ID: 997593261

View in Genome Browser
Species Human (GRCh38)
Location 5:135088632-135088654
Sequence TATTAATTATAGTCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 9, 3: 86, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997593260_997593261 13 Left 997593260 5:135088596-135088618 CCTCTTCTAGCTATTGGAAAGTA 0: 1
1: 0
2: 10
3: 52
4: 218
Right 997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG 0: 1
1: 1
2: 9
3: 86
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997593261 Original CRISPR TATTAATTATAGTCACCTTA TGG Intronic
900774636 1:4573325-4573347 TATTAATCACAGTTACTTTAAGG + Intergenic
900901234 1:5517491-5517513 TATTAACCATAGTCACCATGCGG - Intergenic
901258609 1:7854687-7854709 TATTAATCAGAGTCACCCTGAGG - Intergenic
901353050 1:8615295-8615317 TATTCATTATACTCACCTTGTGG - Intronic
903433065 1:23323892-23323914 TTTTTATTATAATGACCTTAGGG + Intronic
906178234 1:43795010-43795032 TATTATTTTTAGTGACCTGAAGG + Intronic
906806712 1:48786278-48786300 TATTAATAATACTGACTTTATGG - Intronic
907086971 1:51684314-51684336 TATTAATTATTGTCACCATGTGG - Intronic
907696551 1:56735895-56735917 TGTTAACTATAGTCATCCTATGG - Intronic
908769011 1:67579232-67579254 TATTAGTTAAGGTCACCTTCAGG + Intergenic
909141948 1:71878329-71878351 CATTAATTAGAATCACCTGAAGG + Intronic
909559080 1:76989779-76989801 AATTCATTATAGTCCCATTAGGG + Intronic
909922043 1:81394262-81394284 TGTTATTTATAGTCACTATATGG + Intronic
910011016 1:82462262-82462284 TATTAATTAAAATTACATTATGG + Intergenic
911685741 1:100775195-100775217 TATTAACTATAGTCACCATGTGG - Intergenic
911942918 1:104070055-104070077 CATTTATTATTTTCACCTTATGG - Intergenic
913096168 1:115517723-115517745 TATCAATTATAGTCATCCTGTGG + Intergenic
913413167 1:118575066-118575088 AATTCAAAATAGTCACCTTAAGG + Intergenic
915077530 1:153321535-153321557 TATTAACTATGATCACCTTGCGG - Intergenic
915791356 1:158675017-158675039 TATAAATAAGAATCACCTTATGG + Intronic
915918603 1:159957287-159957309 TATTAACTGTAGTCACCATATGG - Intergenic
917992142 1:180391617-180391639 TGTTGATTATAGCCACCCTAAGG - Intronic
918452581 1:184673753-184673775 TGTTGACTATAGTCACCATATGG + Intergenic
918960591 1:191271695-191271717 TATTAATTTTAATGACCTTGAGG + Intergenic
919870312 1:201815670-201815692 TATTAACTATAGTCACCATATGG - Intronic
920729098 1:208466121-208466143 TATTAATTCTAGTCACTTTGTGG - Intergenic
921173989 1:212577464-212577486 TATTAACTATAGTCACTATGTGG + Intronic
921875303 1:220189058-220189080 TCTAAATTACAGTTACCTTAGGG + Intronic
921892783 1:220369741-220369763 TACTAAATATAGTTGCCTTAAGG + Intergenic
922453455 1:225755399-225755421 AATCCATTATAGTCACCCTAGGG + Intergenic
922480199 1:225935281-225935303 GATTAATAATACCCACCTTATGG + Intergenic
923043866 1:230339924-230339946 TATTAACTTTAGTCACCATGTGG - Intronic
1062764520 10:50552-50574 AATTAATTATACTCACTTTTTGG + Intergenic
1064621451 10:17221787-17221809 TATAAATTATAGTCTCATGAAGG - Intergenic
1064959830 10:20951714-20951736 TATTAATGATAGTCACATCTGGG + Intronic
1065412885 10:25449666-25449688 TATTAACTATAGTCACTATTTGG - Intronic
1068631173 10:59299054-59299076 TATTAATTATAGTCACTGTGTGG - Intronic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1068892714 10:62164454-62164476 TCTTAACTATAGTCACCCTATGG - Intergenic
1070643253 10:78184030-78184052 TTTTAAGTAAAGTCACATTAGGG - Intergenic
1071318254 10:84424410-84424432 TATTCATTATAGTCACCTTGAGG - Intronic
1072393748 10:95017109-95017131 TAATAATAATAAACACCTTATGG - Intergenic
1072882161 10:99238256-99238278 TATTAATTATAGACATCTAGTGG - Intergenic
1073537463 10:104290833-104290855 TATTTACTATAGTCACCATGTGG - Intronic
1073633434 10:105172647-105172669 TATGAATTTTAGGCAGCTTAGGG - Intronic
1073831301 10:107386400-107386422 TAATGATTATAGAAACCTTAGGG - Intergenic
1074520493 10:114217194-114217216 TAGTGATTATAGTCACTTTCAGG + Intronic
1077801369 11:5541737-5541759 TATTAACTATAGCCACCATAGGG - Intronic
1077988558 11:7380371-7380393 TATTGACTATAGTCACCCTATGG - Intronic
1079385387 11:19974415-19974437 TATTAACTAAAGTCACATTAGGG - Intronic
1079684269 11:23337364-23337386 TATTAATTATTGTGTCATTAAGG - Intergenic
1079741475 11:24067319-24067341 TTTTAATTATATTCACATCAAGG + Intergenic
1079929873 11:26544525-26544547 TATTAACTATAGTCACCATGTGG - Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1080568663 11:33535960-33535982 TATTAATTAAAGTTGCATTATGG - Intergenic
1085957889 11:81422356-81422378 TAATAATAATAGTTACCTCATGG + Intergenic
1086067952 11:82766121-82766143 TGTTTATTATAGTCACCCTACGG - Intergenic
1086636308 11:89090822-89090844 TATTAACTATAGTTACCTTATGG - Intergenic
1087639199 11:100737223-100737245 TATAAATGATAATAACCTTATGG + Intronic
1088202517 11:107354621-107354643 TATTATATACAGTTACCTTAGGG - Intronic
1090384712 11:126350671-126350693 TATTAACTATTGTCACCATGTGG + Intergenic
1090683823 11:129092689-129092711 TTTTAGTTGTGGTCACCTTAAGG - Intronic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1090870104 11:130737003-130737025 TAATAATAATATTCACCTCATGG + Intergenic
1092118520 12:6026700-6026722 TGATAATTATAGTCACCCTGTGG - Intronic
1093499302 12:19793759-19793781 TAGTAATTATAGTCTCCCTGAGG - Intergenic
1093823255 12:23648444-23648466 TTTTAAATATAGTCACATTCTGG - Intronic
1094420650 12:30267439-30267461 TATTGACTATAGTCACCCTGTGG - Intergenic
1094715345 12:33008618-33008640 CATTAACTATAGTCACCATGTGG + Intergenic
1095102614 12:38200325-38200347 AATTAATTATAGTCACTTTTTGG - Intergenic
1095856780 12:46868669-46868691 TATTGATTATGGTCATCCTATGG - Intergenic
1096486753 12:51987787-51987809 TATTGACTATAGTCACCCTGTGG - Intronic
1096566244 12:52482736-52482758 TATTAACTATAGTCATCCTACGG + Intergenic
1098033183 12:66275411-66275433 TTTTAAGTATAGTCAACTTTTGG + Intergenic
1098303405 12:69077663-69077685 TATTAAGTATAGTCACCATTGGG - Intergenic
1098742281 12:74188564-74188586 TATTAACTATAGTCACCATGAGG - Intergenic
1098789248 12:74799780-74799802 TTTTAATTATAGTTGCCATATGG - Intergenic
1099054417 12:77820835-77820857 AATAAAATATAGTCACTTTAAGG - Intergenic
1099490800 12:83285618-83285640 TATCAATTATAATTACCTTCTGG - Intergenic
1100204536 12:92334025-92334047 TATTAACTATAGTCCTCCTATGG + Intergenic
1100745532 12:97641630-97641652 TATTAAGAATAGTCACCATGTGG + Intergenic
1103787897 12:123447118-123447140 TAATAATAATAGCCACCCTAAGG - Intergenic
1104628412 12:130378640-130378662 TTTTAATTTTAGTCATCTTGTGG + Intergenic
1106146904 13:27057247-27057269 TAATAATAATAAACACCTTATGG + Intergenic
1106776208 13:33012418-33012440 TATTAACTATAGTCACCATGTGG - Intergenic
1107044877 13:35983550-35983572 TATTGACTATAGTCACCCTGTGG - Intronic
1107386125 13:39911645-39911667 TTTTAATGAAATTCACCTTAAGG + Intergenic
1107612693 13:42132327-42132349 TGTTAACTATAGTCATCCTACGG + Intronic
1107649695 13:42532468-42532490 TGTTAACTATAGTCACTCTATGG + Intergenic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1108226015 13:48290089-48290111 TGTTAATTAAAGTCATCCTACGG + Intergenic
1108797855 13:54053967-54053989 TGTTAACTATATTCACCGTACGG - Intergenic
1110024988 13:70525727-70525749 TATTAGCTATAGTCACCTTGCGG - Intergenic
1110697472 13:78508147-78508169 GATTAAATTTATTCACCTTACGG + Intergenic
1110908177 13:80919011-80919033 TCTTATTTATTTTCACCTTATGG - Intergenic
1111123662 13:83884351-83884373 TATTAATCACAGACACCATAAGG - Intergenic
1111467819 13:88640719-88640741 TATTGACTATAGTTACCTTTCGG + Intergenic
1111560421 13:89937670-89937692 TATTAATAATAGTTAGCTTTAGG + Intergenic
1112135166 13:96570109-96570131 TAATAATTACAGGCACATTAGGG + Intronic
1112209046 13:97355478-97355500 TATTTATTAGAGAAACCTTAGGG + Intronic
1112710213 13:102119088-102119110 TATCAATAATAGTGACCTCATGG + Intronic
1112836038 13:103515120-103515142 TATCAATAAAAGTGACCTTAGGG - Intergenic
1114769829 14:25416270-25416292 TGATAATTAAAATCACCTTATGG - Intergenic
1115195574 14:30795278-30795300 TATTGATTAAGTTCACCTTATGG + Intergenic
1115243071 14:31268471-31268493 TCTTAATTAAAATGACCTTAAGG - Intergenic
1115277967 14:31629416-31629438 TATTTATTATAGTGATGTTAAGG + Intronic
1116320965 14:43462255-43462277 TGTTAACTATCATCACCTTATGG + Intergenic
1116414409 14:44663220-44663242 TATTATTTATAGTTTCCATAGGG - Intergenic
1116631865 14:47346026-47346048 TGTTAACTATAGTCATTTTACGG - Intronic
1116631899 14:47346666-47346688 TCTTAATTATAGTTTTCTTATGG + Intronic
1116963141 14:50987637-50987659 TATTTGTTATAATCATCTTAAGG + Intronic
1117746530 14:58875354-58875376 TTTAAAAAATAGTCACCTTAAGG + Intergenic
1117760035 14:59017008-59017030 TATTAACTATAGCCACCATATGG - Intergenic
1117865753 14:60147319-60147341 TATTAACTGTAGTCACCATGCGG - Exonic
1118378388 14:65197246-65197268 TATTGACTATAGTCACCCTGTGG + Intergenic
1118504718 14:66398726-66398748 TTAAAATTATATTCACCTTATGG - Intergenic
1118757729 14:68857142-68857164 TATTGACTATAGTCACCCTGTGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121298046 14:92846081-92846103 TGTGAACTATAGTCACCCTATGG + Intergenic
1121921157 14:97882894-97882916 TTTAACTTATAGTCACCTTCTGG - Intergenic
1121929845 14:97962558-97962580 TAATAATTGTAGTGACCTGATGG - Intronic
1122010117 14:98739466-98739488 TATTAGTTAAAGTCATCATATGG + Intergenic
1123098712 14:105779411-105779433 TGTTAGTTATAGTCACCCTATGG + Intergenic
1125910843 15:43437335-43437357 TATAAATTATTTTCACCGTAGGG + Intronic
1127058811 15:55161163-55161185 TATTAACTATAGTCACCTTGCGG - Intergenic
1127447551 15:59080446-59080468 TATTAATTATGGCAACCTTTTGG + Intronic
1128073038 15:64809018-64809040 TCTTGATTATTGTCACCTGAAGG - Intergenic
1128284250 15:66423294-66423316 TATTAATCATAGTTATTTTAAGG + Intronic
1128593060 15:68919566-68919588 TTTTAATTATAGTTACTGTAAGG - Intronic
1129131632 15:73503530-73503552 AATAAATTATAGTTACATTATGG + Intronic
1129597729 15:76977722-76977744 TGTTAATTATAGTCATCCTAGGG + Intergenic
1131743278 15:95417509-95417531 TATTAATTAAGGTCACTTTTTGG + Intergenic
1131917342 15:97283123-97283145 TATTAATACTAGGCACCTAAGGG + Intergenic
1135876855 16:26209436-26209458 TAATAATTATAGTCACCATGTGG - Intergenic
1136489196 16:30594421-30594443 TGTTAACTATAGTCATCCTACGG - Intergenic
1137256715 16:46781155-46781177 TATTAACTATAGTCATCCTACGG + Intronic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1138275671 16:55732379-55732401 TATTAATTATTGTTACTTTGTGG + Intergenic
1138405262 16:56787877-56787899 TATTAATCACAGTCACGCTAAGG - Intronic
1138912782 16:61422434-61422456 TATTGACTATAGTCACCCTACGG + Intergenic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1139519334 16:67471560-67471582 TGTTAAATACAGTCACCCTATGG + Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1140969300 16:79997509-79997531 TAATAACAATAGTCAACTTAGGG + Intergenic
1141222690 16:82085935-82085957 TTTTTATTATAGCCATCTTAGGG - Intronic
1142440132 16:90092693-90092715 AATTAATTATAGTCACTTTTTGG - Intergenic
1143206716 17:5146711-5146733 TATTATTTATATTCATCTTTGGG + Intronic
1146658313 17:34648351-34648373 TATTAATTATATGCAAATTAAGG + Intergenic
1147538991 17:41340901-41340923 TAGGAATTTTAGTCACTTTATGG - Intergenic
1149346091 17:55737804-55737826 TCTTATTTATAGTTACCTTTAGG - Intergenic
1149873682 17:60207476-60207498 TATTATTTATATTCATCTTTGGG - Intronic
1150087465 17:62284732-62284754 TATTATTTATATTCATCTTTGGG - Intergenic
1151034397 17:70781289-70781311 TGTTAACTATATTCACCCTATGG - Intergenic
1152000017 17:77639422-77639444 TTTTACTTAAAGTCAGCTTATGG - Intergenic
1152957422 18:50868-50890 AATTAATTATAGTCACTTTTTGG + Intronic
1155127930 18:22898665-22898687 TATTAATGATAATCACCATGAGG + Intronic
1155812143 18:30250268-30250290 TAATAAATATAGTTACTTTAAGG + Intergenic
1155855287 18:30826912-30826934 TATTGATGATATTCACCCTAAGG - Intergenic
1157685931 18:49642460-49642482 TATTAACTGTAGTCACCATGTGG + Intergenic
1157879907 18:51311650-51311672 TGTTGATTGTAGTCACCCTATGG - Intergenic
1158966346 18:62625406-62625428 GTTTGATTATAGTCTCCTTAAGG + Intergenic
1159297191 18:66508325-66508347 TATTAACTATAGTTACCATGTGG - Intronic
1159520896 18:69521753-69521775 TATTACCTATAGTCACTCTACGG - Intronic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1159683539 18:71386711-71386733 TATTAATACTAATCACCATAAGG - Intergenic
1166285474 19:41824104-41824126 TGTTAAATATAGTCATCCTACGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
925016459 2:529378-529400 TTCAAATTATACTCACCTTAAGG - Intergenic
925017058 2:537146-537168 TAAAATTTAAAGTCACCTTATGG + Intergenic
926371747 2:12185591-12185613 TATTAACTGTAGTCACCATGTGG - Intergenic
927061659 2:19428735-19428757 TAAGAATCATAGTCACCTTTGGG + Intergenic
927622188 2:24673207-24673229 TCTTAATTATACTCATTTTATGG - Intronic
928351527 2:30560892-30560914 TATGAATCATAGTCAGCTTTGGG + Intronic
928787003 2:34900207-34900229 TATTAACTATAGTCTTCATATGG + Intergenic
928847480 2:35694832-35694854 TATTAATTATAATGATCATATGG + Intergenic
929174765 2:38965211-38965233 CTTAAATTATAGTCACCTCAAGG + Intronic
929326457 2:40617493-40617515 TATTGACTATAGTCACCCTATGG + Intergenic
929467503 2:42158502-42158524 TAGTCACTATAGTCACCTTGTGG - Intergenic
929638772 2:43553794-43553816 TTTAAATTATAGTCATCCTATGG + Intronic
929848316 2:45555958-45555980 TATTAATTAATATTACCTTAAGG + Intronic
929939456 2:46321825-46321847 TATTATATATAATAACCTTATGG - Intronic
931436019 2:62247377-62247399 TGTTAACTATAATCACCCTAGGG + Intergenic
931698001 2:64886339-64886361 TTTTAATTATAGCCATCCTAAGG + Intergenic
931736986 2:65204688-65204710 TATTAACCATGGTCACCATATGG - Intergenic
933127655 2:78630841-78630863 TATTAACCATGTTCACCTTACGG + Intergenic
933506696 2:83185081-83185103 TATTCACTATAGTCAAGTTATGG + Intergenic
934049173 2:88195983-88196005 TATGAACTATAGTCATCTTGTGG + Intergenic
935136468 2:100307672-100307694 TATTAACTGTAGTCAACATATGG - Intronic
935409465 2:102745358-102745380 TATTAGTTATAGTTATTTTAAGG + Intronic
935461332 2:103338464-103338486 TGTTAACTATAGTCACAATAGGG + Intergenic
936824583 2:116565841-116565863 TATTAATTATAATGCCCATATGG - Intergenic
937570085 2:123346872-123346894 TATTTATTATAGTCAGATAATGG + Intergenic
937614934 2:123911106-123911128 TATTATTTATAATCACATTATGG + Intergenic
938321020 2:130363956-130363978 TTTTAATTATAGCCATCCTAGGG + Intronic
938717426 2:134033638-134033660 TATTTATTATAGTCACTACATGG - Intergenic
939209118 2:139148865-139148887 TTTTAATTATAGAGACTTTATGG - Intergenic
939598293 2:144155297-144155319 TAATAATTTTTGTCACCTTCAGG + Intronic
939688852 2:145232750-145232772 AAGTAATTATAGTCTCCTCATGG - Intergenic
941058859 2:160822181-160822203 TGTTGATTATAGTCACCCTGTGG + Intergenic
941065490 2:160898136-160898158 TGTTAATTATAGTTATTTTAAGG + Intergenic
941714556 2:168749945-168749967 TTTTAATTACATTCACATTAAGG + Intronic
943338683 2:186650528-186650550 TATTAACTATAGTCAATCTACGG + Intronic
943357615 2:186876594-186876616 TATTAAATATAATCACCATGTGG + Intergenic
946831496 2:223732659-223732681 TATTCATTACTGTCTCCTTAGGG - Intergenic
947997516 2:234541254-234541276 TATTAACTATGGTCACCATGTGG - Intergenic
1169895032 20:10494922-10494944 TAATAACTATAGTCACCATGAGG - Intronic
1171817517 20:29801446-29801468 AATTAATTATACTCACTTTTTGG + Intergenic
1171900818 20:30854652-30854674 AATTAATTATAGTCACTTTTTGG - Intergenic
1172879143 20:38187129-38187151 TTTTAATTACAGTCACCAAAGGG - Intergenic
1177464666 21:21459810-21459832 TATTAATTATAGTCACAATGCGG - Intronic
1177664958 21:24143475-24143497 TATTAATTATAGTCAAGTTAAGG + Intergenic
1177948768 21:27507216-27507238 CATTAATTATAGTCACCAAGCGG + Intergenic
1177958610 21:27633034-27633056 TGTTAACTATAGTCATTTTATGG - Intergenic
1178220663 21:30654762-30654784 TAGTTTTTATTGTCACCTTATGG - Intergenic
1180320852 22:11320105-11320127 AATTAATTATAGTCACTTTTTGG + Intergenic
1180569954 22:16705115-16705137 TGATAATTATAGTCACCCTGTGG - Intergenic
1181892276 22:26073996-26074018 TCTTAATTAAAGTCTCCTTATGG - Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1183025283 22:35060965-35060987 TATTAACTATAGTCACCATGTGG - Intergenic
950588538 3:13916546-13916568 TTTTTATTATAGTCACCTAGTGG - Intergenic
951176030 3:19601035-19601057 TATTGATTATAGTCCCCCTGTGG - Intergenic
951652914 3:24972047-24972069 TATTAACTATATTCAGCCTATGG + Intergenic
954805691 3:53218728-53218750 TGTTAATTATGGTCAGCCTACGG - Intergenic
954953972 3:54502555-54502577 TATTAATTGTAGTTATTTTAAGG + Intronic
957503388 3:81087332-81087354 TATTTATTATTTTCCCCTTAAGG + Intergenic
957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG + Intergenic
958048041 3:88308924-88308946 TATTACTTATAGTTACCTCTGGG - Intergenic
958439717 3:94141278-94141300 TGTTAACTATAGTCATCCTATGG - Intergenic
958588387 3:96120248-96120270 TAGTAATTATAGACACCTCAGGG - Intergenic
958599346 3:96274960-96274982 TATTAGCTATATTCACCATACGG - Intergenic
958972449 3:100626971-100626993 TATTAATTATAGTAACTTTTTGG + Intronic
959344902 3:105181711-105181733 TAATAATTATACTAAACTTAAGG + Intergenic
959403351 3:105930076-105930098 TATTCCTTATACTCACTTTAGGG - Intergenic
959477884 3:106834042-106834064 TATTTAATATAGTTTCCTTAAGG + Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
961423102 3:126822853-126822875 TATTAATTATTGTAGCTTTATGG + Intronic
961953691 3:130777381-130777403 TGTTAACTATAGTTACCCTACGG - Intergenic
962427963 3:135290091-135290113 TCTTAATTATTGTTGCCTTATGG + Intergenic
963505022 3:146173555-146173577 TTTTAATTCTATTCACTTTATGG - Intergenic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
965168553 3:165229099-165229121 TATTCATAATAGCCAACTTATGG - Intergenic
966065945 3:175821973-175821995 TATGAAGGATAGTCACTTTAAGG + Intergenic
970074964 4:12207711-12207733 TGTTAATTATAGTCACAAGAAGG + Intergenic
972236643 4:37142256-37142278 TATTAACTGTAATCACCATATGG + Intergenic
972466152 4:39358989-39359011 TATTAGTTAGAGGCACCTTTGGG - Intronic
974019093 4:56677121-56677143 TCTCCATTATAGTAACCTTAAGG + Intronic
974068642 4:57103903-57103925 TATTAATTATAGTCATCATGAGG + Intronic
974651724 4:64762665-64762687 TCTTTATTATAGTCATCATAGGG + Intergenic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
975659417 4:76673749-76673771 TATTAAGTATATTCACATTGTGG + Intronic
977155734 4:93570791-93570813 TTATAATTATAGACATCTTATGG + Intronic
977782907 4:100999260-100999282 TGTTAATTATAGTCATCCAATGG + Intergenic
978081588 4:104599600-104599622 TATTAACTCTAGTTACCATATGG + Intergenic
978139692 4:105304096-105304118 TATTCTTTATGGTCACCATAGGG - Intergenic
978171026 4:105670314-105670336 TTTTAATTATAGCCATCTTGTGG + Intronic
978352174 4:107831468-107831490 TAATTCGTATAGTCACCTTATGG - Intronic
978922256 4:114199213-114199235 TATTAAATATAGTCTTCTTTGGG + Intergenic
979128949 4:117014954-117014976 TAATATTTATAATCAACTTAGGG + Intergenic
980145501 4:128978666-128978688 TATTTATTATAGTCACTCTTTGG - Intronic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
980863391 4:138525779-138525801 TATCAGTTTTAGTCACCTTTAGG - Intergenic
981180851 4:141742313-141742335 CATTAACCATAGTCACCATACGG - Intergenic
981434697 4:144706778-144706800 ATTTAATTATTGCCACCTTATGG - Intronic
982963427 4:161870673-161870695 TGTTAATAATACTTACCTTAAGG + Intronic
983156040 4:164350441-164350463 TATTAAATATATTCATCCTATGG - Intronic
983304849 4:165972920-165972942 TATGAAGTATAGTCATCTGATGG + Intronic
983406562 4:167338537-167338559 TATTATTTAAAAGCACCTTAGGG - Intergenic
983497917 4:168464759-168464781 TGTTAATTATATCCACCCTATGG + Intronic
983551708 4:169024468-169024490 AATTAATCATAGTCTTCTTAAGG - Intergenic
983924762 4:173388412-173388434 CATCAATTAAATTCACCTTAAGG + Intronic
983975321 4:173926844-173926866 TCCTAATTATAGTCACCCTGTGG - Intergenic
985136704 4:186793397-186793419 TAATAATTTTAGCTACCTTATGG - Intergenic
985441693 4:189986175-189986197 AATTAATTATAGTCACTTTCTGG + Intergenic
986160047 5:5219284-5219306 TGTTAACTATCGTCACCCTATGG + Intronic
987413668 5:17640207-17640229 TGTTAACTATAGTCACCATGTGG + Intergenic
987579041 5:19764921-19764943 TAGTAATTATAGCCAAATTAAGG - Intronic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
988258708 5:28854151-28854173 TATTAACTATAGTCACCCTGTGG - Intergenic
988310061 5:29544791-29544813 TATTAACTATAGTCACCATGCGG + Intergenic
988394673 5:30681278-30681300 TATTAACTATAGTGACTATATGG - Intergenic
989796133 5:45475606-45475628 TAATAATGATAGTAACCTTTTGG - Intronic
990100544 5:52180264-52180286 TATTGGTTATAGTCACTTTAAGG - Intergenic
990552662 5:56899575-56899597 TATTAAGTAAATTGACCTTAAGG - Intergenic
990783031 5:59387849-59387871 TGTTAACTATAGTCACCCTGAGG + Intronic
991534361 5:67650390-67650412 CATCAATTATAGTCAAATTATGG + Intergenic
992900289 5:81288253-81288275 TATTCATTAAAGTCTTCTTATGG - Intergenic
992987327 5:82245650-82245672 TATGAATTCTAGTCACATAAAGG + Intronic
993770831 5:91924109-91924131 TATTATCTATATTCACCATAAGG - Intergenic
995654353 5:114408289-114408311 TATTATTTATAATCATTTTAAGG + Intronic
995938764 5:117552166-117552188 TATTAATTTTTGTCACCATGGGG - Intergenic
996062347 5:119046131-119046153 TATTAATTATACTTACCTTCAGG + Intronic
996870543 5:128187333-128187355 TATTATTTATTGAAACCTTAGGG + Exonic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
997966406 5:138360087-138360109 TAATAATTATAGTCAGGTTCAGG + Intronic
997966692 5:138362624-138362646 TATTTCTTATAGGCAACTTAGGG - Intronic
998288582 5:140889027-140889049 TATAAATTATAATCAAATTACGG - Intronic
998709828 5:144810923-144810945 TATTAGTTATATTCGCCTTGTGG + Intergenic
998718340 5:144911681-144911703 TTTTAATTATACTTACCTTCTGG - Intergenic
999545491 5:152624327-152624349 TATTAATAACAGACACCCTAAGG - Intergenic
999903815 5:156117343-156117365 TATTAATTCAAGTCCCCTTGAGG + Intronic
1000399352 5:160809592-160809614 TGTTAACAATAGTCATCTTACGG + Intronic
1001029716 5:168253302-168253324 TAATAATAGCAGTCACCTTATGG + Intronic
1003733883 6:8855796-8855818 TATTGATTTTGGTCACCTCATGG + Intergenic
1004238436 6:13896583-13896605 TATTAACTGTAGTCATCCTATGG + Intergenic
1004641996 6:17524592-17524614 TTTTAATTATAGGCAAATTAAGG + Intronic
1004659782 6:17700063-17700085 TATTGAATTTAGTCACCTAAAGG + Intronic
1005530239 6:26697263-26697285 TATTAACTGTAGTCACCATACGG - Intergenic
1005540557 6:26804383-26804405 TATTAACTGTAGTCACCATACGG + Intergenic
1005563807 6:27068790-27068812 TAATACTAATAGTTACCTTATGG - Intergenic
1006074496 6:31522487-31522509 TATTAAGTTTAGTCACCATAAGG - Intergenic
1007456678 6:41983532-41983554 TATTAACTATAATCACCATGTGG + Intronic
1009011371 6:57846480-57846502 TATTAACTGTAGTCACCATACGG + Intergenic
1009405850 6:63311798-63311820 TATTAACTGTAGTCACCATGTGG + Intronic
1009714433 6:67370582-67370604 TACTGATCATAGTCACCTTGTGG + Intergenic
1009994466 6:70883027-70883049 TTTTAATAATAGCCACCTAATGG - Intronic
1010632479 6:78215063-78215085 TTTTAACTATAGTCACCCTATGG + Intergenic
1010809551 6:80284704-80284726 TAGAAATGTTAGTCACCTTAAGG - Intronic
1011234347 6:85199663-85199685 TATTAATTAAAGTTCCTTTAAGG + Intergenic
1011880547 6:92018747-92018769 CATTAATTTTAGTAACATTATGG - Intergenic
1012230653 6:96757357-96757379 TATTAACTATAGTCACCATGTGG - Intergenic
1012713282 6:102635908-102635930 TTTTAATTAGACTCACCATAAGG - Intergenic
1014108955 6:117598840-117598862 TATTAACTGTAATCATCTTATGG - Intronic
1014345299 6:120262791-120262813 TATTAACTATAGCCACCATGTGG - Intergenic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1015741650 6:136461983-136462005 TATTTATTTATGTCACCTTAAGG + Intronic
1016624522 6:146150610-146150632 TGTTAACTATAGTCACCCTGTGG + Intronic
1016642953 6:146371519-146371541 TATTGACTATAGTCACCCTACGG + Intronic
1018334181 6:162767356-162767378 TAAAAATTATAGTCACCAGAAGG - Intronic
1018688529 6:166323202-166323224 TGATAATTATAGTCTCCTTTAGG + Intronic
1020053118 7:5096292-5096314 TGTCAATTATAGTCACCCTATGG + Intergenic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1022085238 7:27061247-27061269 TGCGAATTATAGTCATCTTAAGG - Intergenic
1022124715 7:27344550-27344572 TATTAACTATAGTCACCCTGTGG + Intergenic
1022370059 7:29762326-29762348 TATTTATTGAAGTCACCATATGG + Intergenic
1023137472 7:37066577-37066599 TATTAACTATAGTCATCCTACGG - Intronic
1024108090 7:46113822-46113844 TATTGACTATAGTCACCCTGTGG + Intergenic
1024310083 7:47961152-47961174 TATTCATTATAGCCAAGTTATGG + Intronic
1024415341 7:49098793-49098815 TATTGATTATAGTCACCTGTTGG - Intergenic
1026039014 7:66850987-66851009 TATTAATGGTAATTACCTTAGGG + Intergenic
1027941958 7:84694006-84694028 TATTAATCACAGTCACCATGAGG + Intergenic
1028095740 7:86758214-86758236 TATTAATAATAGCCACTTGATGG + Intronic
1028717255 7:93985374-93985396 TATTACTAATACTCACCTTAAGG + Intronic
1031071422 7:117166384-117166406 AATAAACTATAGTCACCTTTTGG - Intronic
1031397355 7:121289431-121289453 TATTAACAATAGTGACCTTTTGG - Intronic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1031887943 7:127259922-127259944 TATGAATCAAAGTCACATTAAGG - Intergenic
1032623725 7:133565308-133565330 CAATAATTATAGTCTCCTCATGG + Intronic
1033146425 7:138874323-138874345 TATTGATTATAGTTACCATGAGG - Intronic
1033932614 7:146542997-146543019 TATTAACTATAGTCATCATGTGG - Intronic
1034013334 7:147554650-147554672 TATTCATTATAGCCCCCTAATGG - Intronic
1035944090 8:3940270-3940292 TATTAATGATAGACATTTTAGGG + Intronic
1036089057 8:5645329-5645351 TGTTAACTATAGCCATCTTACGG - Intergenic
1037696817 8:21230735-21230757 TAGTAATTATAGTCGGCTAACGG + Intergenic
1038645418 8:29357586-29357608 TGTTAACTATATTCACCCTACGG + Intergenic
1039108685 8:34018490-34018512 TGTTAATTATAGTTATCATATGG + Intergenic
1039318482 8:36400149-36400171 TGTTAACTGTAGTCACCCTATGG - Intergenic
1039360099 8:36866807-36866829 TATTAACTATAGTCACTTTACGG - Intronic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040016446 8:42704241-42704263 TTTTAAATATAGTCACGTTGGGG + Intronic
1040061296 8:43105234-43105256 TGTTAATTATAGTCATCCTATGG + Intronic
1040748726 8:50679435-50679457 TTATAATTATAGCCACATTATGG + Intronic
1040758708 8:50811894-50811916 TATAAACTATAGTCACCAGAAGG - Intergenic
1040992628 8:53368956-53368978 TATTTATTAAAGTCACCATGGGG + Intergenic
1041411349 8:57559993-57560015 TATTAAGTATATACAACTTATGG + Intergenic
1041850013 8:62379862-62379884 TATTATTTATAGTCAGTTTGAGG - Intronic
1042627544 8:70775200-70775222 TCTTAATTCTAGTCACTTTTTGG + Intronic
1043717149 8:83501447-83501469 TAATAATTTTAGTCACATAAAGG + Intergenic
1043957501 8:86378058-86378080 TTTTAATTATTTTCACTTTATGG + Intronic
1046287651 8:112115539-112115561 TATAAATTAAAGTCAAATTATGG - Intergenic
1046689387 8:117266123-117266145 AATTATTTATATTCACCTTTGGG - Intergenic
1046884726 8:119353220-119353242 TATTAATTATAGTCATCAGCAGG + Intergenic
1046889879 8:119411211-119411233 TGTTGACTATAGTCACCCTATGG + Intergenic
1049921006 9:364246-364268 TATTAAGAATAGTCACATTAGGG + Intronic
1050202794 9:3164543-3164565 TTTTAATTATAGTGACTTTGTGG + Intergenic
1050993157 9:12177709-12177731 TATTAATTATATCTATCTTAGGG + Intergenic
1051025889 9:12610293-12610315 AAATAATTATAGTCACCTCAAGG - Intergenic
1051088890 9:13383399-13383421 GATTAATTATAGAAACATTAGGG + Intergenic
1051559147 9:18420785-18420807 TTTTAATTTTAAGCACCTTAAGG - Intergenic
1051776487 9:20639775-20639797 TATTAATTATTGGTTCCTTAGGG - Intergenic
1052077859 9:24166366-24166388 TATTAATGGTAGTCACCATATGG + Intergenic
1053623230 9:39842149-39842171 TAATAAATATAGTCACCCTGTGG - Intergenic
1053881639 9:42601079-42601101 TAATAAATATAGTCACCCTGTGG + Intergenic
1053945402 9:43303977-43303999 TCTTAATTATATACATCTTACGG + Intergenic
1055082896 9:72284621-72284643 TTTTAATTATAGTCATCCTAGGG + Intergenic
1055727558 9:79247751-79247773 TATTAACAATAGTCACCATGCGG - Intergenic
1055802646 9:80057046-80057068 TATTCATAATAGTCAACATATGG + Intergenic
1056632049 9:88302034-88302056 TGTCAATTACAGTCACCTTCTGG + Intergenic
1056867292 9:90239718-90239740 AAAAAATTATTGTCACCTTAAGG - Intergenic
1056880624 9:90388994-90389016 CATTAACTTTAGTCACCTTGTGG - Intergenic
1058213128 9:102198417-102198439 TATTAACTATGGCCACCATATGG - Intergenic
1059033669 9:110729966-110729988 TATTATTGATTGTCATCTTAAGG - Intronic
1059551789 9:115236514-115236536 TCCTAATTATAGTCTCCTTTTGG + Intronic
1059614645 9:115935754-115935776 TTTTAACTATAGTCACCGTATGG + Intergenic
1059804611 9:117785082-117785104 TCTTAATTATAGTCACCAGGTGG + Intergenic
1060164251 9:121396169-121396191 TGTTAATTATAGTCATCCTATGG + Intergenic
1062740723 9:138173705-138173727 AATTAATTATAGTCACTTTTTGG - Intergenic
1203369073 Un_KI270442v1:285879-285901 AATTAATTATAGTCACTTTTTGG + Intergenic
1203588537 Un_KI270747v1:32555-32577 TCTTAATTATATACATCTTACGG + Intergenic
1187725013 X:22193185-22193207 TATTAATTATAATCACATTTAGG + Intronic
1187919224 X:24184613-24184635 TTTTATTTATAGTCATCTTTAGG + Intronic
1188287638 X:28347622-28347644 TGTTAACTATAGTCACCATGAGG + Intergenic
1188398318 X:29713626-29713648 TATGAATCACAGTCACCTGAAGG - Intronic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1190992083 X:55562448-55562470 TATTAACTATTGTCACCATGTGG + Intergenic
1191218538 X:57959966-57959988 TGTTAATTATAGTTACCCTATGG - Intergenic
1192475793 X:71441612-71441634 TATTAACTATAGTCATTCTACGG + Intronic
1192810483 X:74542899-74542921 AATTAATTGCAGTCACCTCAAGG - Intergenic
1192865371 X:75125989-75126011 TATGAATTTTAGTCACCTCATGG - Intronic
1193211788 X:78815309-78815331 CCTTAACTATAGTCACCTTCCGG - Intergenic
1193326388 X:80182559-80182581 TATTAATTAAAGATACATTAAGG - Intergenic
1193550227 X:82883341-82883363 TATTAATTCTAGTAGCCTTTTGG - Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1193805904 X:85994061-85994083 TAATAATTATAGTTAACTAAGGG + Intronic
1194363295 X:92982000-92982022 TATTGACTATAGTCACCTTGTGG - Intergenic
1194846978 X:98821655-98821677 TATTGTTTATAGTCAGCTTTAGG - Intergenic
1195719310 X:107851197-107851219 GAGTTATTATATTCACCTTATGG + Intronic
1195854390 X:109314486-109314508 TATTAATAGTAGTCACCTCTGGG + Intergenic
1196384714 X:115137095-115137117 TATTAACTATAGTCAACCTATGG + Intronic
1196942637 X:120792409-120792431 TATTTATTATAGTCACCATTTGG + Intergenic
1197538116 X:127717105-127717127 TATTAACCGTAGTCACCATAAGG - Intergenic
1197599112 X:128506908-128506930 TAATAATAATAGTCTCATTATGG + Intergenic
1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG + Intronic
1198759781 X:140019192-140019214 TTTTAATTATATTCAAATTAAGG + Intergenic
1198779004 X:140214858-140214880 TTTTAATTATATTCAAATTAAGG - Intergenic
1198986391 X:142458963-142458985 TATTAATGATAGCCACCTCCTGG - Intergenic
1199102204 X:143815626-143815648 TTTTGACTATAGTCACCTTGTGG - Intergenic
1199356875 X:146872935-146872957 TATAAATTATACTAACCTTTTGG - Intergenic
1199866013 X:151850882-151850904 TATTAACTATAGTCACCATACGG - Intergenic
1199903608 X:152202448-152202470 TGTTAATTGTAGTTACCTAAAGG - Intronic
1200335252 X:155344074-155344096 TATTAACTATAGTCATCACATGG + Intergenic
1200351216 X:155497147-155497169 TATTAACTATAGTCATCACATGG - Intronic
1200671536 Y:6098249-6098271 TATTGACTATAGTCACCTTGTGG - Intergenic
1201069211 Y:10129080-10129102 AATTAATTATAGTCACTTTTTGG - Intergenic
1201399626 Y:13591273-13591295 TATTAAATATAGACACCCCACGG + Intergenic
1202085842 Y:21135860-21135882 TATCAATTCTAGTCACATTCTGG + Intergenic
1202305978 Y:23471532-23471554 TGTTCATTATACTCACCTTGTGG + Intergenic
1202564831 Y:26199057-26199079 TGTTCATTATACTCACCTTGTGG - Intergenic