ID: 997589750

View in Genome Browser
Species Human (GRCh38)
Location 5:135065438-135065460
Sequence CCACGAGCACAGACATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 302}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997589750_997589760 4 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589760 5:135065465-135065487 GGTGTTGGGACCTGGGAATATGG No data
997589750_997589761 5 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589761 5:135065466-135065488 GTGTTGGGACCTGGGAATATGGG 0: 1
1: 1
2: 1
3: 11
4: 194
997589750_997589759 -3 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589759 5:135065458-135065480 TGGGGCTGGTGTTGGGACCTGGG 0: 1
1: 0
2: 7
3: 54
4: 534
997589750_997589757 -10 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589757 5:135065451-135065473 GTGCTCGTGGGGCTGGTGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 243
997589750_997589764 24 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589764 5:135065485-135065507 TGGGAGCCATCTGAGGTTGCAGG No data
997589750_997589758 -4 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589758 5:135065457-135065479 GTGGGGCTGGTGTTGGGACCTGG 0: 1
1: 0
2: 6
3: 75
4: 639
997589750_997589766 29 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589766 5:135065490-135065512 GCCATCTGAGGTTGCAGGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 235
997589750_997589763 17 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589763 5:135065478-135065500 GGGAATATGGGAGCCATCTGAGG No data
997589750_997589768 30 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589768 5:135065491-135065513 CCATCTGAGGTTGCAGGGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 247
997589750_997589765 25 Left 997589750 5:135065438-135065460 CCCATGCATGTCTGTGCTCGTGG 0: 1
1: 0
2: 0
3: 23
4: 302
Right 997589765 5:135065486-135065508 GGGAGCCATCTGAGGTTGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997589750 Original CRISPR CCACGAGCACAGACATGCAT GGG (reversed) Intronic
900115332 1:1025660-1025682 CCTCGAGCCCAGACCTGCCTGGG - Intronic
900430747 1:2602032-2602054 CCACAGGCACACACAGGCATGGG + Intronic
903270108 1:22182898-22182920 ACATGTGCACAGACATGCACTGG - Intergenic
903367022 1:22811468-22811490 CCATGAGGACAGACAAGCTTGGG - Intronic
906132558 1:43469238-43469260 CCAAGAGCACAGAGATGCCTGGG + Intergenic
907139630 1:52174887-52174909 TCACGTGCACAGACACACATAGG - Intronic
907580220 1:55565706-55565728 TCACGTGCACAGACACACATAGG - Intergenic
908662581 1:66452851-66452873 CCTTAAGCACAGACATGAATTGG + Intergenic
913081013 1:115387202-115387224 TCACATGCAAAGACATGCATAGG - Intergenic
917378833 1:174381672-174381694 TCACGTGCAGAGACATACATAGG - Intronic
917399510 1:174631776-174631798 TCACGTGCAGAGACATACATAGG - Intronic
919513537 1:198494605-198494627 CCAAGTGCACAGAGATGCCTGGG + Intergenic
920064774 1:203260208-203260230 TCACGAGCAGAGACACACATAGG + Intronic
920191040 1:204194053-204194075 GCAAGAGCAGAGAGATGCATGGG - Intronic
921215225 1:212931152-212931174 CCAGGAGCACTGACATCCAAGGG - Intergenic
921517859 1:216119906-216119928 CCAAGTGCACAGACATTGATGGG + Intronic
921625285 1:217372747-217372769 CCAAGAGCACAGGGATGCCTGGG - Intergenic
921738065 1:218651652-218651674 TCACGTGCAAAGACATACATAGG - Intergenic
921992151 1:221378614-221378636 CCAGGAGCAGACACATACATAGG + Intergenic
923391254 1:233515746-233515768 CGAAGAGCACAGAGATGCCTGGG - Intergenic
923685425 1:236150226-236150248 ACACGGGCACAGACATACACAGG - Intronic
923918066 1:238530632-238530654 CCGAGAGCACAGAGATGCCTAGG + Intergenic
924639367 1:245818653-245818675 TCACGAGCAGAGACACACATAGG + Intronic
1063569328 10:7200345-7200367 CCGGGAGCAGAGACATGTATAGG - Intronic
1064840384 10:19585108-19585130 TCACGAGCAGAGACACACATAGG - Intronic
1065201562 10:23317360-23317382 CCAAGAGCACAGGGATGCCTGGG + Exonic
1066468650 10:35675788-35675810 CCATGAGCACAAACTTCCATGGG - Intergenic
1068060772 10:52064664-52064686 CCAGGAGCACAGGGATGCCTGGG + Intronic
1069264874 10:66444932-66444954 TCACGTGCAGAGACACGCATGGG + Intronic
1069366769 10:67701884-67701906 TCACGAGCAGAGACACACATAGG + Intergenic
1069370410 10:67741765-67741787 TCACGTGCACAGACACACATAGG + Intergenic
1070401490 10:76056787-76056809 CCAAGAGCACAGGGATGCCTGGG + Intronic
1071190303 10:83091434-83091456 TCATGTGCAAAGACATGCATAGG + Intergenic
1071337122 10:84609828-84609850 ACACAAGCACACACATGCATAGG + Intergenic
1072567039 10:96625336-96625358 CAATGAGCACAGAAATGCAAAGG + Intronic
1072901792 10:99414199-99414221 TCACGTGCAGAGACATACATGGG + Intronic
1075230662 10:120673500-120673522 TCATGTGCAAAGACATGCATAGG + Intergenic
1075828725 10:125384725-125384747 CAACCAGCACACACATCCATGGG - Intergenic
1077821217 11:5743001-5743023 CAATGAGCACAGACATTCACAGG + Intronic
1078394271 11:10965461-10965483 CCACGTGCAGAGACACACATAGG + Intergenic
1078812296 11:14779925-14779947 TCACGTGCAGAGACACGCATAGG + Intronic
1079550992 11:21697035-21697057 TCACGTGCAAAGACATGCATAGG + Intergenic
1079575571 11:21999731-21999753 TCATGTGCAGAGACATGCATAGG - Intergenic
1079681349 11:23302049-23302071 TCACGTGCAGAGACATACATAGG - Intergenic
1080333820 11:31174092-31174114 CCAAGAGCACAGGGATGCCTGGG - Intronic
1082269199 11:50151097-50151119 TCACGAGCAGAGACACACATAGG + Intergenic
1082286926 11:50327990-50328012 TCACGAGCAGAGACACACATAGG - Intergenic
1082634461 11:55579407-55579429 CCACGTGCAGAGACACACATAGG + Intergenic
1082638249 11:55623019-55623041 TCACGTGCACAGACACACATAGG - Intergenic
1084569845 11:69952615-69952637 CCATGAGCACAGCCAAGCACTGG + Intergenic
1084839552 11:71833906-71833928 CCCCTTGCACAGACATGCTTTGG + Intronic
1086024950 11:82279583-82279605 TCACGTGCAGAGACATACATAGG + Intergenic
1087067306 11:94038979-94039001 TCACGTGCAGAGACATACATAGG + Intronic
1089742078 11:120591363-120591385 CCAGTAGCACAGTCATGCCTAGG - Intronic
1090312922 11:125758166-125758188 TCACGTGCAAAGACATACATAGG + Intergenic
1091236692 11:134026871-134026893 CAAGGTGCTCAGACATGCATGGG - Intergenic
1091692599 12:2607152-2607174 CCACGAGCCCTGACATTCAAGGG + Intronic
1091725377 12:2843026-2843048 CCACCAGCAGAGACAAGAATTGG - Intronic
1092118768 12:6029019-6029041 TCACGTGCAGAGACATACATAGG + Intronic
1092601723 12:10073459-10073481 TCACATGTACAGACATGCATGGG + Intronic
1093279471 12:17175791-17175813 CCACGTGCAGAGACACACATAGG + Intergenic
1094561039 12:31553946-31553968 TCACGTGCAGAGACATACATAGG - Intronic
1095087464 12:38073231-38073253 TCACGTGCAGAGACATACATAGG - Intergenic
1095488732 12:42710406-42710428 TCATGTGCAAAGACATGCATAGG + Intergenic
1096843690 12:54393644-54393666 CCACCAACACAGACAAGGATAGG + Intergenic
1098790479 12:74816528-74816550 CCAAGAGCACAGAGATACCTGGG - Intergenic
1099713755 12:86264611-86264633 CCAAGAGCACAGAAATGCCCGGG - Intronic
1100564037 12:95777420-95777442 TCACGTGCAGAGACATGCATAGG + Intronic
1102400354 12:112623317-112623339 TCACGTGCAGAGACATACATAGG + Intronic
1103130470 12:118464072-118464094 CCTCGAGTACAGACATAAATGGG - Intergenic
1103744912 12:123115966-123115988 CCAGGAGCACAGCCAGGCTTTGG + Intronic
1104086502 12:125479370-125479392 CCACGTGCAGAGACACACATAGG + Intronic
1104175160 12:126324537-126324559 CCACGTGCAGAGACACACATAGG - Intergenic
1104781234 12:131421896-131421918 CCACAAGAACAGCCATGCCTGGG - Intergenic
1105674383 13:22654617-22654639 CCAGGAACACAGAAATGCAATGG + Intergenic
1105720993 13:23114262-23114284 CTAGGAGCACAGACATGGAAAGG + Intergenic
1105954610 13:25268851-25268873 CCAAGAGCACAGGGATGCCTGGG - Intronic
1108249501 13:48550799-48550821 CCAAGAGCACAGGGATGCCTGGG - Intergenic
1109345780 13:61113430-61113452 CCAAGAACACAGAGATGCCTGGG - Intergenic
1109563395 13:64078809-64078831 CCAGGAGCACAGAGATGCCTGGG + Intergenic
1112436392 13:99394047-99394069 CCAGGAGCACCAACATTCATGGG - Intergenic
1113633974 13:111907490-111907512 CCAAGAGCACAGCCAGGCAGAGG - Intergenic
1115017914 14:28639550-28639572 TCACGTGCAGAGACATACATAGG - Intergenic
1115791090 14:36879552-36879574 CCACAGGCACAAAAATGCATGGG + Intronic
1115978173 14:39019423-39019445 TCACGTGCAGAGACATACATAGG + Intergenic
1117193927 14:53320288-53320310 TCACGTGCACAGACACACATAGG + Intergenic
1120624947 14:86813676-86813698 TCACATGCAAAGACATGCATAGG - Intergenic
1121528101 14:94633435-94633457 CCAAGAGCACAGAGATGCCTGGG + Intergenic
1121725374 14:96144339-96144361 CAACGAGCATAAACGTGCATGGG - Intergenic
1202883131 14_KI270722v1_random:80269-80291 ACACGTGCAGAGACATGCACAGG - Intergenic
1123482370 15:20644121-20644143 CCAGGACCACAGAGATGCTTAGG - Intergenic
1125837583 15:42766378-42766400 TCACGTGCACAGACACACATAGG + Intronic
1126673973 15:51142330-51142352 TCACGTGCAAAGACATACATAGG - Intergenic
1127058211 15:55154026-55154048 CCAGGACCACACACCTGCATGGG - Intergenic
1128965150 15:72051419-72051441 CCAAGAGCACAGTGATGCCTGGG - Intronic
1130273336 15:82463723-82463745 CCACGAGGACAGGCATGTCTGGG - Intergenic
1130587977 15:85195689-85195711 CCACGAGGACAGGCATGTCTGGG - Intergenic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1134694619 16:16214389-16214411 CCACCACCAGAGACAGGCATAGG + Exonic
1134977217 16:18580248-18580270 CCACCACCAGAGACAGGCATAGG - Intergenic
1138532895 16:57644682-57644704 GCACAAGCACACACATGCACGGG + Intronic
1139504214 16:67391085-67391107 CAGCGAGCACAGACATGGCTGGG - Exonic
1139606934 16:68025633-68025655 CCACGGACACAGACAGGCTTAGG - Intronic
1142309553 16:89304552-89304574 ACACGGGCACACACATACATGGG + Intronic
1142414265 16:89932924-89932946 CCAGGGGCACAGACAGGGATGGG + Intronic
1144151607 17:12453790-12453812 TCACGTGCAGAGACATACATAGG - Intergenic
1145732500 17:27201656-27201678 TCACGAGCAGAGACACACATAGG - Intergenic
1146425183 17:32731788-32731810 CCAAGAGCACAGGGATGCCTGGG - Intronic
1146665385 17:34699150-34699172 CCACATGCACAGAAATACATGGG - Intergenic
1150952663 17:69821178-69821200 CCAGGAGCACAGAAATGCCTGGG - Intergenic
1151653269 17:75483213-75483235 CCAGGAGCACACACAAGAATCGG + Intronic
1152543095 17:80986899-80986921 CCACCAGCACAAACAGGCCTAGG - Intergenic
1153384385 18:4476031-4476053 TCACGTGCACAGACACACATAGG - Intergenic
1153398339 18:4651309-4651331 TCACGTGCACAGACACACATAGG - Intergenic
1155220775 18:23683731-23683753 CCAAGAACCTAGACATGCATGGG - Intergenic
1155819082 18:30352557-30352579 CCAAGAGCACAGGAATGCCTGGG - Intergenic
1156230517 18:35150079-35150101 TCACGTGCAAAGACATACATAGG - Intergenic
1156315138 18:35962644-35962666 CCAGGAGCACAGAGATGGAGAGG + Intergenic
1158652607 18:59301138-59301160 TCAGGAGCACAGATCTGCATCGG + Intronic
1158787936 18:60739449-60739471 CCAAGAGCACAGGGATGCTTGGG - Intergenic
1159504545 18:69318058-69318080 CCATGAGCACAGACAACCAAAGG - Intergenic
1159570032 18:70102454-70102476 TCACGTGCAGAGACATACATAGG - Intronic
1160542326 18:79630983-79631005 ACACAAGCACACACATGCACAGG - Intergenic
1162628705 19:11907931-11907953 TCACGTGCAGAGACATACATAGG + Intronic
1166015203 19:39974367-39974389 CCACAAGCACAGCAATGCACTGG + Exonic
1166381500 19:42357457-42357479 CCAGGAGCAGAGACAGGCCTCGG - Exonic
1166608605 19:44167830-44167852 CAAGGAGCCCACACATGCATGGG + Intronic
1202658541 1_KI270708v1_random:47412-47434 TCACGTGCAGAGACATGCATAGG - Intergenic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925477500 2:4233893-4233915 TCACGTGCAGAGACATACATAGG + Intergenic
926366378 2:12137334-12137356 TCACGTGCAAAGACATACATAGG - Intergenic
927117417 2:19918497-19918519 TCACGGGCAAAGACATACATAGG + Intronic
927648794 2:24898409-24898431 CCCCGAGGACAGCCCTGCATAGG - Intronic
927801223 2:26101610-26101632 CCACCAGCACAGAGCTGCAGTGG + Intronic
929894965 2:45951639-45951661 CCTCCAGCACAGAGTTGCATTGG - Intronic
930985977 2:57588530-57588552 TCACGTGCAGAGACATACATAGG + Intergenic
932013709 2:68002745-68002767 TCACGTGCAAAGACATACATAGG + Intergenic
933042488 2:77487254-77487276 CCAAGAGCACAGGGATGCACAGG - Intronic
934837026 2:97599917-97599939 GCACGTGCACAGACACACATAGG - Intergenic
937495497 2:122415081-122415103 CCACAAGCCCAGACTTGCAAAGG - Intergenic
939109930 2:137994286-137994308 TCATGTGCAAAGACATGCATAGG + Intronic
940826725 2:158420844-158420866 TCACGTGCACAGACAAACATAGG + Intronic
941998777 2:171626467-171626489 CCAAGAGCACAGGGATGCCTGGG - Intergenic
943087058 2:183324918-183324940 TCACGTGCAGAGACATGCATAGG + Intergenic
943817186 2:192272313-192272335 TCACGTGCAGAGACATACATAGG - Intergenic
944569212 2:201026073-201026095 TCACATGCAAAGACATGCATAGG + Intronic
944901920 2:204223928-204223950 CCAAGAGCACAGAGATGCCCGGG + Intergenic
947194114 2:227544058-227544080 TCACGTGCAGAGACATACATAGG - Intronic
948548439 2:238749843-238749865 CCACTAACCCAGCCATGCATAGG - Intergenic
948821070 2:240546619-240546641 CCACGTGCAGAGACACACATAGG + Intronic
1170221450 20:13946704-13946726 CCAAGAGCACAGGGATGCCTGGG - Intronic
1171069665 20:22055820-22055842 CCATCAGCACAGTCATGCACTGG + Intergenic
1171281239 20:23900735-23900757 CCACATACAGAGACATGCATAGG - Intergenic
1174968346 20:55245221-55245243 TCACGTGCAAAGACATACATGGG + Intergenic
1175064316 20:56272428-56272450 CCAAGAGCACAGAGATGCTTGGG - Intergenic
1175358011 20:58384412-58384434 CCAAGAGCACAGAGGTGCACGGG + Intergenic
1175385320 20:58591257-58591279 CCACAACCACAGACACGCAGAGG - Intergenic
1177181759 21:17751957-17751979 TCACGTGCACAGACACACATAGG - Intergenic
1177262438 21:18748565-18748587 CCAAGAGCACAGGGATGCCTGGG + Intergenic
1178039337 21:28622059-28622081 TCACGTGCAAAGACATACATAGG - Intergenic
1179565453 21:42245046-42245068 CCACGAGCTCAGGCCTGCAGTGG + Intronic
1180326010 22:11430930-11430952 ACACGTGCAGAGACATGCACAGG - Intergenic
1180588539 22:16915406-16915428 CCACAAGCACAGACGGGCAGAGG + Intergenic
1180949008 22:19712559-19712581 CCACAAGCACAGGCTTGCATGGG + Intergenic
1181342159 22:22190083-22190105 TCACGTGCAGAGACATACATAGG + Intergenic
1181362086 22:22345147-22345169 CCAAGAGCAGGGACATGTATGGG - Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
949245050 3:1917372-1917394 TCACGTGCAGAGACATACATAGG - Intergenic
949308506 3:2670476-2670498 CCACGTGCAGAGACACACATAGG - Intronic
949340172 3:3021043-3021065 CCATGAGCACTGAAATGCTTAGG + Intronic
950185690 3:10944142-10944164 CCAAGAGCACTGACGTGCAATGG + Intergenic
951381245 3:21987051-21987073 TCACGTGCAGAGACATACATAGG - Intronic
952118557 3:30214263-30214285 TCACGTGCAGAGACATACATAGG - Intergenic
952472810 3:33673701-33673723 TCACGTGCACAGACACACATAGG + Intronic
953163679 3:40445246-40445268 CCAAGAGCACAGAGATGCCTGGG - Intergenic
953188118 3:40657178-40657200 TCATGTGCACATACATGCATAGG - Intergenic
953895145 3:46792207-46792229 TCACGTGCAAAGACATGCATAGG + Intronic
954491311 3:50909097-50909119 TCACGTGCAAAGACATACATAGG - Intronic
955108538 3:55924656-55924678 CCAAGAGCACAGAAATGCTGTGG + Intronic
955895637 3:63696498-63696520 CCATGTGCACAGACACACATTGG + Intergenic
956038628 3:65122129-65122151 TCACATGCAGAGACATGCATAGG + Intergenic
960182467 3:114597064-114597086 CCACAGGCACAGATAAGCATTGG + Intronic
961670415 3:128524398-128524420 CCAGGGGCACAGACATGCTGGGG - Intergenic
961943088 3:130657082-130657104 CCAAGAGCACAGGGATGCCTGGG + Intronic
962125078 3:132608383-132608405 TCACGTGCACAGACACACATAGG + Intronic
962138598 3:132764525-132764547 TCACGTGCAGAGACATGCATAGG - Intergenic
962219706 3:133553578-133553600 TCACGTGCAGAGACATACATAGG + Intergenic
964043138 3:152288250-152288272 CCAAGAGGACATACATGCAAAGG + Intronic
964371134 3:156001963-156001985 TCACGTGCAAAGACATGCATAGG - Intergenic
965243061 3:166228558-166228580 CCACGTGCAGAGACACACATAGG + Intergenic
965467725 3:169053236-169053258 CCAGGAGCAGAGCCAAGCATAGG - Intergenic
965604506 3:170485157-170485179 CCACTAGCACACACATGCAAGGG - Intronic
965813510 3:172614756-172614778 CCAAGAGCACAGAGATGCCCAGG + Intergenic
968538790 4:1151668-1151690 CCAGGAGCACAGGGATGCCTGGG + Intergenic
969780636 4:9399910-9399932 CCCCTTGCACAGACATGCTTTGG + Intergenic
970358386 4:15280768-15280790 TCACGAGCAGAGACACACATAGG + Intergenic
972645736 4:40966513-40966535 CCAAGAGTACAGAGATGCCTGGG - Intronic
974680926 4:65160864-65160886 CCACGTGCAGAGACACACATAGG + Intergenic
974944777 4:68513692-68513714 CCACGTGCAGAGACACACATAGG - Intergenic
975805530 4:78107857-78107879 CCACGTGCAGAGACACACATAGG + Intronic
976790463 4:88872395-88872417 TCACGTGCAGAGACATACATAGG + Intronic
976913958 4:90346668-90346690 CCACAAACACAGACATACACAGG - Intronic
978418634 4:108505369-108505391 TCACGTGCAAAGACACGCATAGG + Intergenic
980276107 4:130652619-130652641 TCATGTGCAAAGACATGCATAGG + Intergenic
983491742 4:168397916-168397938 CCAAGAGCACAGGGATGCCTGGG - Intronic
985848121 5:2368919-2368941 ACACATGCACATACATGCATGGG + Intergenic
985958619 5:3282816-3282838 ACACAGGCACAGACATGCACAGG + Intergenic
985958625 5:3282872-3282894 ACACGGGCACAGACACGCACAGG + Intergenic
985958628 5:3282900-3282922 ACACGGGCACAGACACGCACAGG + Intergenic
985958642 5:3283056-3283078 ACACAGGCACAGACATGCACAGG + Intergenic
985958645 5:3283084-3283106 ACACGGGCACAGACACGCACAGG + Intergenic
985958651 5:3283140-3283162 ACACGGGCACAGACACGCACAGG + Intergenic
985958661 5:3283260-3283282 ACACGGGCACAGACACGCACGGG + Intergenic
985958875 5:3284496-3284518 ACACAGGCACAGACATGCACAGG - Intergenic
988003746 5:25382413-25382435 TCACGTGCACAGACACACATAGG - Intergenic
989493159 5:42080404-42080426 TCACGTGCACAGACACACATAGG + Intergenic
989733075 5:44670624-44670646 TCATGTGCACAGACATACATAGG + Intergenic
989977076 5:50599994-50600016 TCACGTGCAGAGACACGCATAGG - Intergenic
990038466 5:51350917-51350939 TCACGTGCAGAGACACGCATAGG + Intergenic
990224065 5:53629762-53629784 TCACAGGCAAAGACATGCATAGG - Intronic
991053145 5:62293783-62293805 TCACGTGCAGAGACATACATAGG + Intergenic
991110513 5:62894762-62894784 TCACGTGCAAAGACACGCATAGG - Intergenic
991359434 5:65803713-65803735 CCAAGAGCACAGGCATACCTGGG + Intronic
992756689 5:79913230-79913252 TCAAGTGCAAAGACATGCATAGG + Intergenic
992811646 5:80395008-80395030 TCACGTGCACAGACACACATAGG - Intergenic
994015269 5:94957520-94957542 TCACGTGCAAAGACATGCACAGG + Intronic
994240070 5:97408541-97408563 CCAAGAGCACAGAGATGCCGAGG + Intergenic
995529375 5:113076915-113076937 TCACGAGCAGAGACACACATGGG + Intronic
996267322 5:121557180-121557202 TCACGTGCAGAGACATACATAGG + Intergenic
997589750 5:135065438-135065460 CCACGAGCACAGACATGCATGGG - Intronic
998599032 5:143565982-143566004 CCATGATCACAGGCAGGCATGGG - Intergenic
999944409 5:156579796-156579818 TCACGTGCACAGACACACATAGG - Intronic
1000033812 5:157426570-157426592 TCACGTGCACAGACACACATAGG + Intronic
1001212373 5:169821877-169821899 TCACGTGCAGAGACACGCATAGG + Intronic
1001844258 5:174906653-174906675 TCACATGCAAAGACATGCATAGG + Intergenic
1002799465 6:507601-507623 ACACGAGCACCCACATGCAAAGG - Intronic
1003418296 6:5932881-5932903 CCACCAGGGCAGAGATGCATTGG + Intergenic
1004866457 6:19857630-19857652 CCATGGGCACACACACGCATAGG + Intergenic
1006616821 6:35334215-35334237 TCACGTGCACAGACACACATAGG + Intergenic
1007649846 6:43412667-43412689 CCAAGAGCACAGAGATGCCTGGG - Intergenic
1007890330 6:45283344-45283366 TCACGTGCAGAGACATACATAGG + Intronic
1008301076 6:49840468-49840490 CCAAAAGGACAGACATGCAGTGG - Intronic
1009610301 6:65931619-65931641 CCAAGGGCACAGAGATGCCTTGG + Intergenic
1009776853 6:68216512-68216534 TCACGTGCACAGACACACATAGG - Intergenic
1009782282 6:68286124-68286146 TCACGTGCAGAGACATACATAGG + Intergenic
1011181710 6:84628460-84628482 CCACGTGCAGAGACACACATAGG + Intergenic
1011308572 6:85956788-85956810 TCACGTGCAAAGACATGCATAGG - Intergenic
1011776562 6:90737623-90737645 TCACGTGCAAAGACACGCATAGG - Intergenic
1013086895 6:106864487-106864509 CAAAGAGCACAGAGATGCCTGGG + Intergenic
1013701327 6:112773772-112773794 ACACAAGCACACACCTGCATGGG - Intergenic
1015812582 6:137175684-137175706 TCACGAGCTCAGACACTCATGGG + Intergenic
1016373772 6:143399835-143399857 TCACGACCACACACATGCTTGGG - Intergenic
1016410867 6:143782748-143782770 TCAGCAGCTCAGACATGCATCGG + Intronic
1016659611 6:146562359-146562381 CCACGTGCAGAGACACACATAGG + Intergenic
1017054395 6:150424508-150424530 CCAAGAGCACAGAGATGTCTGGG - Intergenic
1019072376 6:169358570-169358592 TCACGTGCACAGACACACATAGG + Intergenic
1021947925 7:25745954-25745976 TCACGAGCAGAGACACACATAGG + Intergenic
1026616717 7:71911623-71911645 CCACCTGCACAGACATACTTAGG - Intronic
1029875244 7:103743521-103743543 TCACGTGCAGAGACATACATAGG + Intronic
1030390598 7:108922560-108922582 CCAATAGCACAGAAATCCATAGG - Intergenic
1030395411 7:108980434-108980456 TCACGTGCAAAGACATACATAGG - Intergenic
1031173166 7:118316836-118316858 TCATGTGCAAAGACATGCATGGG - Intergenic
1031815377 7:126427481-126427503 CCATGAGCAGAGACTGGCATGGG - Intergenic
1031836351 7:126685457-126685479 CCAGGAACACAGAGATGCCTGGG - Intronic
1032909970 7:136418069-136418091 TCACGTGCAGAGACATACATAGG - Intergenic
1032919357 7:136527906-136527928 CCAAGAGCACAGGGATGCCTGGG + Intergenic
1033102707 7:138489230-138489252 TCACGTGCACAGACACACATAGG - Intronic
1033672145 7:143503613-143503635 CCAGGAGCAGAATCATGCATAGG - Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035794296 8:2339146-2339168 TCACATGCAAAGACATGCATAGG + Intergenic
1036278071 8:7373843-7373865 CCCCTTGCACAGACATGCTTTGG + Intronic
1036343452 8:7938049-7938071 CCCCTTGCACAGACATGCTTTGG - Intronic
1036838792 8:12098813-12098835 CCCCTTGCACAGACATGCTTTGG - Intergenic
1036860580 8:12345056-12345078 CCCCTTGCACAGACATGCTTTGG - Intergenic
1038333749 8:26630118-26630140 GTACAAGCACAGACACGCATAGG + Intronic
1038383180 8:27115736-27115758 TCACGTGCACAGACACACATAGG + Intergenic
1041205595 8:55495298-55495320 CCAAGAGCACAGAGATGCCTGGG + Intronic
1043082666 8:75785101-75785123 CCAGGAGCACAGGGATGCCTGGG + Intergenic
1043617731 8:82147678-82147700 CCACGTGCAGAGACACACATAGG + Intergenic
1044746178 8:95373590-95373612 TCACGTGCAGAGACATACATAGG - Intergenic
1044936466 8:97297722-97297744 TCACGTGCAGAGACATACATAGG + Intergenic
1045088410 8:98712392-98712414 TCACGAGCAGAGACACACATAGG + Intronic
1045152437 8:99424293-99424315 TCACGTGCAGAGACATACATAGG - Intronic
1046018068 8:108630093-108630115 TCACATGCAAAGACATGCATAGG + Intronic
1046278032 8:111987834-111987856 TCACATGCAGAGACATGCATAGG + Intergenic
1046879700 8:119294281-119294303 TCACGGGCAGAGACACGCATAGG + Intergenic
1046968262 8:120191928-120191950 TCACGTGCAGAGACATACATAGG - Intronic
1046982392 8:120350495-120350517 TCACGTGCAGAGACATACATAGG + Intronic
1048093363 8:131264354-131264376 TCACGTGCACAGACACACATAGG + Intergenic
1048098670 8:131322957-131322979 TCACGTGCACAGACACACATAGG - Intergenic
1049507067 8:143008505-143008527 CCACCTGCACAGACATGCACTGG + Intergenic
1049814359 8:144591245-144591267 CCGTGAGCACAGACCTGCAGGGG + Intronic
1050068120 9:1782356-1782378 TCATGGGCAGAGACATGCATAGG - Intergenic
1050182233 9:2934037-2934059 CCAAGAGCGCAGAGATGCCTGGG - Intergenic
1051597779 9:18842917-18842939 TCACGCGCAGAGACATGCATAGG - Intronic
1052199981 9:25766140-25766162 TCATGTGCACAGACATACATAGG + Intergenic
1052539259 9:29786864-29786886 CCACAAGCACAGGCAAGCAAAGG + Intergenic
1052645427 9:31228394-31228416 TCACGTGCAGAGACATACATAGG - Intergenic
1054347534 9:63981924-63981946 CCACGTGCAGAGACACACATAGG + Intergenic
1055477007 9:76672161-76672183 TCACGTGCACAGACACACATAGG + Intronic
1055695087 9:78874752-78874774 TCACGTGCAGAGACACGCATAGG + Intergenic
1057450186 9:95151592-95151614 ACATGGGCACAGACAGGCATGGG - Intronic
1062609136 9:137365660-137365682 CCACACGCACACACATGCACAGG + Intronic
1186354442 X:8775205-8775227 TCACGAGCAAAGACACACATAGG + Intergenic
1186775630 X:12862178-12862200 TCACATGCAGAGACATGCATAGG - Intergenic
1188109484 X:26180422-26180444 TCACGTGCACAGACACACATAGG - Intergenic
1188420446 X:29985618-29985640 TCACGTGCACAGACACACATAGG - Intergenic
1188494720 X:30771647-30771669 TCACGTGCACAGACACACATAGG - Intergenic
1189429176 X:40932101-40932123 CCAAGAGGACAGACAGGCAATGG + Intergenic
1189856557 X:45229863-45229885 CCACGAGCACAGGGATGCCCAGG + Intergenic
1190620792 X:52284975-52284997 CCAAGAGCACAGATATGCCTAGG + Intergenic
1190685888 X:52872776-52872798 CCACGAGCACAACTATACATTGG + Intergenic
1190686428 X:52877900-52877922 TCACGTGCAGAGACATACATAGG + Intergenic
1191034597 X:56010720-56010742 TCACTTGCAAAGACATGCATAGG + Intergenic
1191775710 X:64810632-64810654 TCACGTGCAGAGACATGCATAGG + Intergenic
1192679034 X:73231846-73231868 CCACGTGCAGAGACACACATAGG + Intergenic
1193049531 X:77085540-77085562 ACACCAGGACAGAGATGCATGGG + Intergenic
1194271643 X:91823557-91823579 CCACGTGCAGAGACACACATAGG - Intronic
1194417316 X:93629578-93629600 TCACGAGCAGAGACACACATAGG + Intergenic
1195241882 X:102960361-102960383 CCAAGAGCCCAGACATGGGTGGG + Intergenic
1195279831 X:103320903-103320925 CCACAAGCACAGACAGCCAAAGG - Intergenic
1195983860 X:110607952-110607974 TCACGTGCACAGACACTCATAGG + Intergenic
1195987242 X:110643901-110643923 TCACGTGCACAGACACACATAGG - Intergenic
1196893187 X:120309741-120309763 CCACGCGCACACACATACAGAGG - Intronic
1198615880 X:138458087-138458109 TCACGAGCAGAGACACACATAGG + Intergenic
1201352548 Y:13060385-13060407 TCACATGCAAAGACATGCATAGG - Intergenic