic
1032408949 7:131678929-131678951 TACTGTGTCAATGGGGAAGAAGG + Intergenic
1034690625 7:153010769-153010791 TACTGGGGTGGTGGAGAGGAAGG + Intergenic
1035318982 7:158016190-158016212 TACAAGGGAGGTGGGGAGGATGG + Intronic
1035351173 7:158247341-158247363 AGGTGGGGAAGTGGGGAGGAGGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035762901 8:2082598-2082620 TACTGGGCAAGTTGGGTTGATGG - Intronic
1036747469 8:11420091-11420113 TAGAGAGTAAGTGGGGAGGAGGG - Intronic
1037688278 8:21162242-21162264 GACTGGGTTATTGGGCAGGAAGG - Intergenic
1037899716 8:22680658-22680680 TTGGGGGTAAGTGGGAAGGATGG - Intergenic
1041278535 8:56188767-56188789 AACTGGGTAACTGGGAAGCAGGG + Intronic
1041844389 8:62311275-62311297 TACTGGGTAACTGTGGAGAGAGG + Intronic
1042447065 8:68897465-68897487 TACTGCAACAGTGGGGAGGAAGG + Intergenic
1047803633 8:128335700-128335722 GACAAGGTAAGTGGGGAGGAGGG + Intergenic
1047906734 8:129480626-129480648 TAACTGGTGAGTGGGGAGGAGGG - Intergenic
1047996837 8:130344844-130344866 TATGGGGGAGGTGGGGAGGAAGG + Intronic
1048272936 8:133043908-133043930 TGCAGAGGAAGTGGGGAGGATGG + Intronic
1048856901 8:138693900-138693922 CCCTGGGTAGGTGGTGAGGATGG - Intronic
1049337869 8:142096102-142096124 TCCTGGGGCAGTGGGGAAGAGGG + Intergenic
1049419006 8:142508648-142508670 GGCTGGGTAAGTGTGGAGGATGG + Intronic
1051683324 9:19631018-19631040 TAGGGAGGAAGTGGGGAGGAGGG - Intronic
1052700040 9:31926787-31926809 AAATGGGTAACTGAGGAGGAAGG - Intergenic
1056092476 9:83218346-83218368 TGCTGGGTTAGTGAGGATGAGGG - Intergenic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1058002470 9:99880139-99880161 TAATGGGTATGTGGGAAGAACGG + Intergenic
1058975387 9:110121369-110121391 GACTGGGCATGTGAGGAGGAAGG + Intronic
1059694197 9:116715463-116715485 AACTGGGAAGGTGGGGAGGAAGG - Intronic
1059946052 9:119409489-119409511 TCCTGGGTGAGCAGGGAGGAGGG - Intergenic
1060052455 9:120387020-120387042 TGCGGGGGCAGTGGGGAGGAGGG - Intergenic
1060733152 9:126050420-126050442 AACTAGGGAAGTGGGGAGGGTGG + Intergenic
1060820568 9:126659248-126659270 TGCTGGGCAGGTGGTGAGGAGGG + Intronic
1061163833 9:128911233-128911255 CCCTGGGGAAGAGGGGAGGAAGG - Intronic
1061308486 9:129746727-129746749 TGAAGGGGAAGTGGGGAGGACGG - Intronic
1186441476 X:9590843-9590865 TACTGTGGGGGTGGGGAGGATGG + Intronic
1186441871 X:9593720-9593742 AAATGGGGAAGTGGGGCGGAAGG - Intronic
1187986568 X:24819802-24819824 TGCCGGGGAAGTAGGGAGGAAGG - Intronic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1189230481 X:39448522-39448544 TACTGAAGAAGTGGGGAAGATGG + Intergenic
1190537603 X:51445553-51445575 AAACGGGGAAGTGGGGAGGAGGG - Intergenic
1192433710 X:71129424-71129446 TACTTGGTACGGGGGTAGGAAGG + Exonic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1194109902 X:89820811-89820833 TACAGGGGAGGTAGGGAGGAGGG - Intergenic
1195275330 X:103275806-103275828 TTCTGTGTATGTGGGGAGGGAGG - Intronic
1195609288 X:106846428-106846450 TACTGTGAAACTGGGGAGGGGGG + Intronic
1197217616 X:123881142-123881164 TACTGGGTAAGTGGAAAGGCAGG - Intronic
1197232800 X:124023870-124023892 GACTGGGTATGTGGGGTGCAGGG + Intronic
1197774127 X:130109273-130109295 TGCTGGGGAGGTGGGGAGGTAGG - Intronic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198934794 X:141894962-141894984 GAGTGGGAAAGTGGGCAGGAAGG + Intronic
1200239759 X:154487230-154487252 TGCTGGGTAAGTGTGGACCAGGG - Intergenic