ID: 997591278

View in Genome Browser
Species Human (GRCh38)
Location 5:135074087-135074109
Sequence TTATAGCCAAAGCCAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997591275_997591278 3 Left 997591275 5:135074061-135074083 CCGGGTGAGGGGCTCAGCAGGAA 0: 1
1: 0
2: 2
3: 24
4: 248
Right 997591278 5:135074087-135074109 TTATAGCCAAAGCCAGAGAGGGG 0: 1
1: 1
2: 0
3: 31
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997591278 Original CRISPR TTATAGCCAAAGCCAGAGAG GGG Intronic
902817368 1:18923998-18924020 TTATTTCCAAAGCCAGACGGGGG + Intronic
902989282 1:20174935-20174957 TCATGCTCAAAGCCAGAGAGAGG - Intronic
903740442 1:25555652-25555674 TTAGAGACAAAGCAAGAGGGTGG - Intronic
906190631 1:43897531-43897553 TTATTGCCAAAGCCAGAGAGAGG + Intronic
909359201 1:74742372-74742394 TTATACCCAAAGCCAGCCAGTGG - Intronic
909420983 1:75464891-75464913 TTACAGCTAAAGAAAGAGAGAGG + Intronic
910147449 1:84098783-84098805 GTATAGACAAAACGAGAGAGAGG + Intronic
910507171 1:87962505-87962527 ATTTAGCCAAAGCCAGAGTCAGG - Intergenic
911949991 1:104161064-104161086 TTAGAGCTAAAGAGAGAGAGAGG + Intergenic
915562351 1:156694564-156694586 TTATTGAGAAAGGCAGAGAGAGG - Intergenic
917536472 1:175877888-175877910 TTATAGCCAGAGTCAAATAGTGG - Intergenic
917941876 1:179930380-179930402 TTAGAGGTAAAGCCAGAGATAGG - Intergenic
918454297 1:184691910-184691932 TAATGGCCAAAGGAAGAGAGTGG + Exonic
918524272 1:185448217-185448239 ATATGGCCAAAGCCAGAATGTGG + Intergenic
920885750 1:209926282-209926304 TTAGAGCCAAAACCAGTGGGTGG - Intergenic
921266948 1:213428655-213428677 TTATAGCACAAGAAAGAGAGAGG - Intergenic
922611706 1:226934922-226934944 TGAAAGCCAAAGGCAAAGAGAGG + Intronic
924632339 1:245752721-245752743 TTAGAGCCACAGCCAGGAAGGGG + Intronic
1062760593 10:13728-13750 TAAGTGCCAAAGCCAGTGAGAGG + Intergenic
1062802046 10:388087-388109 TTAAAGAAAAAGGCAGAGAGGGG - Intronic
1066222335 10:33347297-33347319 TTTTAGCCTAAAACAGAGAGAGG + Intergenic
1066397216 10:35037809-35037831 TTATAGCCTGGGCCACAGAGCGG + Intronic
1066614107 10:37279024-37279046 TTATACCCAAAGCCAGCCAGTGG - Intronic
1068497037 10:57795899-57795921 TCACAGCCAGAGCCAGAGAAAGG + Intergenic
1071129339 10:82373295-82373317 TTATAGCTAACGTCAGAGAAAGG + Intronic
1071209407 10:83320632-83320654 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1071882843 10:89918231-89918253 ACCTAGCCAAAACCAGAGAGAGG + Intergenic
1072629070 10:97133078-97133100 TTATCACAAGAGCCAGAGAGTGG + Intronic
1072780279 10:98246235-98246257 TTATAACCAGACCCAGAGAAAGG + Intergenic
1076426564 10:130371338-130371360 TTATAGCAAACCCCAGAGAAGGG - Intergenic
1076473777 10:130738448-130738470 TTATTGCCAGAGTCAAAGAGAGG + Intergenic
1078662273 11:13297160-13297182 TTCAAACCAAAGCCAGAGAGGGG - Intronic
1081176280 11:39931335-39931357 TTTTAGCCAAAACCCGAAAGAGG + Intergenic
1081284194 11:41247231-41247253 TTAAAGCCAAAGCAACAGAGGGG - Intronic
1081638067 11:44734080-44734102 TGAGAGGCAAAGCAAGAGAGAGG - Intronic
1084459413 11:69287901-69287923 TGATAGACAAAGACAGAGAGAGG + Intergenic
1085438653 11:76536190-76536212 TTATAGACAAGTCCAGAGGGGGG - Intronic
1085777970 11:79383141-79383163 TGTTGGCCAAAGCCAGTGAGGGG - Intronic
1087208163 11:95418492-95418514 TTATAGCCAAAAGCAGAGTCAGG - Intergenic
1088990526 11:114949626-114949648 TTATAGCCCAACACAGAGAGAGG - Intergenic
1089055759 11:115583500-115583522 TTACAGCCAATGCCAGGGAAAGG - Intergenic
1090318027 11:125814431-125814453 TTAGAGCTAAAGGGAGAGAGAGG - Intergenic
1090528778 11:127566927-127566949 TTATATCTAAAGCCAGAATGAGG - Intergenic
1090725899 11:129526980-129527002 TTATAGCAAGAGCCAGCGGGAGG - Intergenic
1092668594 12:10836109-10836131 TTTCAGCCAAAGACAGAGAAGGG - Intronic
1093577477 12:20750314-20750336 ATATAGTGATAGCCAGAGAGAGG + Intronic
1098304097 12:69084750-69084772 TTAAAGCCAGAGGCAGAGATTGG + Intergenic
1099100707 12:78436905-78436927 TTAGAGCCAAAGGGAGAGATAGG - Intergenic
1099376723 12:81902044-81902066 TCATACCCAAAGCCAGGCAGTGG + Intergenic
1100254082 12:92863753-92863775 TCAGAGCCATAGCCAGAGAATGG + Intronic
1101272984 12:103167410-103167432 TTGTAGCCTAAGCCAGGTAGAGG - Intronic
1107966276 13:45601147-45601169 TTACAGCCAAGGACAGAGTGGGG - Intronic
1108424593 13:50286528-50286550 TTATAGCAACAGCCATAGATAGG + Intronic
1109720924 13:66275774-66275796 TTCTAGCCAAAGACATAGAAAGG - Intergenic
1111364992 13:87231730-87231752 TTAGAGCTAAAGCGAGAGATAGG - Intergenic
1113551000 13:111193151-111193173 TTATACCCAAAGCCATCCAGTGG - Intronic
1113926957 13:113946994-113947016 TGCTGGCCACAGCCAGAGAGAGG - Intergenic
1113993102 14:16044504-16044526 AGATAGCGAGAGCCAGAGAGCGG - Intergenic
1114836803 14:26212278-26212300 TGAAAGCCAATGCAAGAGAGAGG + Intergenic
1115521935 14:34241725-34241747 TCTTAGCCAAAGCCAGATTGGGG - Intronic
1116039284 14:39666394-39666416 TTAAAGCCCAAGCCAGAAATGGG - Intergenic
1116046067 14:39743837-39743859 TTATATCCATACTCAGAGAGAGG + Intergenic
1116121573 14:40727470-40727492 TTAGAGCTAAAGCAAGAGATAGG - Intergenic
1117880899 14:60312462-60312484 TCAAAGCCAAAGACAGAGTGGGG - Intergenic
1118789060 14:69072260-69072282 TTATAGGCAAAGGTAGAGAAAGG + Intronic
1119199465 14:72742097-72742119 TAATAGCCACAGCCTGAGTGGGG + Intronic
1119352623 14:73978661-73978683 TTATAGAAAAAGCCAAAGTGCGG + Intronic
1120477693 14:85008866-85008888 TCATAGCCAATGCCAGAGAAAGG - Intergenic
1123463013 15:20491888-20491910 TTACAGCTAAAGAGAGAGAGAGG - Intergenic
1123655046 15:22508526-22508548 TTACAGCTAAAGAGAGAGAGAGG + Intergenic
1125186648 15:36938672-36938694 GTCTAGCCAAAGCAAGTGAGAGG - Intronic
1125404869 15:39341739-39341761 TTAGATCCAAAACCAGAGAGGGG - Intergenic
1125737521 15:41937623-41937645 TTGTTACCAAAGCCTGAGAGGGG + Intronic
1127164435 15:56230014-56230036 TTATGGCCAAAGCCTGAAGGTGG - Intronic
1127237444 15:57070434-57070456 TCATAGACAAAGCCATAGATTGG + Intronic
1128829022 15:70749487-70749509 TTATCGCCCAGGCCAGAGTGCGG - Intronic
1129891869 15:79076948-79076970 TAATAGCAAAAGCCACAAAGAGG + Intronic
1130942268 15:88521045-88521067 TTAAAGCCAAAGCCATAGAATGG + Intronic
1131405830 15:92163683-92163705 ATATTGCGAAAGTCAGAGAGAGG - Exonic
1131411438 15:92211116-92211138 TCATAACCAAAGCCAGCCAGTGG + Intergenic
1134330731 16:13248872-13248894 TTTTAGGCAACGCCACAGAGAGG + Intergenic
1136012681 16:27374268-27374290 TGATTGCTAAAGCAAGAGAGCGG + Intergenic
1139321431 16:66117516-66117538 TTAGATCCAAAGCCCCAGAGTGG + Intergenic
1139379893 16:66523968-66523990 TTTTAGCCAGAGCCACAGAAGGG - Intronic
1140113178 16:72020924-72020946 TGCTAGACAAAGCCAGTGAGTGG + Intronic
1140897811 16:79340626-79340648 TTATATGCAAATCCACAGAGTGG + Intergenic
1142806630 17:2374674-2374696 CAAAACCCAAAGCCAGAGAGAGG - Intronic
1143356084 17:6329909-6329931 TTATAGCCTGAACCAGAGACTGG + Intergenic
1147166777 17:38597729-38597751 AGATAGCCAAAGACTGAGAGAGG - Intronic
1147776728 17:42907247-42907269 TGATGAGCAAAGCCAGAGAGGGG - Intronic
1148532294 17:48405854-48405876 TAATAGCCACAGACAGAGAATGG + Intronic
1149213712 17:54330749-54330771 TCATACCCAAAGCCAGCCAGTGG + Intergenic
1149416034 17:56460922-56460944 TGGTAGCAAAAGTCAGAGAGAGG - Intronic
1152953500 18:14082-14104 TAAGTGCCAAAGCCAGTGAGAGG + Intergenic
1156071527 18:33216884-33216906 GTAAACCCAAAGACAGAGAGCGG + Intronic
1156646485 18:39168239-39168261 TTCTTGCCAAAGCCAGAGCCAGG - Intergenic
1157865169 18:51176757-51176779 TCACTCCCAAAGCCAGAGAGTGG + Exonic
1159353301 18:67301664-67301686 TTATGGCCTGAGGCAGAGAGAGG - Intergenic
1160793663 19:934186-934208 TTATAGCCAAGCCGAGAGGGAGG + Intronic
1164181247 19:22820687-22820709 TTATACCATAAGCAAGAGAGTGG - Intergenic
1164442620 19:28291092-28291114 TTATCTCCAAAGCCACAGTGGGG - Intergenic
1164618379 19:29679956-29679978 GGATAGACAAAGCCAGAGAAAGG + Intergenic
925993208 2:9270071-9270093 TTATCACAAAAACCAGAGAGGGG - Intronic
929262816 2:39885056-39885078 TGATAGCGAAAGGCAGAGAAAGG + Intergenic
930527510 2:52548271-52548293 TTAGAGCTAAAGACAGAAAGAGG - Intergenic
931042276 2:58313712-58313734 TCATAGCAAAAGGCAAAGAGGGG + Intergenic
931163586 2:59720453-59720475 TTATAGCAAAAAAGAGAGAGAGG + Intergenic
933936434 2:87207628-87207650 TTACAGCCAGTGCCAGAGAAAGG - Intergenic
934031988 2:88056253-88056275 GTTTGGCCAAAGCGAGAGAGCGG + Intergenic
934995298 2:98952142-98952164 TCATAAACAAAGCCAGGGAGTGG + Intergenic
935292096 2:101619620-101619642 TTGTAGCCAGCGCCAGAGAAAGG - Intergenic
935495905 2:103781479-103781501 CAAGAGCCAAAGCCAGAGAAAGG - Intergenic
935531809 2:104241953-104241975 TTAGAGCTAAAGAGAGAGAGAGG + Intergenic
936356715 2:111758201-111758223 TTACAGCCAGTGCCAGAGAAAGG + Intergenic
937049922 2:118879981-118880003 TTACAGTCAAAACCAGACAGAGG + Intergenic
938622220 2:133068026-133068048 TGATGGCAAAACCCAGAGAGAGG + Intronic
939476539 2:142694498-142694520 TTATAGCTAAAGCAAGTGGGTGG - Intergenic
939518443 2:143199615-143199637 TAATAGCCTTAGCCAGGGAGTGG + Intronic
940398388 2:153220291-153220313 TCACAGCCAAGGCCAGGGAGAGG + Intergenic
940433073 2:153616959-153616981 TTACAGCTAAAGAAAGAGAGAGG + Intergenic
941551177 2:166917312-166917334 TTAAAACCATAGACAGAGAGAGG + Intronic
941885025 2:170519179-170519201 TTATATCTATTGCCAGAGAGAGG + Intronic
942525137 2:176845056-176845078 TAATAGCTAAAGGCAGACAGAGG - Intergenic
942635458 2:177999352-177999374 TTATTTCCAAACCCAGAGTGAGG - Intronic
943561253 2:189465647-189465669 TTATAGCCACAGTACGAGAGTGG - Intronic
943756225 2:191559988-191560010 TTAGAGCCACAGCTAGGGAGGGG - Intergenic
943793874 2:191967649-191967671 AGATAGCCAAAGCCTGCGAGAGG - Intronic
946010282 2:216558928-216558950 TTATGCCCAAAGCTAGAGAGTGG - Intronic
947401275 2:229733715-229733737 TCATAGCCAGTGCCAGAGAAAGG - Intergenic
1169618447 20:7476882-7476904 TTCTAGCTAATGCCAGAGAGGGG - Intergenic
1170796203 20:19549098-19549120 TTATGGACCAAGCCTGAGAGTGG + Intronic
1171811924 20:29751341-29751363 AGATAGCGAGAGCCAGAGAGTGG + Intergenic
1171907749 20:30914356-30914378 AGATAGCGAGAGCCAGAGAGCGG - Intergenic
1172454169 20:35053567-35053589 GTATAGCCAATGACAGAGATAGG - Intronic
1173270293 20:41527931-41527953 CTGTGGCCAAAGGCAGAGAGAGG - Intronic
1173399108 20:42708912-42708934 TTAAAGGTCAAGCCAGAGAGAGG + Intronic
1173436539 20:43037467-43037489 CTACAGCCAAAGCAAGAGAGAGG + Intronic
1174073616 20:47916373-47916395 ATCTGGCCAAAGCCAAAGAGGGG + Intergenic
1175556905 20:59869797-59869819 TTATATACAAAGCAAAAGAGAGG - Exonic
1177692578 21:24530832-24530854 TTAACACCAATGCCAGAGAGTGG + Intergenic
1178479446 21:32967044-32967066 TTATAGCCAAGGAGTGAGAGGGG + Intergenic
1179810775 21:43867630-43867652 TTTTTGACAAGGCCAGAGAGGGG - Intronic
1180314166 22:11263009-11263031 AGATAGCGAGAGCCAGAGAGCGG + Intergenic
1180600687 22:17013189-17013211 CTATAGATAAAGCCAGAAAGGGG - Intergenic
1183472757 22:38018305-38018327 TTATAGACAGAGTCAGAGATAGG + Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
1185199896 22:49494883-49494905 TGAGAGCCAAAGCCAGAGACGGG + Intronic
950659861 3:14460634-14460656 ATAGTGTCAAAGCCAGAGAGAGG + Intronic
950872033 3:16237830-16237852 TTATAGCCAGGGTCAGGGAGCGG - Intergenic
951520722 3:23608905-23608927 TTTAAGCCAAAGCCTGTGAGAGG - Intergenic
952773885 3:37026154-37026176 TTATGGTCAAAGGCAGACAGTGG - Intronic
952931168 3:38361988-38362010 TTCTAGCAAAACCCAGTGAGTGG - Intronic
953668229 3:44941233-44941255 TTTTAGTCATAGCCAGTGAGGGG - Intronic
954155732 3:48684107-48684129 ACAGAGCCAAAGCCAGAGTGTGG + Intronic
954587448 3:51747925-51747947 TCATAACCAAAGCCAGCCAGTGG + Intergenic
954871700 3:53772279-53772301 CTACAGCCACAGCCAGAAAGTGG + Intronic
957232739 3:77541120-77541142 TTATATCCAAAGAAAAAGAGTGG + Intronic
957967021 3:87335484-87335506 CCATAGTCCAAGCCAGAGAGGGG - Intergenic
958668895 3:97177505-97177527 TTAGAGCTAAAGACAGAGATAGG - Intronic
959823618 3:110767149-110767171 TCAGAGCCACTGCCAGAGAGAGG - Intergenic
960630706 3:119727675-119727697 TGATAGACACAGCCTGAGAGGGG - Intronic
960749084 3:120926477-120926499 CAATAGTCAAAGACAGAGAGAGG - Intronic
960923043 3:122767819-122767841 TGAAAGCCAAGTCCAGAGAGTGG + Intronic
961909961 3:130304202-130304224 TGATGACCAAAGCCAGAGACAGG - Intergenic
962296351 3:134191877-134191899 ATATAGCAATATCCAGAGAGAGG - Exonic
962630889 3:137274332-137274354 CGAGAGCCAGAGCCAGAGAGGGG + Intergenic
965063197 3:163807187-163807209 TCATACCCAAAGCCAGCCAGTGG + Intergenic
967277919 3:187794915-187794937 TTGTAGCCAAAGCCAGTTGGGGG - Intergenic
970647099 4:18135052-18135074 TCACAGCAAAATCCAGAGAGGGG - Intergenic
971001747 4:22331364-22331386 TTAAAGCAGAAGGCAGAGAGTGG - Intergenic
971449164 4:26784082-26784104 TTGAAGCCAAAGCCATTGAGTGG - Intergenic
974527003 4:63058456-63058478 TTATACCCAAAGCCAGCCAGTGG + Intergenic
974586332 4:63883464-63883486 TTAGAGCTAAAGAGAGAGAGAGG - Intergenic
975162690 4:71141996-71142018 TTATATCCAAAGCATTAGAGTGG + Intergenic
975674990 4:76818383-76818405 TTAGAGCTAAAACAAGAGAGAGG - Intergenic
977884638 4:102241705-102241727 TTATACCCGAAGCCAGCCAGTGG + Intergenic
978207914 4:106102110-106102132 TTAAAGCCAAAGGCTCAGAGAGG - Intronic
978684682 4:111425783-111425805 TTAGAGCTAAAGACAGAGATAGG + Intergenic
978706469 4:111718793-111718815 TTCTAGACACAGCCAGAGGGGGG + Intergenic
978966081 4:114743427-114743449 TTAAAGACAAAGAAAGAGAGGGG - Intergenic
980290443 4:130843609-130843631 TTATACCCGAAGCCAGCCAGTGG - Intergenic
980432789 4:132726320-132726342 CTCTAGACAAAGTCAGAGAGTGG + Intergenic
982335231 4:154229139-154229161 TAATTGCCAAAACTAGAGAGAGG - Intergenic
982377660 4:154711700-154711722 TTATGGCCAAAGCCAGTTTGTGG + Intronic
983967214 4:173827483-173827505 TTAAAGAGAAAGCAAGAGAGTGG - Intergenic
984292521 4:177813359-177813381 TTATAACCTTTGCCAGAGAGCGG - Intronic
985667619 5:1189977-1189999 TTATTGTCAAACCTAGAGAGTGG + Intergenic
986476889 5:8143442-8143464 TTGCAGCCAGTGCCAGAGAGAGG - Intergenic
986714082 5:10510102-10510124 GTATAGCCGTAGCCATAGAGTGG - Intronic
986883040 5:12198890-12198912 ATATACCCATACCCAGAGAGGGG - Intergenic
988338948 5:29943719-29943741 GCATCTCCAAAGCCAGAGAGAGG + Intergenic
988557776 5:32252914-32252936 GTAAAGACAAAGCCAGAGAGGGG + Intronic
990144990 5:52750014-52750036 TTATAGACAAACTGAGAGAGAGG + Intergenic
990593199 5:57286769-57286791 TTAGAGCTAAAGACAGAGATAGG + Intergenic
992049832 5:72931919-72931941 TTATACCCGAAGCCAGCCAGTGG + Intergenic
994231281 5:97312665-97312687 TTAAACCCAAAGCCAGCCAGTGG - Intergenic
995706882 5:114996003-114996025 TTATATCCAAAGCCAGCCAGTGG + Intergenic
997072761 5:130638588-130638610 TTATACCCGAAGCCAGCCAGTGG + Intergenic
997149583 5:131478663-131478685 TTATATACTAAGCCAGAGACAGG - Intronic
997591278 5:135074087-135074109 TTATAGCCAAAGCCAGAGAGGGG + Intronic
1000819141 5:165961416-165961438 CTATAGCCATAGCCATAGATGGG - Intergenic
1001760942 5:174207621-174207643 ATGTAGCCAAAGACACAGAGGGG - Intronic
1003225874 6:4205068-4205090 TCATAGCAAAAGCCAAAGAAGGG + Intergenic
1003793189 6:9570199-9570221 TGATAGCCATGGCCAGATAGTGG - Intergenic
1004165125 6:13250005-13250027 TTATTGACAAAGACAGAGAGTGG - Intronic
1005745534 6:28833723-28833745 TTATAGAGCAAGCCAGAAAGTGG + Intergenic
1006820859 6:36893386-36893408 ATATAACCAAAGCCAAAAAGAGG + Intronic
1006953804 6:37848565-37848587 TTTTAACCAAAGCCAGAAAGAGG - Intronic
1008262678 6:49386801-49386823 TTACAGCCAAATCCAGGGAGGGG + Intergenic
1011374598 6:86675746-86675768 TTATACCCAAAACCAGCCAGTGG - Intergenic
1011868182 6:91858357-91858379 CTAGAGCCAAAGACAGATAGAGG + Intergenic
1012471796 6:99580716-99580738 TTCTAGCCAATGCCATGGAGGGG + Intergenic
1012997715 6:105990264-105990286 AGAAAGGCAAAGCCAGAGAGAGG + Intergenic
1013092016 6:106908619-106908641 GTAGAGCCAGAGCCAGAGCGTGG + Intergenic
1013599248 6:111688917-111688939 TTATAGCCTAGGCCAGTCAGTGG - Intronic
1013907392 6:115235537-115235559 TTATACCCGAAGCCAGCCAGTGG - Intergenic
1014279853 6:119429688-119429710 TTAGAGGCAGAGACAGAGAGAGG + Intergenic
1015353851 6:132254062-132254084 TGAGAACCAAAGGCAGAGAGAGG + Intergenic
1015450576 6:133362607-133362629 CTATAGCCACAGCCAGAAAGTGG + Intronic
1016030319 6:139330559-139330581 GAAGAGCCAAAGACAGAGAGCGG + Intergenic
1016696299 6:147000134-147000156 TTATGGACAAACCCAGAGAAAGG + Intergenic
1016743808 6:147556535-147556557 TTAGAACCAAAACCAGAGAATGG + Intronic
1017357223 6:153523896-153523918 ACATGGCAAAAGCCAGAGAGGGG + Intergenic
1021930374 7:25575213-25575235 TAATATCCAAAGATAGAGAGTGG - Intergenic
1022538740 7:31115770-31115792 TTATGTACAAAGGCAGAGAGAGG - Intergenic
1023046676 7:36215909-36215931 TTTTAGCCAAAGACAAAGAGAGG + Intronic
1024498572 7:50074779-50074801 TTAGAGCTAAAGAGAGAGAGAGG + Intronic
1026156005 7:67826344-67826366 TCATAGCCAGTGCCAGAGAAAGG + Intergenic
1026283535 7:68943411-68943433 TCATTGCCATGGCCAGAGAGTGG - Intergenic
1027791422 7:82641771-82641793 TTATGCCCAAAGCCAGCCAGTGG + Intergenic
1027845423 7:83367738-83367760 TTATAGCAACTTCCAGAGAGTGG - Exonic
1031870826 7:127088767-127088789 ATATGGTCAAAGCCACAGAGAGG - Intronic
1033103589 7:138498523-138498545 TTATAGCTAAACCCACACAGGGG - Intronic
1034300112 7:150007999-150008021 TTATTGCCAATGCTAGGGAGGGG - Intergenic
1035322291 7:158040475-158040497 TTTTGGACAAAGCCAGAGAGGGG + Intronic
1036708522 8:11062261-11062283 TGGGAGCCAAGGCCAGAGAGTGG + Intronic
1037968941 8:23157919-23157941 TTACAGCCAATGCCAGAAAAAGG + Intronic
1039692736 8:39879874-39879896 TTATACCCAAAGACAGCCAGTGG - Intergenic
1041002359 8:53465203-53465225 TTATACCCAAAGCCAGCCAGTGG + Intergenic
1041760573 8:61361938-61361960 TTGTAGCCACAGGCAGAGTGAGG + Intronic
1042223339 8:66494670-66494692 TTACTGCCAGATCCAGAGAGAGG + Intronic
1043344599 8:79285436-79285458 TCACAGCCAATGCCAGAGAAAGG - Intergenic
1044005017 8:86928895-86928917 TCATACCCAAAGCCAGCCAGTGG - Intronic
1046103383 8:109640213-109640235 TTATAGCCTTAGCCAGAGACAGG + Intronic
1048077608 8:131089992-131090014 TTAAAGCCTAATCCAGAGAAAGG + Intergenic
1049552230 8:143265741-143265763 TAAGAGCCAGAGCAAGAGAGGGG + Intronic
1049849042 8:144821002-144821024 GGATAGGCAGAGCCAGAGAGTGG - Intergenic
1050838911 9:10121881-10121903 TTGTAGTCAAAGTCAGAGTGGGG - Intronic
1052057342 9:23920251-23920273 TTATACCCGAAGCCAGCCAGTGG - Intergenic
1054968335 9:71055498-71055520 TTATAGCCAGAGCTTGTGAGTGG + Intronic
1055130231 9:72766547-72766569 TTGTAGCCAGAGCAAGAAAGTGG + Intronic
1055152922 9:73024708-73024730 TTCTAGCCTAGGCCACAGAGTGG + Intronic
1056653679 9:88491263-88491285 TAATAGCCAAAGGCAGATAAGGG - Intergenic
1056802616 9:89703430-89703452 CTTTGGCCAAAGCCAGAGACAGG + Intergenic
1058405026 9:104663024-104663046 TTATTCCCAAAGCCACATAGTGG + Intergenic
1062254122 9:135613151-135613173 TTATCTCCAAAGATAGAGAGCGG - Intergenic
1062647425 9:137555914-137555936 ATACGGCAAAAGCCAGAGAGGGG + Intronic
1203362479 Un_KI270442v1:229128-229150 AGATAGCGAGAGCCAGAGAGCGG + Intergenic
1186919865 X:14266721-14266743 CAATAGCAAAAGCAAGAGAGAGG + Intergenic
1188612596 X:32118480-32118502 ATATAACCAAAGCCACATAGAGG - Intronic
1188883405 X:35518544-35518566 TCATAGCCAGTGCCAGAGAAAGG - Intergenic
1190261453 X:48800249-48800271 TTCAAGCCAAAGCCAGACTGTGG + Intergenic
1193022342 X:76803637-76803659 TGATAGAGAAAGCAAGAGAGAGG - Intergenic
1193185306 X:78504852-78504874 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1193305996 X:79952494-79952516 TTATAGCCAAAGAGAGAGACAGG + Intergenic
1194089552 X:89567837-89567859 TCACAGCCAATGCCAGAAAGAGG - Intergenic
1194264711 X:91740078-91740100 TTAGAGCTAAAGACAGAGATAGG - Intergenic
1195199749 X:102536471-102536493 TTAAAGCTAAAGACAGAGATAGG + Intergenic
1196489175 X:116247322-116247344 TTATACCCGAAGCCAGCCAGTGG + Intergenic
1196661901 X:118279094-118279116 TTATACCCGAAGCCAGCCAGTGG - Intergenic
1196856235 X:119987704-119987726 TAACAGATAAAGCCAGAGAGTGG - Intergenic
1197095245 X:122586611-122586633 TTAGAGACAAAGACAGAGATGGG + Intergenic
1197513833 X:127400636-127400658 TTATACCCGAAGCCAGCCAGTGG + Intergenic
1198910653 X:141609911-141609933 TTACAGCCAGTGCCAGAGAAAGG - Intronic
1199757773 X:150881232-150881254 ATAGAGCCAAGGCCACAGAGTGG - Intronic
1200442207 Y:3223891-3223913 TCACAGCCAATGCCAGAAAGAGG - Intergenic
1200776617 Y:7175386-7175408 TCATACCCAAAGCCAGAAAGTGG + Intergenic
1201404172 Y:13633503-13633525 TTATACCCAAAGCCAGCCAGTGG + Intergenic
1201472793 Y:14352308-14352330 TCATACCCAAAGCCAGTCAGTGG - Intergenic
1201631655 Y:16076848-16076870 TTATAGCCAAAACCAGCCAGTGG + Intergenic
1202243283 Y:22791768-22791790 TTATACCCAAAGCCAGCCAGTGG + Intergenic
1202396270 Y:24425518-24425540 TTATACCCAAAGCCAGCCAGTGG + Intergenic
1202474514 Y:25244574-25244596 TTATACCCAAAGCCAGCCAGTGG - Intergenic