ID: 997587015

View in Genome Browser
Species Human (GRCh38)
Location 5:135049220-135049242
Sequence CAGGCCCACCAGAGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997587015_997587022 -6 Left 997587015 5:135049220-135049242 CCTTCCACTCTCTGGTGGGCCTG 0: 1
1: 1
2: 4
3: 43
4: 377
Right 997587022 5:135049237-135049259 GGCCTGGGATGGGTGGAGAGTGG 0: 1
1: 0
2: 6
3: 107
4: 1143
997587015_997587024 11 Left 997587015 5:135049220-135049242 CCTTCCACTCTCTGGTGGGCCTG 0: 1
1: 1
2: 4
3: 43
4: 377
Right 997587024 5:135049254-135049276 GAGTGGAAAGAGAGAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997587015 Original CRISPR CAGGCCCACCAGAGAGTGGA AGG (reversed) Intronic
901636706 1:10673897-10673919 CAGGCCATCCAGAGAGGGCAAGG - Intronic
901726582 1:11247725-11247747 CTGGCACACCTGAGAGAGGAAGG + Exonic
902162227 1:14540314-14540336 CAGGCTCACCTAAGAGAGGAAGG - Intergenic
902233662 1:15044167-15044189 CAGGCCCACCTGGGTGGGGAGGG - Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902814494 1:18908421-18908443 CAGGGCCTCCAGAGAAGGGAGGG + Exonic
904837833 1:33350167-33350189 CAGGCCCCTCAGGGAGTGAACGG - Intronic
905033605 1:34903633-34903655 CAGGGCCTCCCGGGAGTGGATGG - Intronic
905882249 1:41471785-41471807 CAGGCCCACCTGGGTGTGAACGG + Intergenic
906429316 1:45742206-45742228 CGGGCCTACTTGAGAGTGGAGGG + Intronic
909022458 1:70447328-70447350 GAGGCCCACTAGATTGTGGAGGG + Intergenic
909033335 1:70567499-70567521 CAGGCTCAGGAGAGAGTGTAAGG + Intergenic
909736291 1:78966647-78966669 CAGGCCCACCTGGAAGAGGAGGG - Intronic
910788415 1:91025240-91025262 AGGGCCCACCTGAGGGTGGATGG - Intergenic
914344235 1:146784797-146784819 CAGAGCCTCCAGAGAGTGAAGGG - Intergenic
915228830 1:154430654-154430676 GAGGCCCCCCAGAGAGGGGCTGG + Intronic
915824297 1:159058473-159058495 CAGCCCCAGCAGGGAGGGGAGGG + Intergenic
916601490 1:166297584-166297606 CAGGCCGACCAGTGAGTGGTGGG + Intergenic
916789614 1:168113814-168113836 AAGGCCTACTTGAGAGTGGAGGG + Intronic
917957995 1:180119898-180119920 GAGGCCCACCACATTGTGGAGGG - Intergenic
918414063 1:184288948-184288970 CAGGCTCACAAGAGCGTGGCAGG + Intergenic
918948626 1:191105477-191105499 CAGACCTATCTGAGAGTGGAGGG - Intergenic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
921120763 1:212134867-212134889 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
921335366 1:214080180-214080202 GGGGCCCACCAGAGGGTAGAGGG - Intergenic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922462506 1:225824177-225824199 CTGACCCACCAGATAGGGGAGGG + Intronic
922583042 1:226712626-226712648 CAGGCCGTCCAGGGAGTGCAGGG - Intronic
923419102 1:233795238-233795260 GGGGCTCACCAGAGAGTGGAGGG + Intergenic
923680363 1:236113781-236113803 CAGGGCCTCCAGAGGGTGCACGG - Intergenic
924821764 1:247498899-247498921 CAGTCCCACCAGAGGGTGATGGG + Intergenic
924831567 1:247600978-247601000 GGGGCCTCCCAGAGAGTGGAGGG + Intergenic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063602107 10:7491574-7491596 CAGGCCCTCCACAGATTGAATGG - Intergenic
1064843258 10:19620320-19620342 GAGGCCTACTTGAGAGTGGAGGG - Intronic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1069050336 10:63785881-63785903 CAGGCAGAGCAGAGAATGGATGG - Intergenic
1069636927 10:69930542-69930564 CAGGCTCACCGGTGAGTGGCAGG + Exonic
1070053968 10:72916327-72916349 GGGGCCTATCAGAGAGTGGAAGG - Intronic
1070115984 10:73529285-73529307 CAGGCCTATCGGAGGGTGGAGGG + Intronic
1072044461 10:91640761-91640783 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073644694 10:105288673-105288695 GGGGTCTACCAGAGAGTGGAGGG - Intergenic
1073665425 10:105527125-105527147 GAGGCCTACCAGAGAGTGGAGGG + Intergenic
1074412040 10:113236633-113236655 CAGGTACACCAGAAAGGGGAGGG + Intergenic
1075464550 10:122641915-122641937 CAGGCCAAACAGAGAATGTATGG - Intronic
1075914611 10:126156760-126156782 CAGGCCCAGGACAGGGTGGAAGG + Intronic
1077387222 11:2275748-2275770 CAGGCCCAGCAAAGAGGGGCAGG + Intergenic
1077676745 11:4201404-4201426 GAGGCCCGCCAGAAAGTGCAGGG - Intergenic
1079282828 11:19103332-19103354 CAGGCCCACCATCTAGTGCAGGG - Intergenic
1079306262 11:19326130-19326152 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1081617682 11:44600258-44600280 CAGGCCCACTGAAGAGGGGAGGG + Intronic
1081969410 11:47187322-47187344 CGGGCCCAGGAGAGAGTGGGAGG - Intergenic
1082794234 11:57368449-57368471 CTGGCCCGTCAGAGCGTGGAGGG - Intronic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1083276719 11:61601067-61601089 CACGCCCAGCAGTGAGTGGTTGG + Intergenic
1083322747 11:61857362-61857384 CAGGCCCAGCACTGAGTGCAGGG - Intronic
1083642746 11:64154174-64154196 GAGGCTCAGAAGAGAGTGGAGGG - Intronic
1083892095 11:65600583-65600605 CAGGCCAACCCTAGACTGGAAGG - Intronic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1085906377 11:80769245-80769267 CAGGCCCACTTGAGGGTAGAAGG + Intergenic
1086760536 11:90625048-90625070 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1087625871 11:100595401-100595423 CAGGCCCAGCAGAGCTAGGAAGG - Intergenic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1090621971 11:128568313-128568335 CTGGCCCAGCTGAGAGTGGCGGG - Intronic
1091105399 11:132914574-132914596 GAGTCCCAGCAGAGAGTGAACGG + Intronic
1091137036 11:133201118-133201140 GGGGCCCACTTGAGAGTGGAAGG + Intronic
1092003846 12:5052383-5052405 CATGCCTACCAGAGAGTTGCTGG - Intergenic
1092534082 12:9371103-9371125 GAGGCCCACTTGAGAGTAGAAGG - Intergenic
1092660644 12:10734528-10734550 AAGGCCCAGGAGAGAGTTGATGG + Intergenic
1094594697 12:31854483-31854505 CAGGACCGCAAAAGAGTGGAGGG + Intergenic
1095318718 12:40798728-40798750 GGGGCCCACCAGAGGGTGGAGGG + Intronic
1095951749 12:47785400-47785422 CACGGCCTCCAGAGAGCGGATGG + Exonic
1096945853 12:55409219-55409241 CAGGCCTACTTGAGGGTGGAAGG - Intergenic
1098176184 12:67793845-67793867 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
1098347326 12:69519559-69519581 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1099833929 12:87882577-87882599 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1100696202 12:97096792-97096814 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1100813068 12:98359587-98359609 CAGCCCTACCAGATAGTCGATGG - Intergenic
1101045019 12:100795685-100795707 CAGGCTCTTCAGAGAGTGGTAGG + Intronic
1101314265 12:103615026-103615048 CAGGCCCACACTAGAGTGTACGG - Intronic
1101368662 12:104102472-104102494 GGGGCCTATCAGAGAGTGGAGGG - Intronic
1102077689 12:110073167-110073189 CAGGCCCGCCAGGGAGAGCAGGG - Intronic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1102607581 12:114080511-114080533 CATTCTCACCAGAGAGTGGTGGG - Intergenic
1102642312 12:114377980-114378002 CCACCCAACCAGAGAGTGGATGG - Intronic
1105274868 13:18911277-18911299 AGGGCCTATCAGAGAGTGGAGGG - Intergenic
1105530553 13:21215316-21215338 AACGCCTATCAGAGAGTGGAGGG + Intergenic
1105924035 13:24990445-24990467 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1107703938 13:43080229-43080251 GAGGCCTACCTGAGGGTGGAGGG - Intronic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1109645785 13:65253051-65253073 GTGGCCTATCAGAGAGTGGATGG - Intergenic
1110743162 13:79020983-79021005 GAGGCCTACCTGAGAGTGGAGGG + Intergenic
1113919865 13:113901096-113901118 CAGGCTCACCTGAGACAGGAAGG + Intergenic
1116185333 14:41593197-41593219 TGGGCCCATCAGAGAGAGGAGGG + Intergenic
1116319734 14:43446366-43446388 CAGGCCTACTAGAGGGTGGTGGG - Intergenic
1116510056 14:45733868-45733890 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1121115817 14:91341850-91341872 CAGGCCCCCCAGCGAGGGGCCGG - Intronic
1122783202 14:104152390-104152412 CAGGCCCAGCAGTGCCTGGAGGG + Exonic
1124338273 15:28873420-28873442 GAGTCCCAGCAGTGAGTGGAGGG - Intergenic
1125247756 15:37660942-37660964 CGGGCCTACTAGAGGGTGGAAGG - Intergenic
1125750087 15:42021959-42021981 CTGGCCTTCCAGAAAGTGGAGGG + Intronic
1125750286 15:42023225-42023247 CTGGCCCTCCAGAGAGCAGAGGG - Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128879968 15:71234110-71234132 GGGGCCCACCTGAGAGTGGGTGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129362151 15:75030604-75030626 CAGGGCCATCAGGGAGTGAAGGG - Intronic
1129368208 15:75069933-75069955 CAGGCCAAGCGGGGAGTGGAAGG - Intronic
1129473566 15:75768213-75768235 CAGCCCCATCAGTGAGTGGGAGG - Intergenic
1129491321 15:75928571-75928593 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1129731810 15:77936612-77936634 CAGCCCCATCAGTGAGTGGGAGG - Intergenic
1129814087 15:78536877-78536899 CAGGCCCTCAACAGATTGGATGG - Intronic
1130885600 15:88090085-88090107 CAAGCCGAGCAGAGAGGGGAGGG - Intronic
1131314813 15:91326014-91326036 AAGGCCTACCTGAGGGTGGAGGG - Intergenic
1131654412 15:94440764-94440786 CAGGGCAATCAGAGAGTGGGTGG + Intronic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132253198 15:100349991-100350013 CAGGCCCCACAGAGAGTGGTTGG - Intergenic
1132832987 16:1938576-1938598 CAGGCCAGCCAGAGTGGGGATGG - Exonic
1133280207 16:4660840-4660862 CAGGCCCCCCAGACCGGGGAAGG + Intronic
1133583350 16:7167486-7167508 CAGGACCACCAGAAACTGGAAGG + Intronic
1134202156 16:12208193-12208215 CAGGCCCACCTGGGTGCGGAGGG + Intronic
1134285816 16:12861329-12861351 GAGGCCTACCAGAGGGTAGAGGG + Intergenic
1135782542 16:25317182-25317204 TGGGCCTACCAGAGGGTGGAAGG + Intergenic
1136542708 16:30937250-30937272 CAGGCCCACAAGAGACAAGACGG - Intronic
1137408081 16:48205684-48205706 CAGGCCCACCAGCGAGTTCCAGG + Intronic
1137931217 16:52589270-52589292 CCTGCCCTCCAGAGAGTGGCTGG - Intergenic
1138233469 16:55358674-55358696 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
1138427900 16:56948491-56948513 CAGGTCCAGCAAAGAGGGGAAGG - Intergenic
1138609909 16:58114765-58114787 AAGGTCCACCAGTGAGTGGGGGG - Intronic
1138983607 16:62299939-62299961 CAGGCACTCCAGAGAGCTGATGG - Intergenic
1139989762 16:70930552-70930574 CAGAGCCTCCAGAGAGTGAAAGG + Intronic
1140551182 16:75867586-75867608 GGGGCCTACCAGAGAGTGGAAGG - Intergenic
1140572224 16:76120927-76120949 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1141995165 16:87632309-87632331 CAAGCCCACCAGGCAGAGGAGGG - Intronic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1144176934 17:12716523-12716545 CAGACCCACCAGGAACTGGATGG - Intronic
1144393356 17:14817827-14817849 CAGGCCTACTTGAGAGTGGAAGG - Intergenic
1144949133 17:18984700-18984722 CAGGCCAACCAGAGACAGGCTGG - Intronic
1146089218 17:29859450-29859472 AGGGCCTACCAGAGAGTGGAGGG - Intronic
1147262143 17:39214824-39214846 CAGCCCCAGCAGAGAGTGAAGGG - Exonic
1148177064 17:45575815-45575837 CAGGCACTCCAGAGACTGAATGG + Intergenic
1149034150 17:52115666-52115688 CAGCCCCAACCGAGAGGGGAGGG - Intronic
1149894529 17:60419352-60419374 GGGGCCTACCAGAGAGTGGAGGG + Intronic
1150439650 17:65180802-65180824 CAGGCCTACTTGAGGGTGGAGGG - Intronic
1150455504 17:65303937-65303959 CATGCCCACCAGTGGGTGCAAGG + Intergenic
1151987884 17:77555811-77555833 CTGGCCCAGGACAGAGTGGAGGG - Intergenic
1152377115 17:79924625-79924647 CAGGGCCTCCACAGAGTGCAAGG + Intergenic
1154466560 18:14648579-14648601 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1155561778 18:27086104-27086126 CAGGCCTACTTGAGGGTGGAGGG + Intronic
1156379485 18:36544731-36544753 CAGTCCCACCAGAAAGGGGAGGG - Intronic
1156859542 18:41819674-41819696 AAGCCCCACCAGAGAATGAAAGG - Intergenic
1156971544 18:43162986-43163008 CAGTCCCAGCAGGGAGGGGAGGG - Intergenic
1157544597 18:48539138-48539160 CAGACCCAGCAGAGAGGGGAGGG - Exonic
1157874374 18:51258772-51258794 CAAGCCCACGAGAGAGTGAAGGG - Intergenic
1158294877 18:55984785-55984807 GGGGCCTACCAGAGGGTGGATGG + Intergenic
1158357562 18:56638270-56638292 CAGGGCCAACAAAGAGTGAAAGG + Intronic
1159300048 18:66552045-66552067 CAGGACTACTAGAGAGGGGAAGG + Intronic
1159892085 18:73962475-73962497 CAGCCCCATCACAGTGTGGAAGG + Intergenic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1160227299 18:77020844-77020866 CAGGCCTGCCTAAGAGTGGACGG + Intronic
1160708962 19:541997-542019 CACGTCCAGCACAGAGTGGACGG + Exonic
1160826713 19:1083574-1083596 CAGCCCCAAGGGAGAGTGGAGGG - Intronic
1160871940 19:1281674-1281696 CAGGCCCCCCACAGAGGAGATGG - Intergenic
1161296798 19:3524236-3524258 CAGGCCCAGCAGTGCGTGGGAGG + Intronic
1161722150 19:5909040-5909062 CAGGCCCACCGGGGGGTGGGTGG - Exonic
1161927651 19:7313068-7313090 CAGGCCCAGGATAGAGGGGAAGG - Intergenic
1161998601 19:7729839-7729861 CAGGGCTACCAGTGGGTGGACGG - Exonic
1162534320 19:11253970-11253992 CAGGCCCAGCCGGGAGGGGAAGG - Intronic
1163396242 19:17063691-17063713 CAGGCCCTCAAGGGATTGGATGG - Intronic
1163831748 19:19550429-19550451 CAGGGCCCCGAGAGAGTGGGAGG - Intergenic
1164528303 19:29027828-29027850 GAGGCGCACCAGGGAGTGCAGGG + Intergenic
1164600581 19:29560662-29560684 CTGGCCCAGCACAGAGTGGCAGG + Intronic
1165807252 19:38588064-38588086 CAGACTCCCCAGAGAATGGATGG + Intronic
1165969132 19:39610754-39610776 GGGGCCTACCTGAGAGTGGAGGG - Intergenic
1166720298 19:44992550-44992572 CAGGCCCACCTGGCTGTGGACGG + Intronic
1168316748 19:55487960-55487982 CAGATCCACCAGTGAGTGGGAGG + Intergenic
1168526916 19:57095957-57095979 GAGGCCCACCACATTGTGGAGGG - Intergenic
925028405 2:627700-627722 CAGGCCCACCAGTGGGTGCTAGG + Intergenic
925264363 2:2555221-2555243 GGGGCCTATCAGAGAGTGGAGGG + Intergenic
925756282 2:7135046-7135068 CAGGCGCACCTGAGAGAGGTGGG - Intergenic
926795330 2:16614531-16614553 CAGGCTCTCCAGAGGGTGAAAGG - Intronic
927973058 2:27317741-27317763 TGGGCCCACTGGAGAGTGGAAGG + Intronic
928494992 2:31822637-31822659 TAGACCCGCCAGATAGTGGATGG - Intergenic
930475900 2:51881727-51881749 GAGGCCTACTGGAGAGTGGAGGG - Intergenic
931164662 2:59733563-59733585 CAGTCCCAGCAGAAAGTGGACGG + Intergenic
931557904 2:63525233-63525255 AAGGCCTACCTGAGGGTGGAGGG + Intronic
931763059 2:65433046-65433068 CAACCCAACCAGAGAGGGGAGGG + Intergenic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
933654258 2:84874749-84874771 CAAGCCAACCAGTGACTGGAGGG + Intronic
933774210 2:85761997-85762019 CAGCACCCCCAGAGGGTGGAGGG + Intronic
934188136 2:89763969-89763991 CAGACCCCCCAGGGAGTGGGAGG + Intergenic
934308471 2:91843985-91844007 CAGCCCCCCCAGGGAGTGGGAGG - Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
935735183 2:106100817-106100839 CAGGCCCTTCAGAAGGTGGAGGG + Intronic
937648720 2:124296548-124296570 CATGACCACCAATGAGTGGAGGG - Intronic
937921299 2:127133467-127133489 CAGTCCCATCAGAAAGAGGAGGG + Intergenic
940236369 2:151515181-151515203 CAGGCCCTTCACAGAGTGGAAGG + Intronic
940632953 2:156261651-156261673 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
940765712 2:157787711-157787733 CGGGCTAACCAGAGAGTGTATGG + Intronic
941889644 2:170565916-170565938 CAGGCCCTACTGAGAGAGGAGGG + Intronic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
943776223 2:191769305-191769327 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
943963405 2:194297990-194298012 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
947533839 2:230928765-230928787 AAGCCCCAACAGAGAGAGGAAGG + Intronic
948493956 2:238333265-238333287 CAGGCCAACCAGAGGTTGGAGGG - Intronic
948575513 2:238947125-238947147 CAGGCCCCCCCAAGAGTGCAGGG + Intergenic
1169191174 20:3660081-3660103 CAGGCCCACCAGGGACGGAAGGG + Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172763127 20:37336093-37336115 CACTCCGACCAGAGAGGGGAAGG + Intergenic
1172810129 20:37641395-37641417 CAGGCCCGGGAGTGAGTGGAGGG + Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1174529550 20:51200040-51200062 CAGGCCCACGAGACAGAGAAAGG + Intergenic
1175166686 20:57049059-57049081 CAGGCCCACCAGAGGCATGAGGG + Intergenic
1175883456 20:62274031-62274053 GAGGGCCACCAGAGACAGGAGGG - Intronic
1176808032 21:13510043-13510065 GGGGCCTATCAGAGAGTGGAGGG + Intergenic
1177309024 21:19362893-19362915 GAGGCCTCCCAGAGGGTGGAGGG - Intergenic
1178589917 21:33900943-33900965 CACACAGACCAGAGAGTGGATGG + Intronic
1179603918 21:42499683-42499705 AAGGCCCTCGAGAGAGTGGAGGG + Intronic
1180095078 21:45552645-45552667 CAGCCCCAGCAGAGAGGGGCTGG + Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1180535559 22:16391065-16391087 CAGACCCCCCAGGGAGTGGGAGG - Intergenic
1180636585 22:17266891-17266913 CAGGCCCTCCAGGGAGCTGAGGG + Intergenic
1180739800 22:18045143-18045165 CAGGCCCTCCAGAGAGAGAGAGG - Intergenic
1181142800 22:20819632-20819654 CAGGCCCACCTGAGAGATGCTGG + Exonic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181359529 22:22323771-22323793 CAGTCCCCCCAGATGGTGGAGGG + Intergenic
1181369609 22:22405515-22405537 CAGTCCCCCCAGATGGTGGAGGG + Intergenic
1181582777 22:23837231-23837253 CAGGGCCACCAGGCTGTGGATGG - Intronic
1181815236 22:25431823-25431845 CAGGGCCACCAGAGCTGGGAAGG - Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1183424493 22:37731937-37731959 CAGGCCCACCACAGACAGCAGGG + Intronic
1184448441 22:44568182-44568204 ACCACCCACCAGAGAGTGGATGG + Intergenic
1184966795 22:47981163-47981185 GAGGCCTACCAGAGAGTGGAGGG - Intergenic
1185204724 22:49531256-49531278 CAGGTCCTCCAGAGACAGGACGG - Intronic
1185408432 22:50670911-50670933 CAGGCCCACCTGGGAGAGGAAGG + Intergenic
949108088 3:224554-224576 CAGGCACACCATATGGTGGAAGG - Intronic
949146761 3:710126-710148 GGGGACTACCAGAGAGTGGAGGG - Intergenic
951583043 3:24186004-24186026 CAGGCCCAACCAAGAATGGAGGG + Intronic
953408310 3:42671559-42671581 CAGGCCCTCAATAGACTGGATGG - Intergenic
953844184 3:46414214-46414236 CAGCCCCTCCAGAGTTTGGAAGG + Intergenic
953881023 3:46691428-46691450 CTGGCCCCCCGGAGAGTGTAGGG - Intronic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954273836 3:49529702-49529724 CAGGCCAACCAGAGAATGGGGGG + Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954479161 3:50781781-50781803 GGGGCCTACCAGAGAATGGAAGG - Intronic
954907194 3:54072799-54072821 CAGGCCCTCTAGAGAGTACAGGG + Intergenic
955255189 3:57324519-57324541 GAGGCCCACCACATTGTGGAGGG - Intronic
957536189 3:81506904-81506926 GGGGCCTACCAGAGGGTGGAGGG + Intronic
959079443 3:101784478-101784500 CAGGTCCAACACAAAGTGGAGGG + Intronic
961537478 3:127578885-127578907 CAGGCCCTGCAGACAGGGGAAGG + Intronic
962988317 3:140556319-140556341 AAAGCCCACCAGAGAGTAGGAGG + Intronic
964062987 3:152547158-152547180 AGGGACAACCAGAGAGTGGAGGG - Intergenic
966164236 3:176999074-176999096 CTGGCACAGCAGAGAGAGGAGGG + Intergenic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
966917517 3:184593206-184593228 CAGGCAGACCACAGAGTGGCAGG - Intronic
967314088 3:188134456-188134478 GAGGCCTACTGGAGAGTGGAGGG + Intergenic
968189875 3:196660023-196660045 CAGGCCCGGCAGGGCGTGGAGGG - Exonic
968520993 4:1034631-1034653 CAGGCCCACCTGGGACGGGATGG + Intergenic
968617120 4:1582447-1582469 CAGACCCAAGAGAGAGTGGACGG + Intergenic
968913616 4:3487717-3487739 CTGGCCCACCAGTTACTGGACGG + Intronic
969512823 4:7629438-7629460 CAGGCCCAGCTGAGAGGTGAGGG + Intronic
972337421 4:38119847-38119869 CAGGCTGACCACAGACTGGAGGG + Intronic
972373599 4:38449521-38449543 GGGGCCCAGCAGAGGGTGGAGGG - Intergenic
972796946 4:42430631-42430653 GGGGCCCACCGGAGGGTGGAAGG - Intronic
973265404 4:48205288-48205310 CCAGCACACCAGTGAGTGGAAGG - Intronic
973556954 4:52092979-52093001 GGGGACCACCAGAGAGTGGATGG + Intronic
974332346 4:60496973-60496995 CAGGCCCTTAAGAGATTGGATGG + Intergenic
974722793 4:65763995-65764017 GGGGCCTACCAGAGAATGGAGGG - Intergenic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
975036083 4:69684504-69684526 GGGGCCCACCTGAGAGTGGAGGG - Intergenic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976272819 4:83247997-83248019 CAGTCCCACCTGAGCATGGAGGG + Intergenic
976346266 4:84005218-84005240 CAGGCCTTTCAGAGGGTGGAGGG + Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978491005 4:109312307-109312329 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
979008092 4:115330210-115330232 TGGGCCTATCAGAGAGTGGAAGG - Intergenic
981655475 4:147107867-147107889 CGGGCCTACCAGAGGTTGGAGGG + Intergenic
981884316 4:149654440-149654462 CAGGGGCAACAGAGAGTGGTGGG - Intergenic
983899537 4:173119173-173119195 CAGGCCTATTGGAGAGTGGAGGG + Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985731819 5:1553705-1553727 CAGGCCCACCAGAGCCTTGCAGG - Intergenic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986350448 5:6873463-6873485 GGGGCCAACCAGAGAGTGGAGGG + Intergenic
989760457 5:45009570-45009592 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
989992412 5:50782873-50782895 GAGGCTCATCAGAGAGTGGTAGG + Intronic
990797056 5:59555332-59555354 GGGGCCTACCAGAGGGTGGAGGG + Intronic
993255941 5:85590293-85590315 AGGGCCTACCAGACAGTGGAGGG - Intergenic
994348260 5:98714341-98714363 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
995778613 5:115752179-115752201 AAGGCCTACTTGAGAGTGGAGGG - Intergenic
997580710 5:135015051-135015073 CAGGCCCTCAAGAGAGACGATGG + Intergenic
997587015 5:135049220-135049242 CAGGCCCACCAGAGAGTGGAAGG - Intronic
997867345 5:137476192-137476214 GGGCCCTACCAGAGAGTGGAGGG - Intronic
998174955 5:139895987-139896009 CAGGCCCACCCCAAAGAGGATGG - Intronic
1000148450 5:158476098-158476120 CAGGCTCACAAGAAAGTGGAGGG + Intergenic
1000823062 5:166009324-166009346 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1001302660 5:170547526-170547548 GGGGCCCACCAGAGGGTGGGAGG - Intronic
1001328206 5:170744612-170744634 CAGGCCCACCAGCGTGTGAGCGG + Intergenic
1001483129 5:172102117-172102139 CAGACCCAACAGAGAGGGCAGGG + Intronic
1001951264 5:175818183-175818205 CTGGCCCACTAGGGAGGGGAAGG + Intronic
1001993683 5:176136589-176136611 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1002198241 5:177512698-177512720 CAGGCCAACCAGGCAGGGGAAGG + Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1003400889 6:5789911-5789933 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1004702025 6:18088200-18088222 CAGGCCCACCAGAGAACAGTGGG + Intergenic
1004899890 6:20184209-20184231 CAGGCCCACCCATGAGGGGAGGG + Intronic
1005505957 6:26468964-26468986 CAGGACCACCAGAGAGGAGAGGG + Exonic
1006507308 6:34497682-34497704 CAGCCCCAGCAGAGCGTGGGAGG - Intronic
1007257265 6:40537896-40537918 CAGGCACACTAGAGATTGAAGGG + Intronic
1007851962 6:44811722-44811744 CAGGCCCACCACTGAGTGTCTGG - Intronic
1010041341 6:71388536-71388558 CAGGATCCCTAGAGAGTGGAAGG + Intergenic
1010455419 6:76049180-76049202 GGGGCCTATCAGAGAGTGGAGGG + Intronic
1010657511 6:78529041-78529063 CAGGCCAACAAGAGAATGCAGGG + Intergenic
1011253561 6:85398757-85398779 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1011314145 6:86012667-86012689 CAGGCCTACTTGAGGGTGGAGGG - Intergenic
1013848517 6:114484766-114484788 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1014244301 6:119050980-119051002 GGGGCCTACCTGAGAGTGGAGGG + Intronic
1014368446 6:120575115-120575137 CAGGAGCACAAGAGAGTGAATGG - Intergenic
1016806516 6:148217595-148217617 CAGGCCCACCACAGACTGTAAGG - Intergenic
1018418013 6:163618053-163618075 GGGGCCCATCAGAGAGTGGAGGG - Intergenic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1018861870 6:167716831-167716853 GGGGCCCATCAGAGAGTGGAGGG + Intergenic
1020117921 7:5486852-5486874 CAGGCCACCCAGGGAGAGGACGG + Intronic
1020118329 7:5488670-5488692 CAGGCCCTCCAGCCAGTGGGAGG - Intronic
1021279691 7:18702385-18702407 CAGCACCTCCAGAGAGTGGATGG + Intronic
1022113728 7:27246040-27246062 CAGGCCCACCGGCGAGTAGTAGG - Exonic
1024195922 7:47058931-47058953 GGGGCCTATCAGAGAGTGGAGGG + Intergenic
1024456078 7:49608611-49608633 TGGGCCTACCTGAGAGTGGAGGG - Intergenic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1026887854 7:73964904-73964926 CAGGCCCTCCGGAGAGCTGAAGG - Intergenic
1028414147 7:90562120-90562142 CAGCCCCACTAGTGAGTGGCTGG + Intronic
1028444922 7:90910935-90910957 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1028913392 7:96232423-96232445 ACGGCCTACCAGAGGGTGGAGGG + Intronic
1029250109 7:99230097-99230119 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029943827 7:104510888-104510910 GGGGCCTATCAGAGAGTGGAGGG + Intronic
1030187793 7:106780344-106780366 CAGGCCCTCAGGAGAGTAGATGG - Intergenic
1030374537 7:108739773-108739795 GGGGTCCACCAGAGGGTGGAGGG - Intergenic
1031768505 7:125811792-125811814 GGGGCCCATCAGAGGGTGGAGGG - Intergenic
1032013122 7:128359748-128359770 CTGGCCCAAGAGAGAGTGGCTGG + Exonic
1032504348 7:132424394-132424416 CAGGCCCACAAGACAGTAGAGGG + Intronic
1032540292 7:132697345-132697367 GAGCTCCACCAGGGAGTGGAGGG + Intronic
1032751526 7:134846378-134846400 CTGCCAGACCAGAGAGTGGAGGG + Intronic
1033220873 7:139525426-139525448 CTGGACCACCAGACAGTGGCAGG + Intronic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1034101391 7:148453689-148453711 AGGGCCTATCAGAGAGTGGAGGG + Intergenic
1034113006 7:148556910-148556932 CACACCCACTAAAGAGTGGAGGG - Intergenic
1035084864 7:156249405-156249427 CAGGCCCAACAGACAGCGCATGG - Intergenic
1035202276 7:157275376-157275398 CAGGTCCACCAAAGCGTGGGTGG + Intergenic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1035552630 8:542016-542038 CATGCCCTCCAGAGGGTGAAGGG + Intronic
1035560861 8:602563-602585 CTGGCCCACCAGAGCCTGGCAGG - Intergenic
1037670497 8:21011444-21011466 CAGGCCCTCAATAGATTGGATGG + Intergenic
1037762696 8:21752430-21752452 GGAGCCCAGCAGAGAGTGGAAGG - Intronic
1041487174 8:58392113-58392135 CAGGCCCACCAGGGAGTTGGAGG + Intergenic
1041898214 8:62951143-62951165 CACACCCACCTGAGACTGGAAGG - Intronic
1042529344 8:69798568-69798590 CAAGAACACCACAGAGTGGATGG + Intronic
1043418594 8:80076492-80076514 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1044109488 8:88254296-88254318 CAGGCCTATCAGAGAGTGGAGGG + Intronic
1046044997 8:108954180-108954202 CAGGCCCACCAGAATCTTGAAGG - Intergenic
1046179305 8:110622278-110622300 GGGGCCCATCAGAGGGTGGAAGG + Intergenic
1048763179 8:137819207-137819229 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
1048922316 8:139242350-139242372 CAGCCTCACTATAGAGTGGATGG + Intergenic
1049128622 8:140815402-140815424 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1049187782 8:141267364-141267386 CAGGCTCACCAGCGAGCGTACGG + Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050310085 9:4343904-4343926 GGGGCCTACCTGAGAGTGGAGGG + Intronic
1052839420 9:33279397-33279419 CAGGCTCAACAGAGAAGGGAAGG - Intronic
1053000172 9:34573608-34573630 CCGGCCCAGCACAGAGCGGAGGG + Intronic
1053168101 9:35858910-35858932 CAGGTCCACCAGAGGCTGGTGGG - Intergenic
1053401238 9:37825561-37825583 GGGGCCTTCCAGAGAGTGGAGGG + Intronic
1053873382 9:42517905-42517927 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
1054262285 9:62879561-62879583 GGGGCCTACCTGAGAGTGGAGGG + Intergenic
1054268947 9:62948847-62948869 GGGGCCTACCTGAGAGTGGAGGG - Intergenic
1056123570 9:83513040-83513062 CAAGCCCACCAGAGAGAATAAGG + Intronic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057429383 9:94980131-94980153 CAGGGCCAGAGGAGAGTGGACGG - Intronic
1057628095 9:96695997-96696019 CATGGCCACCAGAATGTGGATGG + Intergenic
1057724152 9:97556392-97556414 CAGGCCCACCAGAGAGTGGTGGG + Intronic
1060004350 9:119986400-119986422 CAGGCTCACCTGAGAGGGCATGG + Intergenic
1060216271 9:121740298-121740320 CAAGCCTTCCAGAGAGTGGGTGG - Intronic
1061301667 9:129709235-129709257 CAGACCCACAAGAAAGCGGAGGG - Intronic
1061937478 9:133866146-133866168 CAGGCCCCCCAGGGGGTGGGTGG + Intronic
1062127030 9:134869462-134869484 CAGACCCCGCAGAGGGTGGAGGG + Intergenic
1062203412 9:135321271-135321293 CAGGCAGGCCAGAGAGTGCAGGG + Intergenic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1187107348 X:16257542-16257564 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1188319437 X:28717485-28717507 GAGGCCTACCAGAGGGTAGAGGG + Intronic
1188620745 X:32220105-32220127 CAGGCCCACAAGAGGGAGGCAGG + Intronic
1188831259 X:34900351-34900373 CTGGCCAATCACAGAGTGGATGG - Intergenic
1188992096 X:36833901-36833923 GGGGCCTATCAGAGAGTGGAGGG + Intergenic
1189649853 X:43177459-43177481 CAGCCCCACCTGGGAGGGGAGGG - Intergenic
1190902739 X:54694480-54694502 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1190953170 X:55165799-55165821 GGGGCCCATCAGAGGGTGGAGGG - Intronic
1191708204 X:64116371-64116393 CGGGCCTACCAGAGGTTGGAGGG - Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1192237031 X:69302527-69302549 GAGGCCCAGCAGAGAGCAGAGGG - Intergenic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1194525494 X:94972126-94972148 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1195288811 X:103411745-103411767 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1195370889 X:104171100-104171122 CAGGCCCACCTGAGAGAAAAGGG + Intronic
1195568821 X:106376766-106376788 GAGGCCTACCAGAGGGTGAATGG + Intergenic
1196820048 X:119694295-119694317 CAGTCCCAAGAGAGAGGGGAGGG - Intergenic
1196830288 X:119770584-119770606 GGGGCCTATCAGAGAGTGGAGGG - Intergenic
1197320826 X:125028519-125028541 GGGGCCTATCAGAGAGTGGAGGG + Intergenic
1197377482 X:125699164-125699186 CGGGCCTATTAGAGAGTGGATGG - Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197625577 X:128798561-128798583 AGGGCCCACCTGAGGGTGGAGGG + Intergenic
1197626779 X:128810832-128810854 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198655735 X:138911451-138911473 GGGGCCTACCAGAGAGTGGTGGG + Intronic
1199233687 X:145467687-145467709 CAGGCCTAGCAGGGAGTGGGGGG - Intergenic
1199492838 X:148420064-148420086 GAGGCCTATCAAAGAGTGGAGGG + Intergenic
1199718791 X:150526964-150526986 GAGGCCCACAAGAGAAGGGAGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200857671 Y:7957044-7957066 AAGTCCCACAGGAGAGTGGATGG + Intergenic