ID: 997585098

View in Genome Browser
Species Human (GRCh38)
Location 5:135039306-135039328
Sequence GGTAGCAGCCTCGGGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997585098_997585115 26 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585115 5:135039355-135039377 GAGGGTTGATCCCGCCGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
997585098_997585109 8 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585109 5:135039337-135039359 GTGCCCGGAGCCAAAGCAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 158
997585098_997585113 21 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585113 5:135039350-135039372 AAGCAGAGGGTTGATCCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 72
997585098_997585105 -7 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585105 5:135039322-135039344 TGCTACCCTCTTGAGGTGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 98
997585098_997585114 25 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585114 5:135039354-135039376 AGAGGGTTGATCCCGCCGGTTGG 0: 1
1: 0
2: 0
3: 0
4: 17
997585098_997585108 7 Left 997585098 5:135039306-135039328 CCCGTGCCCCCGAGGCTGCTACC 0: 1
1: 0
2: 1
3: 14
4: 231
Right 997585108 5:135039336-135039358 GGTGCCCGGAGCCAAAGCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997585098 Original CRISPR GGTAGCAGCCTCGGGGGCAC GGG (reversed) Intronic
900420949 1:2555716-2555738 GGAAGGGGCCACGGGGGCACTGG + Intronic
900661980 1:3789300-3789322 GGTTGGAAGCTCGGGGGCACAGG + Intronic
900673147 1:3868332-3868354 GGAAGAAGCCTCGGGGGGAGAGG - Intronic
900680422 1:3913290-3913312 GGAAGCAGCCTGGGGGCTACGGG + Intergenic
900984616 1:6066154-6066176 GGAAGCGGCCTCGGGAGCCCAGG - Intronic
902100386 1:13983225-13983247 TGGAGGAGGCTCGGGGGCACAGG + Intergenic
902404639 1:16175914-16175936 GGTAGGAGCCTCAGGGGACCTGG + Intergenic
903063787 1:20687218-20687240 GGTGGCTGGCTCAGGGGCACTGG - Intronic
903210325 1:21814627-21814649 GGTAGGAGCCGGGGGCGCACGGG - Exonic
903744803 1:25579640-25579662 GGTAGCTGCTTCTGTGGCACTGG - Intergenic
906714362 1:47955912-47955934 GGCAGCAGCCTAGGAGGTACAGG - Intronic
906811008 1:48826892-48826914 TGTAGCAGACTCCGGGGCATGGG - Intronic
908475796 1:64486970-64486992 GGTAGCAGCCTAGGAGGACCTGG + Intronic
908641561 1:66229303-66229325 GGTAGAAGCCTCTGGGGGGCCGG - Intronic
912506681 1:110161503-110161525 GGTAGCAGGATCAGGAGCACGGG + Intronic
913050700 1:115114450-115114472 GGTAGCAGACTCTGGGACCCTGG - Intergenic
913167927 1:116206098-116206120 GGCAGCAGCCTCTGGGGCAGAGG - Intergenic
913960958 1:143337858-143337880 GGTACCAGCCTCAGGGGCTGTGG + Intergenic
914055311 1:144163430-144163452 GGTACCAGCCTCAGGGGCTGTGG + Intergenic
914123834 1:144802931-144802953 GGTACCAGCCTCAGGGGCTGTGG - Intergenic
914878604 1:151530548-151530570 GGCAGCAGCCAAGCGGGCACTGG + Exonic
918134473 1:181659265-181659287 GGCACCTGCCTCTGGGGCACAGG + Intronic
919878876 1:201889277-201889299 GGCAGAGGCCTCGGGGGCTCTGG + Intronic
922720341 1:227896995-227897017 GGGGGCAGCCTCGGAGGCCCAGG + Intergenic
922861257 1:228818537-228818559 GGAAGCAGCCTGGGGGCCATCGG - Intergenic
924078252 1:240363817-240363839 GGAAGCAGGCTGGGGGGCAGAGG - Intronic
1063205551 10:3827242-3827264 GGAAGCATTCTCGGGGGCAGAGG + Intergenic
1063944792 10:11165815-11165837 GGGAGCAGCCCCTGGAGCACAGG - Intronic
1064140113 10:12783336-12783358 GGGAGCAGCCTGGGGGACAGGGG - Intronic
1068083278 10:52346556-52346578 GTTGGCTGCCTCGGGGACACGGG - Intergenic
1069954026 10:72038865-72038887 TGTAGCAGAATCGTGGGCACAGG + Intergenic
1070113292 10:73505286-73505308 GGTAGCAGCCTCAGGTGCTAAGG - Exonic
1070652167 10:78245281-78245303 GACAGCAGCCACTGGGGCACTGG - Intergenic
1073292193 10:102418881-102418903 GCTGGCAGCCTCCGGGGCTCTGG - Exonic
1075343064 10:121662569-121662591 GTGAGCAGCATCGGGGGCCCGGG + Intergenic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076637404 10:131891460-131891482 GACAGCAGCCTCTGGAGCACAGG - Intergenic
1077119540 11:900498-900520 AGTAGCAGCCTCAGAGGCAGTGG - Intronic
1077155925 11:1090750-1090772 GGTAGCAGCCTGGTGGACACAGG - Intergenic
1077219317 11:1408398-1408420 GGCAGCAGCCACGGGAGAACTGG + Intronic
1077364330 11:2155448-2155470 AGGGGCAGCCTCGGGGACACTGG + Intronic
1077404966 11:2378711-2378733 GGTGACAGCCTGGGGGGCACGGG - Intronic
1077502714 11:2916594-2916616 GGCAACAGCCTCGGCTGCACAGG - Intronic
1078600356 11:12724890-12724912 GGGAGCAGCCCCGGAAGCACAGG - Intronic
1083297505 11:61722988-61723010 CTCAGCAGCCCCGGGGGCACAGG + Intronic
1083932927 11:65855712-65855734 GGGCGCAGACTCGGGGGCCCTGG + Exonic
1084563099 11:69915006-69915028 AGAAGCAGTCTCGGGGGCAGGGG - Intergenic
1088876825 11:113943193-113943215 GTAAGCAGCCTCGGGGTCACTGG + Intronic
1089822601 11:121241699-121241721 GCTTGCACCCTCGGGGGCACAGG - Intergenic
1090258877 11:125304456-125304478 GGGAGCAGCCTGAGAGGCACGGG + Intronic
1095548143 12:43396936-43396958 GGCAGGAGCCACGGGGGCATGGG - Intronic
1096554496 12:52395084-52395106 GGCTGCAGCATCGTGGGCACTGG - Exonic
1096777659 12:53973927-53973949 GGTAGCAGCGGCCGGGGAACGGG + Intronic
1101330410 12:103753295-103753317 GGTCGCAGCTTCGTTGGCACAGG - Exonic
1102025874 12:109714161-109714183 GGATGCAGCCTCGGGGGCCTCGG - Intergenic
1104072511 12:125357980-125358002 GCTGGCAGCCTCCAGGGCACCGG - Intronic
1113605512 13:111602323-111602345 TGTGGCAGCCGCAGGGGCACAGG - Intronic
1113642234 13:111965913-111965935 CGTAGGAGCCTCTGGGGCCCGGG + Intergenic
1118312594 14:64704677-64704699 GGTAGCTGCCCCGCGGGCTCGGG - Exonic
1119195729 14:72715519-72715541 GGCAGCAGCCTGGGGTGCAGGGG + Intronic
1119268426 14:73279306-73279328 GTTAGCAGCATCAGGGGCATGGG + Exonic
1123110315 14:105864095-105864117 CGGAGCAGCCTGGGGGGCTCAGG - Intergenic
1123161823 14:106286382-106286404 GGTGCCAGCCTTGGGGGCACAGG - Intergenic
1125494722 15:40181565-40181587 GGTAGCAGAGTCGGGGGAAATGG - Intronic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1129468504 15:75737731-75737753 GGAAGGAGCCTGGGGGGCATGGG - Intergenic
1129710704 15:77819138-77819160 GGCGGGAGCCTCGGGGGCAGCGG - Intronic
1129727077 15:77906776-77906798 GGAAGGAGCCTGGGGGGCATGGG + Intergenic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1132557374 16:578583-578605 GGGAGCAGAGTTGGGGGCACAGG - Intronic
1132560720 16:592374-592396 GGCAGCAGCACCGGGGGCTCTGG + Intronic
1132812192 16:1805870-1805892 AGTGGCAGCCACGTGGGCACAGG + Intronic
1137272525 16:46911624-46911646 GGTCTCAGCCTCGGCAGCACAGG - Intronic
1142077503 16:88128656-88128678 GGGAGCAGGCTCAGGGGCAAAGG - Intergenic
1142627433 17:1201189-1201211 AGCAGCAGCCTCGTGGACACCGG - Intronic
1143475797 17:7203363-7203385 GGAAGCAGGCTTGGGGGCACAGG + Intronic
1145721041 17:27073044-27073066 GGTGGCAGCCATGGGGGCCCTGG - Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146656940 17:34639976-34639998 GGCAGCAGCCTAGGGGGCACAGG + Intergenic
1152579373 17:81159357-81159379 GGTAGCAGTCCTGGGGGCAGTGG + Intronic
1152926131 17:83088577-83088599 GGCAGCAGCATCGTGGACACAGG + Intronic
1153760119 18:8322779-8322801 GGTGGCAGCCATGGGGGCCCTGG + Intronic
1154251779 18:12750912-12750934 GGGAGCAGCCTTAGGGGCCCAGG - Intergenic
1156270189 18:35523575-35523597 GGTAGCTGCCTGGGGGGAGCAGG - Intergenic
1157484729 18:48078703-48078725 GGTAGCAGGGTGGGGGGCTCTGG + Intronic
1160038510 18:75322321-75322343 GGTGGCTGCCTGGGGGGCACTGG + Intergenic
1160595317 18:79969439-79969461 GGAAGCATCCGCGTGGGCACAGG - Intronic
1160732137 19:646113-646135 GGCATGAGCCTCGGGGGCGCTGG - Intergenic
1160988721 19:1852001-1852023 GCGAGCAGCCCCGGGGGCGCAGG + Intergenic
1161017010 19:1988090-1988112 GGCTGCAGCCTGGGGGGTACAGG - Intronic
1161342197 19:3749228-3749250 GGTATCAGACTTGGTGGCACAGG + Intronic
1162750862 19:12828635-12828657 GGTAGGAGACGCGGGGGCAAGGG - Exonic
1165423250 19:35732589-35732611 GGGAGCAGCCACGGGGGCCCGGG + Exonic
1166055326 19:40284996-40285018 GGGACCAGCCTCGGGGGGCCGGG - Intronic
1168334092 19:55587010-55587032 GGAAGAAGGCTCGGGGGCCCGGG + Intergenic
1202694794 1_KI270712v1_random:116107-116129 GGTACCAGCCTCAGGGGCTGTGG + Intergenic
928245074 2:29619859-29619881 GGAGGCAGCCCCTGGGGCACTGG + Intronic
928964899 2:36966576-36966598 GGGAGCAGCCTCCTGGGCGCGGG + Intergenic
929964566 2:46524632-46524654 GGTAGCAGCCCTGTGGGCAAGGG + Intronic
931228121 2:60351524-60351546 GGCAGCTGCCTCTGGGGCCCGGG - Intergenic
933371717 2:81423105-81423127 ACTAGCAGGGTCGGGGGCACAGG - Intergenic
934275966 2:91573156-91573178 GGTACCAGCCTCAGGGGCTATGG + Intergenic
938118897 2:128620190-128620212 GGCACCGGCCTCGGGGGCTCTGG + Intergenic
943820600 2:192315431-192315453 GTTGGCTGCCTCGGGGACACGGG + Intergenic
945683061 2:212936801-212936823 GGGAGCAGGCACGGGGGGACTGG + Intergenic
948054986 2:235004290-235004312 TGTAGTCGCCTCGGTGGCACTGG + Intronic
948905110 2:240976203-240976225 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905132 2:240976293-240976315 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905143 2:240976338-240976360 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905154 2:240976383-240976405 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905187 2:240976518-240976540 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905209 2:240976608-240976630 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905220 2:240976653-240976675 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905231 2:240976698-240976720 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905243 2:240976743-240976765 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905255 2:240976788-240976810 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905266 2:240976833-240976855 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905287 2:240976923-240976945 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905320 2:240977058-240977080 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905332 2:240977103-240977125 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905344 2:240977148-240977170 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905355 2:240977193-240977215 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905366 2:240977238-240977260 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905377 2:240977283-240977305 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905398 2:240977373-240977395 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905442 2:240977553-240977575 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905464 2:240977643-240977665 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905475 2:240977688-240977710 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905520 2:240977868-240977890 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905564 2:240978048-240978070 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905576 2:240978093-240978115 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905599 2:240978183-240978205 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905634 2:240978318-240978340 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905655 2:240978408-240978430 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905676 2:240978498-240978520 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905721 2:240978678-240978700 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905764 2:240978858-240978880 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905786 2:240978948-240978970 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905798 2:240978993-240979015 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905809 2:240979038-240979060 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905820 2:240979083-240979105 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905831 2:240979128-240979150 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905852 2:240979218-240979240 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948905896 2:240979398-240979420 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905918 2:240979488-240979510 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905930 2:240979533-240979555 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905941 2:240979578-240979600 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905953 2:240979623-240979645 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905964 2:240979668-240979690 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905975 2:240979713-240979735 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948905986 2:240979758-240979780 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948906007 2:240979848-240979870 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948906075 2:240980118-240980140 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906096 2:240980208-240980230 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906107 2:240980253-240980275 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906118 2:240980298-240980320 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948906141 2:240980388-240980410 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906152 2:240980433-240980455 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906197 2:240980613-240980635 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906240 2:240980793-240980815 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906262 2:240980883-240980905 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906273 2:240980928-240980950 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906295 2:240981018-240981040 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906327 2:240981153-240981175 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948906338 2:240981198-240981220 GGTAGGAGCCTCAGGAGCCCAGG + Intronic
948906349 2:240981243-240981265 GGTAGGAGCCTCTGGAGCCCAGG + Intronic
948906361 2:240981288-240981310 GGTAGGAGCCTCCGGAGCCCAGG + Intronic
1169673903 20:8132862-8132884 AGGGGCAGCCTCGGGCGCACAGG + Intronic
1172527022 20:35606092-35606114 GGTGGCAGCCTGGGGGCCAGAGG + Intergenic
1173435135 20:43025585-43025607 GGTAGGAAACTCTGGGGCACAGG - Intronic
1176105491 20:63383982-63384004 GGTTGCAGCCTGGGCGGCACTGG - Intergenic
1176139908 20:63540414-63540436 GGTAGAAGCCTCGGAGGCTCTGG - Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1179482082 21:41684977-41684999 GGCAGCACCCTCGGAGGCTCTGG + Intergenic
1179810349 21:43865628-43865650 CGCAGCAGCCTCGGTGGCGCTGG + Intronic
1180042279 21:45287043-45287065 GGGCGCAGCCTCGGGAGCCCAGG - Intronic
1180091505 21:45535958-45535980 GGGAGCAGCTTCGGGGGCAAGGG - Intronic
1180835407 22:18927114-18927136 GGCTGCAGCCTCAGGGGCCCTGG - Intronic
1180871636 22:19150095-19150117 GGGCGCAGCCTCGGGCGCCCCGG + Exonic
1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG + Exonic
1182279216 22:29208405-29208427 GGAAGCAGCCCCAGGGGCAGGGG - Intronic
1183060874 22:35335668-35335690 GGGAGCAGGCTCCGGGGGACAGG + Intronic
1183358813 22:37372971-37372993 GGGAGCAGACTCGGGGGCCAAGG - Exonic
1184086633 22:42269918-42269940 CCTGGCAGCCCCGGGGGCACCGG - Intronic
1184403678 22:44287910-44287932 GGCAGCAGCCACGGGGGCTGAGG + Intronic
1203285495 22_KI270734v1_random:152413-152435 GGCTGCAGCCTCAGGGGCCCTGG - Intergenic
949414283 3:3799488-3799510 GCTTGCAGCCGCGGGCGCACGGG - Exonic
951907804 3:27721615-27721637 GGTAGCAGCGGCGGGGGCGGCGG - Exonic
953607378 3:44420649-44420671 GGAGGAAGCCTCGGGGGTACAGG - Intergenic
954617039 3:51974437-51974459 GGAAACAGGCTCGGGGGCATTGG - Intronic
960053943 3:113263189-113263211 CTTAGCAGCCTCAGGGCCACTGG - Intronic
963038413 3:141051526-141051548 GGTAGCAGCAGCTGGGGCCCGGG - Exonic
968293550 3:197556216-197556238 GGTTGCAGCCTCGCGGGCTGAGG + Intronic
969466644 4:7361294-7361316 GGAAGCAGCGTCAGGGACACAGG - Intronic
969595569 4:8147704-8147726 GGCAGCTCCCTCGGGGGCTCAGG - Intronic
974015023 4:56641370-56641392 GGAAGAATCCTCAGGGGCACAGG - Intergenic
976760089 4:88539348-88539370 GGCTGCAGCCTCGGGGGGAGAGG + Intronic
979649751 4:123115332-123115354 GGTTGCAGCGTCGGTGGCCCGGG + Intronic
985275509 4:188234016-188234038 GGTACCTGCCTCTGGGGCATAGG + Intergenic
985727623 5:1524200-1524222 CGTGGCAGCCTCGCGGGCCCGGG - Intergenic
985890801 5:2714059-2714081 GGTGACAGCCTCAGGGGCTCCGG + Intergenic
990825596 5:59894032-59894054 GGTAGCCGCCTCCAGGGCACCGG + Intronic
997304284 5:132826530-132826552 GGAAGCAGCCTGGGTGGAACAGG - Exonic
997585098 5:135039306-135039328 GGTAGCAGCCTCGGGGGCACGGG - Intronic
999768247 5:154756268-154756290 GGTAGCAGACCCCGGGGCCCTGG - Intronic
1001167611 5:169384910-169384932 GGTAGCAGCCCCGGGAGCTGTGG + Intergenic
1001396236 5:171420987-171421009 GGGAGCGGCCTCGCGGGCAGCGG - Intronic
1001906728 5:175478997-175479019 GATGGCTGCCTCGGGGGCAGCGG + Intronic
1001907638 5:175486282-175486304 AGGAGCAGCCTCCAGGGCACTGG - Intronic
1002140459 5:177134245-177134267 GGTAGCAGGCTGCGGGGCGCGGG + Intronic
1002185506 5:177452976-177452998 AGTGGCAGCCATGGGGGCACTGG - Intronic
1004312190 6:14555368-14555390 GATGGCAGCCTCGGAGCCACAGG - Intergenic
1006300535 6:33191627-33191649 CGTGGCAGCATCGAGGGCACAGG + Intronic
1007393814 6:41565845-41565867 GGCAGCAGCGGCGGGGCCACAGG + Exonic
1010810001 6:80290143-80290165 TGAAGCAGCCCTGGGGGCACTGG - Intronic
1011614078 6:89182049-89182071 TGTACCAGCCTGGGGGACACAGG + Exonic
1013991004 6:116253679-116253701 GTCAGCAGCCTCGGCGGCAGAGG + Exonic
1018702744 6:166440030-166440052 GGAACCAGCCTTGGGGACACTGG + Intronic
1019010341 6:168839698-168839720 GGGAGCAGTCACGGGGCCACAGG + Intergenic
1019121847 6:169810468-169810490 GGGAGCAGCCTCGTTGACACAGG + Intergenic
1022107627 7:27208243-27208265 GGTATCAGCTTCGGAGGCAGAGG + Intergenic
1023931429 7:44708721-44708743 GGTAGCCACCACCGGGGCACTGG + Exonic
1024524432 7:50336414-50336436 GGTTGCAGGCTCAGAGGCACAGG + Intronic
1026883232 7:73920567-73920589 GGGAGCAGGCCCAGGGGCACTGG + Intergenic
1027679101 7:81196568-81196590 GGTAATAGCCTCTGGAGCACTGG + Intronic
1029744782 7:102510871-102510893 GGTAGCTGCCTCAGGGCGACTGG + Intronic
1029762774 7:102610033-102610055 GGTAGCTGCCTCAGGGCGACTGG + Intronic
1034545315 7:151785328-151785350 GGGACCAGCCCCGCGGGCACTGG - Intronic
1035264046 7:157679925-157679947 GGTGGTATCCTGGGGGGCACTGG - Intronic
1038642121 8:29337176-29337198 GCTAGCAGCCTCCGCAGCACAGG + Exonic
1045418539 8:101991315-101991337 GGTAGCAGCCTCATAGGAACAGG - Intronic
1049705647 8:144040820-144040842 GGTGGCAACCTGGGGGGCAAGGG - Exonic
1049746566 8:144265637-144265659 GGAAGCAGCCTCCTGGGCAGCGG - Intronic
1059702495 9:116789228-116789250 GGAAGCAGCCTCAAGGTCACTGG + Intronic
1061399732 9:130361842-130361864 AGTAGCAGCCTTGGGGGCAGTGG + Intronic
1062260944 9:135663172-135663194 GGCAGCAGCCTCGGGGCCTTTGG + Intergenic
1062337043 9:136075936-136075958 GGCAGCAGCCCCAGGGCCACAGG - Intronic
1062355120 9:136158246-136158268 TGTGGCAGCCCCGGGGACACTGG + Intergenic
1062653515 9:137590375-137590397 GGTAGCAGCCAGGCGGGCTCCGG + Exonic
1062717088 9:138016499-138016521 GGTTGCAGCCTGGGGAGCCCTGG + Intronic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1188811706 X:34659446-34659468 TGTAGCAAACTCAGGGGCACAGG + Intergenic
1189047159 X:37605589-37605611 AGTAGAAGCCTAGGGGACACAGG - Intronic
1195540658 X:106059014-106059036 GGAAGCAGGCTTGGGGCCACTGG - Intergenic
1200141941 X:153906836-153906858 TGTCCCAGCCTCGGGGCCACAGG - Exonic
1202368418 Y:24182184-24182206 GGAAGGAGCCTGGGGGCCACAGG - Intergenic
1202502367 Y:25487933-25487955 GGAAGGAGCCTGGGGGCCACAGG + Intergenic