ID: 997595331

View in Genome Browser
Species Human (GRCh38)
Location 5:135103452-135103474
Sequence TGACCTCGAGGTCGTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997595320_997595331 22 Left 997595320 5:135103407-135103429 CCCTGGGTCCCCTGTCGGTCTGC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 77
997595323_997595331 13 Left 997595323 5:135103416-135103438 CCCTGTCGGTCTGCAGACTTGAC No data
Right 997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 77
997595322_997595331 14 Left 997595322 5:135103415-135103437 CCCCTGTCGGTCTGCAGACTTGA No data
Right 997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 77
997595321_997595331 21 Left 997595321 5:135103408-135103430 CCTGGGTCCCCTGTCGGTCTGCA 0: 1
1: 0
2: 0
3: 16
4: 149
Right 997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 77
997595324_997595331 12 Left 997595324 5:135103417-135103439 CCTGTCGGTCTGCAGACTTGACT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 997595331 5:135103452-135103474 TGACCTCGAGGTCGTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997595331 Original CRISPR TGACCTCGAGGTCGTGTTGG GGG Intronic