ID: 997597536

View in Genome Browser
Species Human (GRCh38)
Location 5:135117091-135117113
Sequence CTGGGCACACAGCTGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 532}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997597536_997597555 25 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597555 5:135117139-135117161 GCAGGGGCAGGGGCAGTGGTGGG 0: 1
1: 5
2: 150
3: 347
4: 1829
997597536_997597551 14 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597551 5:135117128-135117150 CTGGGGTGGGGGCAGGGGCAGGG 0: 2
1: 4
2: 128
3: 1698
4: 12923
997597536_997597539 -5 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597539 5:135117109-135117131 CCCAGAGCTGTGTGATGTGCTGG No data
997597536_997597542 -3 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597542 5:135117111-135117133 CAGAGCTGTGTGATGTGCTGGGG No data
997597536_997597552 15 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597552 5:135117129-135117151 TGGGGTGGGGGCAGGGGCAGGGG 0: 1
1: 11
2: 139
3: 1422
4: 13400
997597536_997597547 7 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597547 5:135117121-135117143 TGATGTGCTGGGGTGGGGGCAGG No data
997597536_997597553 21 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597553 5:135117135-135117157 GGGGGCAGGGGCAGGGGCAGTGG 0: 6
1: 129
2: 251
3: 1071
4: 6112
997597536_997597543 0 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597543 5:135117114-135117136 AGCTGTGTGATGTGCTGGGGTGG 0: 1
1: 0
2: 1
3: 39
4: 297
997597536_997597545 2 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597545 5:135117116-135117138 CTGTGTGATGTGCTGGGGTGGGG 0: 1
1: 0
2: 0
3: 57
4: 514
997597536_997597544 1 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597544 5:135117115-135117137 GCTGTGTGATGTGCTGGGGTGGG 0: 1
1: 0
2: 3
3: 43
4: 385
997597536_997597541 -4 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597541 5:135117110-135117132 CCAGAGCTGTGTGATGTGCTGGG No data
997597536_997597549 9 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597549 5:135117123-135117145 ATGTGCTGGGGTGGGGGCAGGGG No data
997597536_997597548 8 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597548 5:135117122-135117144 GATGTGCTGGGGTGGGGGCAGGG 0: 1
1: 1
2: 7
3: 178
4: 2577
997597536_997597554 24 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597554 5:135117138-135117160 GGCAGGGGCAGGGGCAGTGGTGG 0: 2
1: 10
2: 84
3: 412
4: 2710
997597536_997597546 3 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597546 5:135117117-135117139 TGTGTGATGTGCTGGGGTGGGGG 0: 1
1: 0
2: 3
3: 72
4: 649
997597536_997597550 13 Left 997597536 5:135117091-135117113 CCAGGCACCAGCTGTGTGCCCAG 0: 1
1: 0
2: 1
3: 72
4: 532
Right 997597550 5:135117127-135117149 GCTGGGGTGGGGGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997597536 Original CRISPR CTGGGCACACAGCTGGTGCC TGG (reversed) Intronic
900403499 1:2482556-2482578 GTGGGCACACAGCCTGTCCCTGG + Intronic
900410715 1:2511286-2511308 CTGGGGACACAGCGGGGCCCGGG - Intronic
900767129 1:4513122-4513144 CTGGGAACAAAGCTGATGCCTGG + Intergenic
900833769 1:4984603-4984625 CTGGTCACACAGGTGCTGACAGG + Intergenic
901031074 1:6307183-6307205 CTCGGCACACAGGAGGTGCCTGG + Intronic
901053163 1:6435837-6435859 CTGAGCACAGGCCTGGTGCCTGG - Intronic
901053639 1:6438329-6438351 CTGAGCACAGGCCTGGTGCCTGG - Intronic
901416797 1:9121990-9122012 CAGGCCATACAGCTGATGCCTGG + Intronic
901461922 1:9397152-9397174 CTGGGGACTCAGCTCGTGCGAGG - Intergenic
901679775 1:10906287-10906309 CTGGGCACCCACTTGGTGCCAGG - Intergenic
902101550 1:13994541-13994563 CTGGGCACTGTGCTGGAGCCTGG + Intergenic
902127033 1:14223342-14223364 CTGGGATCACAGCCTGTGCCAGG - Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902481076 1:16712212-16712234 CTGAGCACAGGCCTGGTGCCTGG + Intergenic
902519476 1:17007890-17007912 CTGTGCCCACAGCAGCTGCCTGG - Intronic
902614802 1:17618047-17618069 CTGAGCACCCAGCCTGTGCCAGG - Intronic
902683948 1:18063604-18063626 CTGGGCACCCAGCAAGTGCCAGG + Intergenic
902809395 1:18879744-18879766 CTGGGCACACTGCAGGTACCTGG + Intronic
902988740 1:20171439-20171461 CAACCCACACAGCTGGTGCCAGG + Intronic
903381021 1:22896885-22896907 CTGGGCACCACGCTGGTGCTGGG - Intronic
903479016 1:23639630-23639652 CTGAGCAAGGAGCTGGTGCCAGG - Intronic
903500337 1:23796978-23797000 CTGGGGTTAAAGCTGGTGCCTGG - Intronic
903603285 1:24557156-24557178 CTGGGCACCGTGCTGGTGCTGGG - Intronic
903690933 1:25173118-25173140 CTGGGCACTCACCATGTGCCAGG + Intergenic
903799053 1:25953133-25953155 CTGGCCCCACAGCTGGGACCTGG + Intergenic
904295955 1:29519887-29519909 CTGAACACACGGCTGCTGCCGGG - Intergenic
904347678 1:29883962-29883984 CTGGGCACCAAGCTGATGCAGGG - Intergenic
905043093 1:34976514-34976536 CTGGGCACTGAGCTGCCGCCTGG - Intergenic
905451188 1:38057699-38057721 CTGGTCACACAGCTGGTAAGAGG - Intergenic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906100555 1:43257702-43257724 CTGGGCACACAGATGTTCCCAGG - Intronic
906294753 1:44642743-44642765 TTGGGCTCACATGTGGTGCCAGG + Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
908266421 1:62383827-62383849 CTGAGCACTCACCAGGTGCCAGG - Intergenic
908581547 1:65522400-65522422 CTGGCCACACGACTGGTGCGGGG + Intronic
909600491 1:77456527-77456549 CTGGGCAGAGAGCATGTGCCAGG + Intronic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912551024 1:110485389-110485411 GAAGTCACACAGCTGGTGCCTGG + Intergenic
913966348 1:143380533-143380555 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914060721 1:144206140-144206162 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914118429 1:144760229-144760251 CCTGGCATACAGCAGGTGCCTGG + Intergenic
914328581 1:146645197-146645219 CTGGGCACTTACCTGGTGCTGGG + Intergenic
915054395 1:153112676-153112698 CGGGGCACACAGGAGGTGGCTGG + Exonic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
916056807 1:161073708-161073730 CTTGGCACACACCTGGCTCCTGG + Exonic
916205137 1:162308935-162308957 ATGGTCACACAGCTGCTGCATGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918095796 1:181333111-181333133 CTGGGCCCACAGCTGATGAAGGG - Intergenic
918528210 1:185488069-185488091 CTGGCCACGTAGCTGGTGCAAGG + Intergenic
919633012 1:199977264-199977286 CTGGGCACCCACCTCCTGCCAGG - Intergenic
920130694 1:203729692-203729714 CTGGGGACACAGGTGCTTCCTGG + Intronic
921784396 1:219211303-219211325 CTGGGGACTTAGCTGGTTCCTGG - Intronic
922620203 1:226984164-226984186 CTGACCACAGAGCTGGTGTCTGG + Exonic
922754818 1:228089841-228089863 CTGGGCACTGAGCTACTGCCAGG - Intronic
923231558 1:231991011-231991033 CTTGGCACACAGGTGCCGCCTGG - Intronic
923902180 1:238338111-238338133 CAATGAACACAGCTGGTGCCTGG - Intergenic
923917852 1:238529527-238529549 CCTTGCACAGAGCTGGTGCCTGG - Intergenic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
924770693 1:247077249-247077271 CAGGGCACCCAGATGCTGCCTGG + Intronic
1062862640 10:822475-822497 CTGGGCCCACTGATGGTGACTGG - Intronic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1066213007 10:33258137-33258159 CTAGGAACACAGCTGGTACTTGG - Intronic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1067224580 10:44367358-44367380 CTCTGCACACACCTGGTGGCTGG + Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067941314 10:50659435-50659457 CTGGGCGCACCGCTGCAGCCAGG - Intergenic
1068677107 10:59779548-59779570 CTGGTCACACAGCTGCTGACCGG + Intergenic
1069718611 10:70536156-70536178 CTGGGCACACACCAGCTCCCTGG - Intronic
1069886474 10:71627075-71627097 GTGTCCACACAGCTGGTACCTGG + Intronic
1070540573 10:77412522-77412544 CAGGGCACACAGCCTGTGCCTGG - Intronic
1070862553 10:79684397-79684419 CTGGGCGCACCGCTGCAGCCAGG - Intergenic
1071776255 10:88791716-88791738 AAGGGCCCACAGCTGGTGACAGG + Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1072538647 10:96381763-96381785 CTAGGCTCAGAGCTGCTGCCAGG - Intronic
1073300659 10:102469266-102469288 CTGGGCAGATTGCAGGTGCCTGG + Intronic
1074526610 10:114268535-114268557 CTGGGCACTTAGCGTGTGCCAGG - Intronic
1075069278 10:119309879-119309901 CTGGGCACACAGCTGCTGAGAGG - Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075316877 10:121460074-121460096 GGGGGGACACAGCTGGTTCCTGG - Intergenic
1075333540 10:121592703-121592725 CTGGGAACACATCTCGTGCGTGG - Intronic
1075630204 10:123995943-123995965 CTGGGCACACAGTGGGTCGCAGG + Intergenic
1075728857 10:124624588-124624610 CTGGGAGCACACTTGGTGCCTGG - Intronic
1075841897 10:125511908-125511930 CTGTGCAGCCAGCTGGTTCCGGG - Intergenic
1076726695 10:132417188-132417210 CTGGACACACTGCCGGTCCCCGG - Exonic
1077034741 11:489208-489230 CTGGTTACCCAGCTGCTGCCCGG - Intronic
1077097608 11:805551-805573 CTGGGAACGCACCTGGGGCCGGG - Intronic
1077160752 11:1111771-1111793 CTTGGCCCAGAGCAGGTGCCTGG + Intergenic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1077228579 11:1448833-1448855 CTGGCCACACACCTGGCTCCCGG - Intronic
1077481097 11:2815061-2815083 CTCAGCACGCAGCAGGTGCCTGG - Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1079346524 11:19657277-19657299 CTGGGCATCCAGTTTGTGCCAGG + Intronic
1080451128 11:32379839-32379861 CAGGCCCCACTGCTGGTGCCTGG - Intergenic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1083431041 11:62613579-62613601 CTGGGCCCGCTGCTGGTGGCTGG + Exonic
1083463208 11:62828928-62828950 CTGGGAATACAGGCGGTGCCAGG - Intronic
1083576704 11:63797120-63797142 CTGGGTACACAGCAGGTGATGGG - Intergenic
1084150891 11:67287471-67287493 CTGAGCACACACCTGGCTCCGGG - Intergenic
1084276272 11:68052585-68052607 CTGGGAGCAGTGCTGGTGCCTGG - Intergenic
1084488361 11:69464059-69464081 CCCGGCACACAGCAGGCGCCTGG + Intergenic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1086961681 11:92984727-92984749 CTGGGCCCATAGCTGTTACCTGG + Intronic
1087639133 11:100736436-100736458 CTGGGCACACAGAAAATGCCTGG + Intronic
1088186624 11:107177653-107177675 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1088888227 11:114024366-114024388 CAGGGCCCACTCCTGGTGCCTGG + Intergenic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1089309918 11:117551301-117551323 CCTGACACACAGCAGGTGCCTGG - Intronic
1089327361 11:117666516-117666538 CTGAGGACAAAGCTGCTGCCGGG + Intronic
1089685934 11:120146944-120146966 CTGGGGACACAGCTGAGCCCAGG + Intronic
1090008816 11:123027517-123027539 ATGGGCACACACCTGTTGCGGGG + Intergenic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091206333 11:133823690-133823712 CTGGGCACAGGGATGGTCCCGGG + Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091408296 12:222531-222553 CTGTGCACACAGCTGGTGTGAGG + Exonic
1092529303 12:9331515-9331537 CTGAGCACTCACCTTGTGCCAGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1095797739 12:46238734-46238756 CTGAGGACACAGCTAGTGGCTGG + Intronic
1095946178 12:47754892-47754914 CAGGCCACAGTGCTGGTGCCAGG - Intronic
1100739495 12:97575711-97575733 CTGGGCACACTCCTGGATCCTGG + Intergenic
1101011420 12:100454226-100454248 CAGGGCCCATAGCTGGAGCCTGG - Intergenic
1101841992 12:108334366-108334388 CTGGCCACATAGTGGGTGCCTGG - Intronic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103723213 12:122985696-122985718 CTGGGCCCACACCTGGCACCAGG + Exonic
1103763757 12:123268259-123268281 GGGGACAGACAGCTGGTGCCAGG + Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104404810 12:128508532-128508554 CTCTGCACACAGCTGGGGACAGG - Intronic
1104416592 12:128600782-128600804 CCTGGCACAAATCTGGTGCCTGG + Intronic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1104845417 12:131844455-131844477 CGGGGCCCACATCTGGTGCCAGG + Intronic
1104936387 12:132366539-132366561 CTAAGCACACGGCTGCTGCCCGG + Intergenic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1105805562 13:23950009-23950031 CTGGGCAGCCAGGGGGTGCCAGG + Intergenic
1106177316 13:27342454-27342476 CTGTGGACACAGCTGGTCACAGG + Intergenic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1113641729 13:111962537-111962559 CTGGGCTCGCAGCAGGTGCTAGG - Intergenic
1113769207 13:112897889-112897911 CCTGGCACAGAGCGGGTGCCAGG - Intronic
1116692373 14:48125821-48125843 CTGTCCACACAGCTTGTGTCTGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118255119 14:64199110-64199132 CTGGGCTCTTAGCAGGTGCCTGG - Intronic
1118806970 14:69246330-69246352 AAAGGCACACAGCTGGTGGCTGG - Intergenic
1119204471 14:72783864-72783886 CTGGGCCCACGGGTGGTGCCAGG + Intronic
1119518705 14:75269517-75269539 CTGGGCACGTGGCTGGGGCCAGG - Intergenic
1119680294 14:76587252-76587274 CAGGCCACACAGCTAGTGACAGG + Intergenic
1121741147 14:96253142-96253164 TGGAGCACCCAGCTGGTGCCAGG - Intronic
1122207790 14:100156825-100156847 CTGGGGGAACAGCTTGTGCCGGG + Intronic
1122676980 14:103423646-103423668 CTTGGCCCAGAGCTGGAGCCTGG - Intronic
1122693711 14:103542990-103543012 CTGGGGACAAAGCCGCTGCCAGG + Intergenic
1122744057 14:103887707-103887729 GTGGGTGCACAGCAGGTGCCAGG - Intergenic
1123487597 15:20755674-20755696 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123544089 15:21324732-21324754 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123707421 15:22960102-22960124 CTGGGCACAGTGGTGGAGCCCGG - Intronic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1124346053 15:28922310-28922332 CTGCCCACACTGGTGGTGCCTGG - Intronic
1124577383 15:30921858-30921880 CTGGGAACACAGCAGGTCACAGG - Intronic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125719135 15:41836758-41836780 CTGGGAACACATCAGATGCCAGG - Intronic
1127754407 15:62077114-62077136 ATGGTCACACAGCTGGTGAGGGG + Intergenic
1128571862 15:68739454-68739476 CTAGGTACCCAGCTGGTGTCGGG + Intergenic
1128698428 15:69786533-69786555 CTGGACACACTGGGGGTGCCTGG - Intergenic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1128805711 15:70529560-70529582 CTGTGCACATAGGAGGTGCCAGG - Intergenic
1129198260 15:73983698-73983720 CTGGGCACTCAGCTGGGGACCGG + Exonic
1129272957 15:74428997-74429019 CTGGCCATACACCTGGTGGCTGG + Intronic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129462039 15:75704426-75704448 CTGGCCACCCATCTGGAGCCTGG - Intronic
1129722817 15:77887420-77887442 CTGGCCACCCACCTGGAGCCTGG + Intergenic
1129905026 15:79180527-79180549 CTTGCCAGACCGCTGGTGCCAGG - Intergenic
1130386276 15:83415047-83415069 ATCGGCACACAGCTGTAGCCAGG + Intergenic
1131170091 15:90171901-90171923 CTGGGACTACAGGTGGTGCCTGG - Intronic
1131542609 15:93287747-93287769 CTGGGAACATAGCCGGTGCCAGG - Intergenic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1132381403 15:101369106-101369128 CCGAGGACAAAGCTGGTGCCGGG + Intronic
1202952431 15_KI270727v1_random:52005-52027 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1132586127 16:706335-706357 CCGGGCACGCAGCAGGTGCGCGG - Intronic
1132829277 16:1919513-1919535 CTGGCCACAGGGCTGGCGCCAGG + Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134356154 16:13484011-13484033 CTGGGCTCACGACTGGTGTCTGG + Intergenic
1134680316 16:16120469-16120491 CTGGGCATTCAGCCAGTGCCAGG - Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1135464342 16:22672349-22672371 CTGGCCACACTGGTGGTGCTGGG + Intergenic
1136044272 16:27602986-27603008 CACGGCACCCAGCTGATGCCAGG + Intronic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1137367800 16:47875830-47875852 CAGGTGACACAGCTGGTGACTGG + Intergenic
1137670362 16:50274887-50274909 CGAGTCACACAGCTGGTGACAGG + Intronic
1137947076 16:52743821-52743843 TTGGGAACACAGATGATGCCTGG - Intergenic
1138293374 16:55867057-55867079 CATGGCACACAGCTGAGGCCTGG - Intronic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139847323 16:69930136-69930158 CTGGGGGCAGAGCTGGTTCCTGG - Exonic
1139924400 16:70478260-70478282 CTGGGCTCACAGGAGGTGGCTGG + Exonic
1140004982 16:71065746-71065768 CTGGGCACTTACCTGGTGCTGGG - Intronic
1141542624 16:84737819-84737841 CTGGGCACTCAGGGTGTGCCAGG - Intronic
1141604536 16:85145335-85145357 CGGGGCGCACAGCTGGTGAGAGG - Intergenic
1141690645 16:85594351-85594373 CAGGGCTCACAGATGGGGCCTGG - Intergenic
1141815901 16:86409093-86409115 CTGGGCACAGGCCTGGAGCCTGG - Intergenic
1141851625 16:86650079-86650101 CTGGACATGGAGCTGGTGCCGGG + Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142276418 16:89121172-89121194 CCGGGCACACAGCTCCTCCCAGG + Intronic
1142292390 16:89199104-89199126 GTGGGCACCCTGCTGCTGCCCGG - Exonic
1142668316 17:1475014-1475036 CTGGTCAGCCAGCTTGTGCCTGG + Exonic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1143952002 17:10640376-10640398 CTCTGCACACAGCTTGTGTCCGG + Exonic
1144659049 17:17056538-17056560 CAGGGCCCACAGCTGCTGGCTGG - Intronic
1144757946 17:17691622-17691644 CCGGGCACACACCAGGTGCCTGG - Intronic
1144767791 17:17742177-17742199 CAGGGCCCACAGCAGATGCCAGG + Intronic
1144848841 17:18233956-18233978 CCGGGCACACAGTGGGTGCTGGG - Intronic
1146263352 17:31435793-31435815 CCTGGCCCACAGTTGGTGCCTGG - Intronic
1146301964 17:31696447-31696469 CTGGGCACCCAGCTCCTGGCTGG + Intergenic
1146633061 17:34484499-34484521 AAGGGCACACAGCTGGTGAGTGG - Intergenic
1146723122 17:35137227-35137249 ATGGGCACACAGATGTTGCCAGG - Intronic
1147334064 17:39716316-39716338 TCGGGCGCACAGCTGGTGGCAGG - Exonic
1147446284 17:40477163-40477185 CGTGGCAGACAGCAGGTGCCTGG - Exonic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1148210488 17:45805686-45805708 CTGGGAACTCTGCTGGTGGCCGG + Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148695374 17:49555402-49555424 CTGGGCACACAGGTGGAACCAGG - Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1150139754 17:62717718-62717740 CTGGCCACACTGCTAGTCCCAGG + Intronic
1150721226 17:67615897-67615919 TTGGGCACACAGATGGTCTCAGG - Intronic
1151299876 17:73216311-73216333 CTGGGCAGACAGCAGGTGTTTGG + Intronic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1151548625 17:74808490-74808512 CTGGGCACTCTGGTAGTGCCTGG + Intronic
1151603161 17:75118972-75118994 CTGGGAACCCAGCTGGCACCAGG + Intronic
1151625374 17:75272421-75272443 GTGAGGGCACAGCTGGTGCCTGG - Intergenic
1151658989 17:75508779-75508801 ACAGTCACACAGCTGGTGCCTGG - Intronic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1152037253 17:77881025-77881047 CTTGGCACACAGTAGGTGCACGG + Intergenic
1152223882 17:79083777-79083799 CTGGGCGCTCAGGTGGTACCAGG - Exonic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152650532 17:81490443-81490465 CTGGGCACCCTGCTGGTGGCAGG + Intergenic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1155087031 18:22468700-22468722 CTTGCCACACAGCTGCTGCCAGG + Intergenic
1155250740 18:23951186-23951208 CTGGGCACGCATCGGGAGCCAGG - Intronic
1155603594 18:27577227-27577249 CTTAGCACACAGTTGCTGCCCGG - Intergenic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156889905 18:42178736-42178758 AAGGTCACACAGCTGGTGGCAGG + Intergenic
1157401860 18:47395442-47395464 CTGGGAACACAGATGATGGCTGG - Intergenic
1158617556 18:59002031-59002053 GTGGCCACACAGCTGGTGATTGG - Intergenic
1159861350 18:73652944-73652966 CTGGGCACCCACCACGTGCCAGG - Intergenic
1159923340 18:74246515-74246537 CTGGGCACTCAGCACCTGCCAGG - Intergenic
1160114610 18:76065539-76065561 CTGGGCACCCACCCTGTGCCAGG - Intergenic
1160328818 18:77973925-77973947 CTAGGCTCACAGAAGGTGCCTGG - Intergenic
1160331702 18:77998881-77998903 CTGGGCACTGAGCTGGTCCTGGG + Intergenic
1160373268 18:78391485-78391507 CCGAGGACACAGCAGGTGCCGGG - Intergenic
1160696274 19:486118-486140 CTGGGCACCCAGCCCATGCCTGG + Intergenic
1160929714 19:1564692-1564714 CTGGGGAGAGGGCTGGTGCCAGG + Intronic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1161170565 19:2810531-2810553 GGCGGCACACAGCTGGGGCCTGG + Intronic
1161219011 19:3109406-3109428 ATGGGCACACTGATGGTCCCAGG - Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1162152356 19:8655458-8655480 CTGGGCAGACACCAGGTGCGGGG + Intergenic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1163133423 19:15291223-15291245 CTAGCCAAACAGCAGGTGCCTGG + Intronic
1163145824 19:15379050-15379072 CCGGGTACAGAGCTGGAGCCCGG + Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164717929 19:30407075-30407097 CTGGGGTCACAGCAGGTGGCTGG + Intronic
1164750913 19:30654161-30654183 CTTGGCTCACACCTGCTGCCAGG - Intronic
1165751712 19:38264416-38264438 CTGGGCCCGCCCCTGGTGCCGGG - Intronic
1165886693 19:39084091-39084113 CTGGGCTCTCACCTGGTGGCCGG + Intronic
1166124325 19:40704685-40704707 CTGGGCACTTACTTGGTGCCAGG + Intronic
1166229960 19:41420974-41420996 CTGGGCACAGTGCTGAGGCCTGG - Intronic
1166318939 19:42004476-42004498 TCTGGCACACAGTTGGTGCCTGG - Intronic
1166740633 19:45112805-45112827 CGGGGCACAGAGCAGGTGCTGGG + Intronic
1166777271 19:45320706-45320728 CTGGCCACACAGCTGGTTGTAGG - Intronic
1167328797 19:48841278-48841300 CTGGGCACTCATCCGGGGCCGGG + Exonic
1167351688 19:48978957-48978979 CTGACCACACAGCTGATGTCAGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1202700129 1_KI270712v1_random:158028-158050 CCTGGCATACAGCAGGTGCCTGG - Intergenic
1202715115 1_KI270714v1_random:38116-38138 CTGAGCACAGGCCTGGTGCCTGG + Intergenic
924962142 2:45428-45450 CTGGGCACACACCTCGGGTCCGG + Exonic
925783220 2:7403028-7403050 CTGGCCACACAGCTGTTCCCAGG - Intergenic
926158440 2:10471220-10471242 CTCGGCACACAGCAGATGCTTGG + Intergenic
926300367 2:11597724-11597746 CAGGGCACACGGCTACTGCCAGG - Intronic
927278915 2:21286645-21286667 CTGGACACAATGCTGGTTCCTGG + Intergenic
927643425 2:24860168-24860190 CTCAGCACACACCTGCTGCCAGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929158603 2:38810289-38810311 CAGGGAACAAAGCTGGGGCCCGG + Intronic
929227550 2:39526136-39526158 CTCGACAAACAGCTTGTGCCAGG + Intergenic
929571645 2:43026710-43026732 CTGGGGTCATAGCTGGTGCCTGG - Intergenic
929900169 2:45993791-45993813 CTGGGCACAGTGCTGTTGCCTGG + Intronic
931246697 2:60498217-60498239 CTGGGCACAGAAGTGGTGCGTGG + Intronic
931566815 2:63622917-63622939 CTCGGCGCACACCTGCTGCCAGG + Intronic
932432885 2:71686098-71686120 CTGGGCAGTCAGCTGGAACCTGG + Intronic
932435165 2:71699080-71699102 CTGGGCACACAGCGGGGCTCAGG + Intergenic
934171062 2:89541503-89541525 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934281367 2:91615821-91615843 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934980246 2:98833544-98833566 TTGGTCACACAGATGGTGCCAGG - Intronic
935963346 2:108448817-108448839 CGGGACCCACAGCTGGTTCCGGG - Exonic
936529427 2:113265473-113265495 CAGGGCTGACTGCTGGTGCCTGG + Intronic
936577782 2:113669925-113669947 CTCGGCACACAGCAGGCGTCTGG + Intergenic
937227986 2:120380699-120380721 CTCAGCACACAGGTGGAGCCGGG - Intergenic
937304402 2:120862346-120862368 CCTGGCACACAGCAGGAGCCTGG - Intronic
937315318 2:120928309-120928331 CTGGGCAGGCAGCTGGCCCCAGG - Intronic
937320532 2:120958132-120958154 CTGGGCTCAGAGGTGGTGACAGG + Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938307369 2:130265002-130265024 CTGGGGGTACAGCTGCTGCCCGG + Intergenic
938447963 2:131391840-131391862 CTGGGGGTACAGCTGCTGCCCGG - Intergenic
938496071 2:131798802-131798824 CTAGGCAGACACCTGGGGCCTGG - Intronic
938977860 2:136496330-136496352 CTGGGCACCCACCATGTGCCTGG - Intergenic
939079015 2:137638100-137638122 CTGGGCACAGAGCTCTTGCATGG - Intronic
940630394 2:156230561-156230583 CTGGGCTCTGAGCTGGTGCTGGG - Intergenic
941574902 2:167217382-167217404 CTGTGCTCAGAGCTGATGCCTGG + Intronic
941937316 2:170994684-170994706 CTGGGGACAGAGCCAGTGCCTGG - Intronic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
947237860 2:227962649-227962671 GTTGGGTCACAGCTGGTGCCAGG + Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948505674 2:238425901-238425923 CTGGGCACACCCCTGGCTCCTGG + Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1168834620 20:869804-869826 CTGACCCCACTGCTGGTGCCAGG + Intergenic
1168989270 20:2080301-2080323 CTGGGAACACAGGTGCTGCTGGG + Intergenic
1170160147 20:13302500-13302522 CAGGGCCCCAAGCTGGTGCCAGG + Intergenic
1172467404 20:35166447-35166469 CTGGGCACACGGCCAGTCCCTGG + Intergenic
1172501970 20:35434009-35434031 GTGGGCACACAGCAGGTGGGTGG + Exonic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1172930162 20:38580813-38580835 CTGGGGACCCAGCTGGCTCCTGG + Intergenic
1172977743 20:38919364-38919386 ATGGTCACACAGCTGGCTCCTGG - Exonic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1173642775 20:44615426-44615448 TTTGGCACACAGCAGGTGCTTGG + Intronic
1174366981 20:50062397-50062419 CGGGGCACACAGCCGGTGAGAGG + Intergenic
1174460184 20:50676943-50676965 CGGTGCACGCAGCTGGTGCTTGG - Intronic
1174463242 20:50697964-50697986 CTGGGATTACAGGTGGTGCCTGG + Intergenic
1175259200 20:57664146-57664168 GTGGGAACACGGCTGGGGCCAGG - Intronic
1175285207 20:57833257-57833279 CTGGGCACAGAGCTGCTCCAAGG - Intergenic
1175881613 20:62262641-62262663 CAGGGCACACTACTGGTGTCAGG - Intronic
1176065644 20:63193074-63193096 CTGGGCTTACAGCTGGTCTCCGG + Intergenic
1176102376 20:63370367-63370389 GTGGGCCCCCAGCTGGGGCCAGG - Intronic
1176104851 20:63381107-63381129 CTGGGCACACCGCAGAGGCCAGG - Intergenic
1177859983 21:26441001-26441023 CTGGGCACAGTGCTCATGCCTGG - Intergenic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178936937 21:36871066-36871088 CTGGGCACACGGCCGGTCTCAGG - Intronic
1178951708 21:36990655-36990677 CTGGGCACCCCGCTTGTGGCTGG - Intergenic
1179032968 21:37736162-37736184 CTCGGTACACAGGAGGTGCCTGG - Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179576355 21:42310720-42310742 CTGGTCATCCAGCTGGTGGCAGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180161315 21:45999806-45999828 GTGGACAAAGAGCTGGTGCCAGG + Intronic
1180183210 21:46127141-46127163 CTGGGCCCACAGGAGGTCCCCGG + Intronic
1180882863 22:19218839-19218861 CTGGGCAGAGTGCTGGGGCCAGG - Intronic
1180926158 22:19556378-19556400 CCTGGCACTCAGCAGGTGCCAGG - Intergenic
1181025758 22:20126513-20126535 CTGGGGACACAGGTGCTTCCTGG + Intronic
1181616571 22:24058973-24058995 CCTGGCACATAGCTGGTGCTCGG + Intronic
1181667458 22:24407988-24408010 CAGGCCACACAGCTGGTCTCTGG - Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1182062685 22:27409035-27409057 GAGCGCACACAGCTGTTGCCTGG + Intergenic
1182153213 22:28045551-28045573 CTGAGCACCTAGCAGGTGCCAGG - Intronic
1182158599 22:28099408-28099430 TTGTGCCCACAGCTCGTGCCTGG + Intronic
1182301671 22:29340560-29340582 TGAGGCACTCAGCTGGTGCCTGG + Intronic
1182323155 22:29491439-29491461 CTGGGCACAAACCATGTGCCAGG + Intergenic
1182364585 22:29769758-29769780 CTGGGCAAACAGCTGCTGGGTGG - Exonic
1182619949 22:31613496-31613518 CTGGGCCTGCAGCTGCTGCCGGG - Exonic
1183211580 22:36454831-36454853 CTGGGCACTTAGCAGGCGCCCGG + Intergenic
1183598575 22:38826841-38826863 CTGGGCATGCAGCAGGTGCCTGG - Intronic
1183686755 22:39365466-39365488 CTGGGCACACAGCAGGCCCTGGG + Intronic
1183726683 22:39593910-39593932 TTGGGCACACAGCAAGTGCCTGG + Intronic
1184037012 22:41923077-41923099 CTGGGCACACAACAGGTCCTTGG + Intergenic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184285148 22:43466365-43466387 CTGGGCACACAGCAGCTCACTGG - Intronic
1184406586 22:44304080-44304102 CAGGGCCCAGAGCAGGTGCCAGG - Intronic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184959480 22:47918602-47918624 CTGGCCCCACAGATGGTGACTGG + Intergenic
1185002451 22:48254146-48254168 TGGGGCACCCAGCTGGTGTCTGG + Intergenic
1185009453 22:48305095-48305117 CTGCGCCCACTGCTGGGGCCAGG + Intergenic
1185067784 22:48640655-48640677 CATGGCGCACAGATGGTGCCCGG + Intronic
1185332466 22:50257903-50257925 CCGGCCACACACTTGGTGCCAGG + Intronic
1185338336 22:50280697-50280719 GAGGGCACACAGGTGGCGCCGGG - Intronic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
1185422450 22:50742737-50742759 CTCGGCACACAGCAGGCGTCTGG - Intronic
949102827 3:166365-166387 CTGGGCTCACAGACTGTGCCAGG - Intergenic
949321780 3:2819650-2819672 CTGTGCACTCAGCTGGTGTCAGG - Intronic
950435255 3:12975525-12975547 AAGGCCACACAGCTAGTGCCTGG + Intronic
950495409 3:13331076-13331098 ATGTGCACACAGCTGGTGGCAGG - Intronic
950918421 3:16668266-16668288 CTAGACACAAAGCAGGTGCCTGG + Intronic
952842791 3:37662416-37662438 CTGGGCACACTCCAGGAGCCAGG + Intronic
952875894 3:37944002-37944024 CTGAGAACACTGCTGTTGCCTGG + Intronic
953135459 3:40177805-40177827 CTGGGCACACAGTAAGTGTCTGG - Intronic
954659923 3:52221591-52221613 CTGGGCACTCCGCCTGTGCCTGG - Exonic
955348549 3:58178228-58178250 CCTGGCACACAGTAGGTGCCCGG - Intergenic
956366179 3:68505661-68505683 CTGGGGACCCAGCTTGTTCCTGG + Intronic
958026708 3:88058576-88058598 CCGGGCCCACAGCTGGCACCTGG - Intronic
958736129 3:98011184-98011206 TTCGGCACAGAGCTGTTGCCAGG - Intronic
961345973 3:126263641-126263663 CTGGGCACAGAAGTGGTGCCAGG + Intergenic
961464083 3:127070971-127070993 TTGCTCACACATCTGGTGCCAGG + Intergenic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
961555544 3:127694545-127694567 CAGGGCACACAGGTGCTGGCAGG - Intronic
961829172 3:129614642-129614664 CTCGGCACACAGCAAGTGCTTGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962394936 3:135007260-135007282 CTGGGTACACAGCTAATGACAGG + Intronic
962755722 3:138464304-138464326 CAGGGCTCACAGCTGCTTCCTGG - Intronic
962977247 3:140456433-140456455 CTGGGCACAGAATGGGTGCCAGG - Intronic
963834937 3:150048502-150048524 CTGGGCACACAGCTCTTCTCCGG + Intronic
966816776 3:183896189-183896211 CTAGGCACAGAGCTGGATCCTGG - Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968647371 4:1747478-1747500 CTGGGCACGCAGCCGTGGCCTGG + Intergenic
968905215 4:3447712-3447734 CTGGGCAGACATGTGGTGCGGGG + Intronic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969124443 4:4936014-4936036 CTGGGCACATAGGAGGTGCCAGG - Intergenic
969354388 4:6616807-6616829 CAAGGCATACAGCTGGTGCGCGG - Intronic
969601234 4:8177740-8177762 CTGGGCAGACCCCTGGTGTCAGG + Intergenic
969702893 4:8777426-8777448 CTCAGCGCACAGCAGGTGCCTGG - Intergenic
970001061 4:11366647-11366669 CTTGGCCTACAGCTGGGGCCTGG - Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
970510803 4:16779778-16779800 GTGGGCACCCAGCTGATGCCTGG - Intronic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
974493359 4:62595467-62595489 CTGGGAAGACACCTGTTGCCAGG + Intergenic
976821901 4:89216144-89216166 CTGGGAGCTCAGCTGGGGCCAGG - Intergenic
980134937 4:128849706-128849728 CTGGGCACACAGCTAATGTCAGG - Intronic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
981790042 4:148526346-148526368 CAGGGAACAAAGCTGGGGCCTGG + Intergenic
984171723 4:176368064-176368086 CTAGGCACGCAGCTGGTGCTTGG - Intergenic
985384867 4:189434668-189434690 CATGCCACACAGCTGCTGCCAGG + Intergenic
985524265 5:394186-394208 CTGAGCACAAAGCTGCAGCCTGG - Intronic
985719550 5:1482105-1482127 CTGGGCTCACTGCAGGTTCCTGG - Intronic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
985743472 5:1633675-1633697 CTGGGGACACGGCAGGTGACGGG + Intergenic
985982550 5:3483081-3483103 CTGGGCACACGAATGTTGCCAGG - Intergenic
986026810 5:3858763-3858785 CTGACCACAAAGCAGGTGCCAGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986527442 5:8695413-8695435 CAGGACACACCGCTGGTGACTGG - Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
989242555 5:39217638-39217660 CAAGGCCCACAGCTGGTGCGTGG + Intronic
989578277 5:43008792-43008814 CGGGGAGCAGAGCTGGTGCCTGG - Intergenic
990467122 5:56080838-56080860 CTGGGACCACAGCTGATGGCTGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991425817 5:66490624-66490646 CTGGACACACAACAGGAGCCTGG - Intergenic
993872371 5:93267850-93267872 CTGGGCACCCAGCTGCTGGTGGG + Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998018154 5:138749312-138749334 CTCAGCACACAGCAAGTGCCTGG + Intronic
998093060 5:139382143-139382165 CTGGGCAGGCAGCCGGTTCCAGG - Intronic
999002456 5:147939353-147939375 CTTGGCACCCACCTGGGGCCTGG - Intergenic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
999714732 5:154351580-154351602 CTGTGCACACACCTTGTTCCTGG + Intronic
1001330062 5:170755468-170755490 CTGGGCACATAGCAGGTACTTGG + Intergenic
1001580471 5:172794693-172794715 CAGGACATCCAGCTGGTGCCAGG + Intergenic
1002500664 5:179645257-179645279 CCTGGCACACAGATGGTACCTGG + Intergenic
1002660779 5:180790089-180790111 CAGGGTACACAGCTGATACCAGG - Intergenic
1003247921 6:4399968-4399990 CAGGGCACTCACCTGGTGCCTGG - Intergenic
1005009517 6:21322680-21322702 CTTGGCTCACAGCAGGGGCCTGG + Intergenic
1005360013 6:25023103-25023125 CAGGGAACAAAGCTGGGGCCTGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006681372 6:35798915-35798937 CTGGGCACCCACCATGTGCCAGG - Intergenic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007260237 6:40558311-40558333 CTGGGCACAAAGCTGCAGGCAGG - Intronic
1007329377 6:41092900-41092922 CTGTTCACACAGATGGTTCCTGG + Exonic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007401881 6:41607415-41607437 CTGGGCCCACATCTGGTGGTGGG + Intergenic
1007816367 6:44528209-44528231 TAGGGGACACTGCTGGTGCCTGG + Intergenic
1009909214 6:69904847-69904869 CTAGGCACACGGCTTGTGCTGGG + Intronic
1010235409 6:73571260-73571282 CTAGGCCAACTGCTGGTGCCAGG - Intergenic
1010591296 6:77716062-77716084 CTGAGCACTCACCTTGTGCCTGG + Intronic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1012461697 6:99469859-99469881 CTGGGATTACAGGTGGTGCCTGG + Intronic
1012869911 6:104660053-104660075 CTGGGCTCCAGGCTGGTGCCAGG - Intergenic
1013111703 6:107069769-107069791 CTGGGCACACTGCTGCAGCCAGG + Exonic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1014608257 6:123506205-123506227 CTGGGCTCACAGCTAGTTGCTGG + Intronic
1016115335 6:140275945-140275967 TTGGTCAAACAGCTGGTGACTGG - Intergenic
1016845097 6:148561775-148561797 TTGTGCACATAGCAGGTGCCGGG + Intergenic
1017096741 6:150811673-150811695 CAGGGCGCACAGACGGTGCCAGG + Intronic
1017940767 6:159050927-159050949 CTAGGCACGCAGCTCCTGCCAGG + Intergenic
1018606790 6:165606029-165606051 CTGGGCACGCAGCAGGTGCGTGG + Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019290142 7:246248-246270 CTGGGCACCCAGCTGCCGACGGG - Intronic
1019634926 7:2070394-2070416 CCGGGCACACAGGTGCTCCCAGG + Intronic
1019702535 7:2480856-2480878 CGTGGCACACAGTAGGTGCCTGG + Intergenic
1019875630 7:3808164-3808186 CAGAGCACACAGCAGTTGCCAGG + Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020046637 7:5045760-5045782 CGGGGCCCACAGCTGGTCCCAGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022329298 7:29362393-29362415 CTGGGCACAGACCATGTGCCAGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1024641634 7:51333754-51333776 CTGGGCACTCAGCAGCGGCCAGG + Intergenic
1026845893 7:73699083-73699105 CTGGGACCACAGGTTGTGCCTGG - Intronic
1026971767 7:74472890-74472912 CTGGCCCCACAGCTGGTGGGAGG + Intronic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1028160334 7:87476999-87477021 CTGGCCAGACAGCTGGTACATGG - Intronic
1028456331 7:91041882-91041904 CTGGGTGCATATCTGGTGCCGGG + Intronic
1028508788 7:91598958-91598980 CTGGCCACAAAGCTCTTGCCTGG - Intergenic
1028864727 7:95694884-95694906 CCTGGCACACAGCTGGTTCTCGG + Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029660113 7:101954733-101954755 CTGGTCACACAGCTGCTCGCAGG + Intronic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1032080305 7:128855304-128855326 CTGGGCACAAACCTGGAGGCTGG - Exonic
1032222611 7:130006128-130006150 CCTGGCACTCAGCAGGTGCCTGG - Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1035312074 7:157975792-157975814 CAGGGCACACAGTAGGTACCTGG - Intronic
1035768677 8:2129281-2129303 CAGGGCGCACAGCTGGGACCAGG + Intronic
1036183537 8:6605101-6605123 CTGGTCCCACAGCAGGTGCTTGG + Intronic
1038245865 8:25855351-25855373 CTTGGCACACTGCTACTGCCAGG + Intronic
1038685895 8:29718382-29718404 CTGAGCACAGGGGTGGTGCCGGG - Intergenic
1039065054 8:33600337-33600359 CTGGTCACACAGCTCGTTACTGG + Intergenic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1040826481 8:51626530-51626552 CAGGGCACATATCTGCTGCCTGG - Intronic
1040878044 8:52173622-52173644 CTGGGCACACCCCACGTGCCTGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043760711 8:84063935-84063957 CACGGCACACCGCTGCTGCCGGG + Intergenic
1044746585 8:95376833-95376855 CTGGGCACTGTGCTTGTGCCTGG + Intergenic
1047788740 8:128180667-128180689 CTGAGCACATAGCTGGTCCTCGG - Intergenic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048301752 8:133256462-133256484 CTGGGTACATAACTTGTGCCAGG - Intronic
1048986744 8:139738814-139738836 CTGGGCGCAGAGCTGGTCCTGGG + Intronic
1049175642 8:141190835-141190857 CTTGGCACAGAGCTGCAGCCTGG + Intronic
1049206691 8:141366849-141366871 CTGGGCACCCAGCAGATGCTCGG + Intronic
1049255670 8:141612358-141612380 GAGGGGACAGAGCTGGTGCCTGG + Intergenic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1049690042 8:143954310-143954332 AGGGGCACACTGCTGGGGCCGGG - Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1051984462 9:23066089-23066111 CTAGGCACTAAGCTGGTTCCTGG - Intergenic
1052798695 9:32947353-32947375 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1053120412 9:35542639-35542661 CTTGGAACACAGTAGGTGCCTGG - Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053645575 9:40117884-40117906 CTAGGCAGACACCTGGGGCCTGG + Intergenic
1054538998 9:66258088-66258110 CTAGGCAGACACCTGGGGCCTGG - Intergenic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1056532118 9:87497499-87497521 CTGGGATCCCAGCTTGTGCCGGG - Intronic
1056701863 9:88917824-88917846 CTGGCCACACAGATGGTTACTGG - Intergenic
1057080714 9:92172599-92172621 CTGGGCACACTGCTGCAGCCAGG - Intergenic
1057233795 9:93342627-93342649 CTGGGCACCGACCTCGTGCCTGG - Intronic
1057845082 9:98516733-98516755 CTTGGCACAGAGCAGTTGCCTGG + Intronic
1058369111 9:104244231-104244253 CTGGGCATATAGATGTTGCCTGG + Intergenic
1058765268 9:108176319-108176341 CTGAGCATATAACTGGTGCCAGG - Intergenic
1059282043 9:113143269-113143291 TAGGGCACACAGCTGGTGAAGGG - Intergenic
1059444778 9:114331406-114331428 CTGGGCACGCAGCAGGGGCTGGG + Intronic
1059458520 9:114414874-114414896 CTGGGCACTCAGCAGCTTCCTGG + Intronic
1059506708 9:114805889-114805911 CTGGGCTCTCACCTGCTGCCTGG - Exonic
1060007695 9:120015101-120015123 CTGGGCACTCAGCATGGGCCAGG - Intergenic
1060214897 9:121732893-121732915 CCTGGCACATAGCAGGTGCCAGG + Intronic
1060519130 9:124283943-124283965 CTGGGCACCAAGCGTGTGCCAGG - Intronic
1060967082 9:127717410-127717432 CTGGACCCACAGCTGGTGAGAGG + Exonic
1061015319 9:127977986-127978008 CTGTGCTCACAGCTAGGGCCTGG - Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061426402 9:130501144-130501166 CAGGGAACAAAGCTGGGGCCTGG - Exonic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1061864274 9:133484564-133484586 CTGGGCACACAAAGGGTGTCTGG + Intergenic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1061949011 9:133925713-133925735 CTGACCCCACAGCTGATGCCTGG + Intronic
1062114054 9:134798084-134798106 CAGGTGACACAGCCGGTGCCAGG - Intronic
1062243537 9:135552167-135552189 CTGGGCACATATTTGGGGCCAGG - Intergenic
1062633430 9:137477832-137477854 GTGGGCACACCGCATGTGCCAGG + Intronic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1186477114 X:9866060-9866082 CTGGGACCACAGCAGGGGCCAGG + Intronic
1186878249 X:13838636-13838658 CTCAGCCCCCAGCTGGTGCCTGG - Intronic
1190059618 X:47202452-47202474 CTGAGCACAGAACTGGTGCAGGG - Exonic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1193151930 X:78134516-78134538 CTGGGTAGACTGCTGGTTCCAGG - Intronic
1193912960 X:87327941-87327963 TTGGGCACACTGGAGGTGCCAGG - Intergenic
1199586916 X:149424228-149424250 CTGGGCTCCCAGCTGCTGCTGGG - Intergenic
1200775505 Y:7166928-7166950 CCTGGCACCCAGCTGCTGCCTGG - Intergenic