ID: 997595340

View in Genome Browser
Species Human (GRCh38)
Location 5:135103487-135103509
Sequence AAGCTGGGCCTCCTCCAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997595340_997595355 12 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595355 5:135103522-135103544 CCATGCGGGGGCTGGTGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 226
997595340_997595350 0 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595350 5:135103510-135103532 CCCTCCAGGGGTCCATGCGGGGG No data
997595340_997595356 21 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595356 5:135103531-135103553 GGCTGGTGTGCTGGCCTTCTTGG No data
997595340_997595348 -1 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595348 5:135103509-135103531 TCCCTCCAGGGGTCCATGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 124
997595340_997595346 -3 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595346 5:135103507-135103529 CTTCCCTCCAGGGGTCCATGCGG 0: 1
1: 0
2: 1
3: 17
4: 235
997595340_997595353 4 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595353 5:135103514-135103536 CCAGGGGTCCATGCGGGGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 253
997595340_997595357 28 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595357 5:135103538-135103560 GTGCTGGCCTTCTTGGTCTCAGG 0: 1
1: 0
2: 3
3: 18
4: 215
997595340_997595347 -2 Left 997595340 5:135103487-135103509 CCTATCTGGAGGAGGCCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 997595347 5:135103508-135103530 TTCCCTCCAGGGGTCCATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997595340 Original CRISPR AAGCTGGGCCTCCTCCAGAT AGG (reversed) Intronic
900644341 1:3702276-3702298 TAGCTGGGCCCCCTCCAGGAGGG - Intronic
901642225 1:10698618-10698640 ATGGTGGGCCTCTTCCAGGTGGG - Intronic
906059943 1:42941997-42942019 TAGCTGGGCTTCTTCCAAATAGG - Intronic
907746169 1:57215833-57215855 AAGCTTGGCCTTTTCCAAATAGG - Intronic
908650350 1:66326189-66326211 AAACTGGGCTTCCCCTAGATGGG + Intronic
909579674 1:77219976-77219998 CAGCTGTGTCTCTTCCAGATAGG - Intergenic
910316597 1:85891589-85891611 AAACAGGGCCTCAACCAGATGGG - Intronic
913281652 1:117190602-117190624 AATCTAGGACTCCTCCAGACAGG + Intronic
916120694 1:161525635-161525657 AATCTGGGCCTTGTCCAGCTTGG - Exonic
916130460 1:161607267-161607289 AATCTGGGCCTTGTCCAGCTTGG - Intronic
917479686 1:175401338-175401360 ACCCTGGGTGTCCTCCAGATGGG + Intronic
918122437 1:181551281-181551303 AAACTGGGCCTCCCCCTGCTTGG + Intronic
924233069 1:241978437-241978459 GGGCTGGGCCTCCACCAGAGGGG - Intergenic
1066199928 10:33134835-33134857 AAGCAGTGCCTCCTCGAGCTGGG - Intergenic
1067711735 10:48655988-48656010 AAGCGGGGCCTCCAGCAGAGCGG + Intronic
1072925053 10:99609888-99609910 AAGCGTGGCTTCCTACAGATGGG - Intergenic
1073498969 10:103918656-103918678 AACCTGGGCCTCCTAGAGGTTGG + Intergenic
1075497029 10:122930833-122930855 AAGCTGGTCCTCCAAAAGATGGG + Intergenic
1077280967 11:1745255-1745277 AAGCTGTCCCTCCTCCCGCTTGG - Intronic
1077895916 11:6453276-6453298 AACCTGGGCCTGCTCCTGAATGG + Intronic
1077907468 11:6545501-6545523 AAGCAGAGCCTCCTCCATCTCGG - Exonic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1080398496 11:31912236-31912258 AAGGTAGGGCTCCTCCAGACAGG - Intronic
1080871643 11:36241768-36241790 AAGCTAGCCCTCCTCCAGCAGGG - Intergenic
1083384452 11:62297161-62297183 GAGCTGGGCCTCCCACAGACAGG - Intronic
1083990096 11:66241582-66241604 AAGCTGGGCCTCCCCACTATGGG - Exonic
1084684677 11:70686625-70686647 CACCTGTGTCTCCTCCAGATAGG - Intronic
1087181242 11:95144558-95144580 AATCTGACCCTGCTCCAGATGGG + Intergenic
1091142858 11:133250944-133250966 AAGCTGTTCCTCCTCCTGCTTGG - Intronic
1092020508 12:5198731-5198753 AAGCGGGGGCCCCTCCAGCTAGG + Intergenic
1096569953 12:52516756-52516778 CTGCAGGGCCTCCTCCAGCTCGG + Exonic
1103050886 12:117778635-117778657 CAGCTGTGCCTCCACCAGCTGGG + Intronic
1105776827 13:23670031-23670053 CAGCTGAGCCTGCTCCAGAGGGG + Intronic
1106376182 13:29190515-29190537 AACCTTGCCCGCCTCCAGATTGG + Intronic
1117370084 14:55070180-55070202 AAACTGGCCCTGCTCCAGAATGG - Exonic
1121731396 14:96189621-96189643 ACGATGGGCCTCCCCCAGCTCGG - Intergenic
1122837210 14:104436171-104436193 GAGCTGAGCCTCCTGCAGATGGG + Intergenic
1122837489 14:104437288-104437310 GGGCTGGGCCTCCTGCAGCTGGG - Intergenic
1122863472 14:104593145-104593167 AAGCTGGACGCCCTCCACATAGG + Exonic
1127833655 15:62772517-62772539 AAGTTCTGCCTCCTCCAGTTTGG - Intronic
1128229227 15:66023379-66023401 CAGCTGGGCCTCCTGCAGACTGG - Intronic
1128523528 15:68391181-68391203 GAGCTGAGCCCCCTCCAGAATGG - Intronic
1128809673 15:70561773-70561795 AAGCTGGTCCTCCGAAAGATGGG - Intergenic
1134000505 16:10779305-10779327 AGGCTGGGCAAACTCCAGATAGG - Intronic
1136178830 16:28537400-28537422 AAACTGGGGCTCCTCCAGGGTGG - Intronic
1136376826 16:29870889-29870911 ATTGTGGGCCTCTTCCAGATGGG - Intergenic
1136629258 16:31479742-31479764 AATTTGGGCATCCTCAAGATAGG - Intergenic
1137628048 16:49921906-49921928 AAGCTGGGCCCCCATCAGCTGGG - Intergenic
1137719885 16:50621782-50621804 AAGCTGAGGCTCTTCCAGACAGG + Intronic
1138634023 16:58322281-58322303 AAGTTTGGCCTCATACAGATAGG - Intronic
1141752841 16:85970600-85970622 AAGCTCTGCTTCCTCCAGTTGGG + Intergenic
1141768725 16:86075601-86075623 AGCCTGGGCTTCTTCCAGATGGG - Intergenic
1141810252 16:86371261-86371283 AGCCTGGGACTCCTCCAGACCGG + Intergenic
1141878165 16:86840599-86840621 GACCTGGGCCTCCTCCAGGGTGG + Intergenic
1142033813 16:87851729-87851751 CTGCTGGGCTTCGTCCAGATCGG - Exonic
1145287504 17:21517269-21517291 CTGCTGGGCCTCCTCCAGCATGG + Intergenic
1145390124 17:22449120-22449142 CTGCTGGGCCTCCTCCAGCATGG - Intergenic
1146123667 17:30216010-30216032 AAGCTGGTCCTCCTCCAAATAGG - Intronic
1147983302 17:44288574-44288596 AACCTGGCCCTCCTCCAGGGTGG + Intergenic
1148847526 17:50538106-50538128 AGGCCGGGCCTGCTCCAGGTCGG - Exonic
1148891547 17:50811199-50811221 ATGCTCAGCCTCCTGCAGATGGG - Intergenic
1149324646 17:55517433-55517455 AAGCTGGGACTCCCTCAGCTGGG - Intergenic
1149421777 17:56518687-56518709 CAGGTGGGCCAGCTCCAGATTGG - Intergenic
1149581141 17:57751092-57751114 AAGCTGGCCCTTCTCCAGCCTGG + Intergenic
1154339399 18:13490788-13490810 AGCCTGGCCCTCCTCCAGAATGG - Intronic
1161772281 19:6237271-6237293 AGGCTGGGTGTCCTCCAGGTGGG - Intronic
1164668961 19:30062399-30062421 GGTCTGTGCCTCCTCCAGATGGG - Intergenic
1164668990 19:30062500-30062522 GGTCTGTGCCTCCTCCAGATGGG - Intergenic
1164669016 19:30062600-30062622 GGTCTGTGCCTCCTCCAGATGGG - Intergenic
1166299617 19:41906502-41906524 GGGCGGGGCCTCCTCGAGATGGG + Exonic
1166880951 19:45929609-45929631 AAGCTGGGCATGCCCCAGTTGGG + Intergenic
1166895458 19:46019415-46019437 TACCTCTGCCTCCTCCAGATCGG - Exonic
930093862 2:47551943-47551965 GAGCTGGGCCTCCTCCTGAAGGG + Intronic
931855654 2:66299453-66299475 TAGCTGAGCCTCCTGCAGAATGG + Intergenic
931986784 2:67749868-67749890 AAGATGGGACTCCTACAGGTGGG - Intergenic
934152567 2:89161738-89161760 AAGCTGGGCTTCCTCTTGAATGG + Intergenic
934214678 2:90020180-90020202 AAGCTGGGCTTCCTCTTGAATGG - Intergenic
934526881 2:95057452-95057474 AAGCTGTGTCTTCTCCAGAAGGG - Intergenic
935396429 2:102614343-102614365 AATCTGGACCTCATTCAGATTGG + Intergenic
940344727 2:152617442-152617464 TAACTCAGCCTCCTCCAGATGGG - Intronic
940864598 2:158805377-158805399 AAGCTGTGCGTCCTCAAGAGTGG + Intronic
941003021 2:160221319-160221341 GAGCAGGGCCTGCTCCAGAGCGG - Intronic
946203098 2:218083027-218083049 AGGCTGAGCCTCTTCCAGAGAGG - Intronic
948491406 2:238315416-238315438 CAGCCGGGCTTCCTCCAGTTTGG + Intergenic
948789073 2:240367972-240367994 CAGCTGGGCCCCTTCCAGCTGGG - Intergenic
948967102 2:241391363-241391385 AAGCGGGGCCTCCTTCACCTTGG + Intronic
1169116711 20:3071257-3071279 ACGCTGGGACCCCTCCAGGTGGG - Intergenic
1172231858 20:33342075-33342097 AATCTGGGCCGCCTGCAGAGAGG + Intergenic
1176039763 20:63059146-63059168 AGGAGGTGCCTCCTCCAGATGGG + Intergenic
1176126675 20:63478623-63478645 GAGCTGGTCCTCATCCCGATGGG + Intergenic
1183439187 22:37813590-37813612 CACCTGGGCCTCCTGCAGCTTGG - Exonic
1183453823 22:37910799-37910821 AAGCTGGGACTCCACCAGCTTGG + Intronic
950301836 3:11886474-11886496 AAGATGGGCTTTCTCCATATTGG + Intergenic
950433666 3:12966376-12966398 CAGGTGGGCTTCCTCCAGAGGGG + Intronic
950467799 3:13165655-13165677 CACCTGGGCCTCTTCCAGAGGGG - Intergenic
950828808 3:15854157-15854179 GAGCTGGGCCTCCTTAAAATAGG - Intronic
950831039 3:15876648-15876670 AAGGTGGGACTCCTCAAGAATGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952906592 3:38143126-38143148 AAGCTGGGCCCCCTCCTCACAGG + Intergenic
956964936 3:74447937-74447959 AAGCTGGGCTGCATCCTGATGGG - Intronic
958067513 3:88563282-88563304 AAGTTTGGCCTCTTCCAGTTGGG - Intergenic
960117444 3:113910821-113910843 AAGCTGGTTCTCCTCCAGGGGGG - Intronic
969135477 4:5025348-5025370 GAGCTGGGCTTCCTCTAGTTTGG + Intergenic
976824473 4:89245611-89245633 CAACAGGGCCTACTCCAGATGGG - Exonic
983084849 4:163430132-163430154 AAGTAGGGCCTACTTCAGATAGG + Intergenic
984866970 4:184289118-184289140 CAGCTGGGCCTACTCCAGAAGGG + Intergenic
990035745 5:51317128-51317150 CACCTCGGCCTCCCCCAGATAGG + Intergenic
996466598 5:123809789-123809811 AAGCTGGGCCTCATGCAGCCAGG + Intergenic
997595340 5:135103487-135103509 AAGCTGGGCCTCCTCCAGATAGG - Intronic
998384235 5:141747284-141747306 AGGCTGGGCCTGCTCCTGACTGG + Intergenic
999296289 5:150461493-150461515 GGGCTGGGCCTCCTCCTGAGAGG - Intergenic
1000851007 5:166340206-166340228 CAGCTGGCCCTCATCCAGCTTGG - Intergenic
1001277236 5:170359754-170359776 ATGCTGGGCCTGCTGCAGAGGGG - Intronic
1002943235 6:1735708-1735730 AAGCTGGACCTTGTCCAGATTGG - Intronic
1005130231 6:22498467-22498489 CAGCAGGGCCTCCTCCTGGTGGG - Intergenic
1006122675 6:31816727-31816749 AATCTGGGCCTTGTCCAGCTTGG - Exonic
1006124538 6:31828921-31828943 AATCTGGGCCTTGTCCAGCTTGG - Exonic
1006387150 6:33737634-33737656 ACACTGGGCCTCTTCCACATTGG + Intronic
1007107084 6:39291081-39291103 AAGCAGGGTCTCCTCTGGATTGG + Intergenic
1007246533 6:40467324-40467346 CAGCTGGGCCTGCCCCAGACAGG - Intronic
1012121122 6:95367788-95367810 AAGCCTGGCCTCCTGCAGGTTGG + Intergenic
1017246916 6:152236919-152236941 CTGCTGGTCCTCATCCAGATGGG + Exonic
1019526027 7:1480902-1480924 ATGCTGGACCTCCACCAGGTGGG + Exonic
1022535643 7:31096611-31096633 CAGCTGGGACCCCTCCAGACCGG + Intronic
1023025143 7:36043028-36043050 AAGATGGGCTTCCTCCAGCCTGG + Intergenic
1024285232 7:47751468-47751490 AAGCAGAGCCTCCTCCAGGGAGG - Intronic
1032657966 7:133952349-133952371 CAGCTGGGCATCCTCCACAGGGG + Intronic
1033259558 7:139831122-139831144 TACCAGGGCCTCCTCCAGACTGG - Intronic
1033794270 7:144829043-144829065 TAGGTGGGCCTCTCCCAGATGGG + Intronic
1034713902 7:153221528-153221550 ATGCTGGAGCCCCTCCAGATGGG + Intergenic
1036778765 8:11631472-11631494 CAGCTGGGCCCCCTCCAGCCTGG + Intergenic
1038778492 8:30551456-30551478 AACGTGGGCCTCCTCCTGACTGG + Intronic
1038778714 8:30552977-30552999 GAGCATGGCCTCCTCCAGCTAGG + Intronic
1038894219 8:31763429-31763451 AAGCTGGGTCCACACCAGATTGG + Intronic
1041108404 8:54463474-54463496 AACTTGAGCCTACTCCAGATGGG - Intergenic
1042643062 8:70956286-70956308 AAGATGAGCTTCCTGCAGATAGG - Intergenic
1042937917 8:74079111-74079133 TAGCTGGGCCTTCAACAGATTGG - Intergenic
1045439248 8:102193478-102193500 ACTCTGTGGCTCCTCCAGATTGG - Intergenic
1045810508 8:106215442-106215464 AAGCTGGGCTTCCTTCCAATCGG - Intergenic
1049667737 8:143854570-143854592 AAGTTTGGCCAACTCCAGATGGG + Intergenic
1057692815 9:97301416-97301438 AAGTTGGGCCTCCTCAAGGAAGG - Intergenic
1058189200 9:101892272-101892294 AAGCTGGCCATCCTGCAGGTTGG - Intergenic
1061411578 9:130424916-130424938 AAACAGGGCCTCCCCCAGGTGGG + Intronic
1061525761 9:131160770-131160792 AAGCTGAGGGTCCTCCAGTTGGG - Intronic
1062430637 9:136525523-136525545 GGGCATGGCCTCCTCCAGATGGG + Intronic
1062490132 9:136800983-136801005 AAGCAGAACCTACTCCAGATGGG + Intronic
1062502835 9:136858624-136858646 GAGCAGGGCCTCCTCTGGATGGG - Intronic
1185785068 X:2883939-2883961 GAGCTCTGCCTCCTGCAGATCGG - Intergenic
1186164036 X:6807691-6807713 CAGCTGGGCTTCCTCCAGGATGG - Intergenic
1189331743 X:40148443-40148465 CTGCTGGGCCTCCTCCAAACCGG + Intronic
1199779717 X:151046952-151046974 CAGCTGTCCCTCCTCAAGATGGG - Intergenic
1201355020 Y:13088229-13088251 AAGATAAGCCTCCTCCAGCTGGG + Intergenic