ID: 997599931

View in Genome Browser
Species Human (GRCh38)
Location 5:135132236-135132258
Sequence CTGGAGCCATGGGGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997599916_997599931 14 Left 997599916 5:135132199-135132221 CCAAAGGGTGAATATAGGCATCA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG 0: 1
1: 0
2: 3
3: 46
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997599931 Original CRISPR CTGGAGCCATGGGGGGAGCT GGG Intronic
900151948 1:1182671-1182693 CTGGGGCCAGGGCTGGAGCTTGG + Intronic
900171343 1:1270625-1270647 CTGGACCCACGGGGGGAGTTGGG - Intronic
900190381 1:1350365-1350387 CTGGAGCGACGGGGGGAGTGAGG + Intergenic
900190701 1:1351165-1351187 CTGGAGCGACGGGGGGAGTGAGG + Intergenic
900389332 1:2427252-2427274 CTGGGGCCAGGAGGGCAGCTGGG + Intronic
900573977 1:3373966-3373988 TTGGAGCTCTGGGTGGAGCTTGG + Intronic
900921137 1:5671354-5671376 CAGGGACCATGGAGGGAGCTAGG - Intergenic
901057256 1:6454363-6454385 CCGGCGCCACGGCGGGAGCTAGG + Intronic
901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG + Intergenic
901943072 1:12678664-12678686 CAGCTGCCATGTGGGGAGCTGGG - Intergenic
902383467 1:16063538-16063560 CTGGAGCCACGGTGGGAGTGCGG + Exonic
902477109 1:16694128-16694150 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
903565520 1:24262461-24262483 CTGGAGCCTTGGAGGGAGCATGG - Intergenic
903759756 1:25689680-25689702 CTGGACTCATGGGGGCTGCTGGG + Intronic
903848170 1:26290715-26290737 GTGGAGCCATGGAGGGAGGCAGG + Intronic
904000046 1:27333761-27333783 CTGGTGCCATGGGGGATCCTGGG - Intronic
904053499 1:27655418-27655440 CAGGAGCCATGGGGGGGGCGAGG + Intergenic
904253287 1:29239237-29239259 CCGGAGCCATTCAGGGAGCTGGG - Intronic
904384808 1:30134383-30134405 CTTGAGCCCTGGGGAGAACTGGG + Intergenic
904744693 1:32703277-32703299 CTGGAGCCTGGGGGCGGGCTGGG + Intronic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905349781 1:37337514-37337536 GTGGAGCCATGGGGAGAGAAAGG - Intergenic
906523291 1:46479625-46479647 CTGGGGTCCTGGGGGGGGCTAGG + Intergenic
907029233 1:51154063-51154085 CTGGGACCATGGTTGGAGCTGGG - Intergenic
907298759 1:53472037-53472059 CTCAAGCCATGGGGGGAGGGGGG + Intergenic
907778083 1:57538406-57538428 ATGGAGCCAGGGAGGGAGGTAGG - Intronic
908165311 1:61451622-61451644 CTGGAGCCTTGGTGGGAGTGTGG + Intronic
908339235 1:63159425-63159447 CTGGAGCCTTTGGAGGGGCTGGG + Intergenic
910058063 1:83055512-83055534 CTGGAGCCAGGGAGGAAACTTGG + Intergenic
910288752 1:85580608-85580630 ATGGAGCCAGGGGAGGCGCTTGG + Intergenic
910960359 1:92755654-92755676 CTTTAACAATGGGGGGAGCTTGG + Intronic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912409075 1:109467197-109467219 ATGGAGCCAGGGTGGGGGCTGGG + Intronic
913023445 1:114810200-114810222 CTGGAGATATGGACGGAGCTGGG + Intergenic
914884502 1:151574154-151574176 CTGGAGCCATGACGGGAGAAAGG - Intronic
915111430 1:153566621-153566643 CTGGAGCAGGGAGGGGAGCTGGG - Intronic
915328077 1:155091648-155091670 CCGGAGCTGTGAGGGGAGCTTGG + Intergenic
915401648 1:155626243-155626265 GGGGAGCCATGGGGAGACCTGGG + Intergenic
915941307 1:160120246-160120268 GTGGAGACATGGGGTGTGCTGGG - Intronic
916171087 1:162002238-162002260 CTGGAGTCCTGGGGAGAGCAGGG - Intronic
919717122 1:200790328-200790350 CTGGAACCATGGGGGCAGCGGGG + Intronic
920010069 1:202861027-202861049 CTGGAGCCTGGAGGGGATCTAGG - Intergenic
920192387 1:204201877-204201899 CTGGAGCCAGGCGGTGGGCTGGG + Intronic
920214068 1:204349649-204349671 CTGGAGCCAAGGCTCGAGCTGGG - Intronic
921385453 1:214564363-214564385 CTTGAGCCATGGGGGTAGGAGGG - Intergenic
921761783 1:218923478-218923500 CTGGAGTCAGGGAGCGAGCTGGG - Intergenic
923663629 1:235979790-235979812 CTGTAGCCATGGGGGCTGCGTGG - Intronic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064638966 10:17396399-17396421 GTGTAGCCATGGAGGGAACTGGG - Intronic
1065208786 10:23382393-23382415 CTGGGGCCCAGGGGGGAGCGGGG + Intergenic
1067067774 10:43113355-43113377 CTGAAGCCATGGGTGAAGCCAGG - Intronic
1067079568 10:43205505-43205527 CTGGAGCCCAGGGCTGAGCTGGG - Intronic
1067429314 10:46232675-46232697 CTGGAGCCCTGGGGGTGGATGGG - Intergenic
1069796785 10:71058519-71058541 CAGGAGCATTAGGGGGAGCTGGG + Intergenic
1069813832 10:71180962-71180984 ATGAAGGCATGGGCGGAGCTGGG + Intergenic
1069962553 10:72087427-72087449 CTGGAGCGAGGGGAGCAGCTCGG - Intronic
1070449252 10:76541448-76541470 CTGGAGCGGTGGGGCGATCTGGG - Intronic
1070547283 10:77462792-77462814 TTGGGTCCATGGGGAGAGCTTGG + Intronic
1070909394 10:80104322-80104344 CTCCCGCCATGGAGGGAGCTAGG + Intergenic
1074214736 10:111373226-111373248 ATGCAGCTATGGGAGGAGCTGGG - Intergenic
1074266569 10:111910295-111910317 CTGGAGTGATGGTGGGTGCTGGG - Intergenic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1075592342 10:123702090-123702112 CTGGAGCAATGGCGTGATCTTGG + Intergenic
1075782394 10:125026032-125026054 CTGGGGACCTGGGGGGAGCAGGG - Intronic
1076564267 10:131387339-131387361 CTGGAGCCCTGGGGACAGCTGGG - Intergenic
1077037399 11:502079-502101 CTGGAGCAGAGGGAGGAGCTCGG + Exonic
1077332697 11:1990361-1990383 GGGGAGCCATGGTGGCAGCTGGG - Intergenic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1077483343 11:2826769-2826791 TTGGAGCCATGCTGGGTGCTGGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077659543 11:4055289-4055311 CTGGAGCCAGGAAGGGAGCTGGG - Intronic
1078097917 11:8311794-8311816 CTGGAGCCCTTGGGGGTGTTGGG - Intergenic
1079685308 11:23352033-23352055 GTGGAGCCATGGGGGCAGGTGGG + Intergenic
1080588237 11:33700179-33700201 ACGGAGCCAAGGAGGGAGCTAGG + Intronic
1081773603 11:45664171-45664193 CTGGAGGGGTGGGAGGAGCTGGG - Intronic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1082829416 11:57604428-57604450 CTGGAGTCATGGTGGGAGTGGGG + Intronic
1082856783 11:57815441-57815463 CTGGATCGATCGGGGGATCTAGG + Exonic
1083268425 11:61558005-61558027 CAGGTTCCATGGGGAGAGCTGGG - Intronic
1084191675 11:67502262-67502284 CTGGAGCTATGGGGGGACCCTGG - Intronic
1084193142 11:67508033-67508055 CTGGAGCCAGGGGTGCTGCTGGG + Exonic
1084214109 11:67638485-67638507 CTGGAGCAGAGGGGGGTGCTGGG + Intronic
1084562952 11:69914404-69914426 CTGCAGCCAGGGAGGGGGCTGGG + Intergenic
1084642871 11:70436219-70436241 CTGGAGCTGTGGGGGGACCTTGG - Intronic
1084884713 11:72196092-72196114 CTGCAGCCATGAGTGGGGCTGGG + Exonic
1085048060 11:73364625-73364647 TTGGTGCCATGGGATGAGCTAGG + Intronic
1085521596 11:77142411-77142433 GTAGATCCATGGGGAGAGCTGGG + Intronic
1085531290 11:77193734-77193756 CTGGAGCCCTGGGGAGCTCTAGG + Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1088764213 11:112961190-112961212 CTGGAGCTTTTGGGGGAGCCGGG - Intergenic
1089359652 11:117877262-117877284 CTAGAGCCAGGTGGGGAGCTGGG + Intronic
1089698663 11:120231042-120231064 CTGGAGCAATGGCTGGGGCTTGG - Intergenic
1089890299 11:121874028-121874050 CTGCAGCCAGAGGGGCAGCTGGG + Intergenic
1090482406 11:127080088-127080110 CAGGAGCCATGAGGGGCCCTAGG - Intergenic
1090854286 11:130598432-130598454 CTGGAGCCATCGGGGCTCCTGGG - Intergenic
1202815680 11_KI270721v1_random:45537-45559 GGGGAGCCATGGTGGCAGCTGGG - Intergenic
1091540844 12:1460451-1460473 GTGCAGCGATGGGTGGAGCTTGG - Intronic
1091628253 12:2139166-2139188 CTGGAGCCAGGGCAGGAGCACGG - Intronic
1091697191 12:2635719-2635741 CTGGAGCTATAGGGTGAGCAGGG - Intronic
1091964729 12:4729432-4729454 CAGGAGCCAGGGTGGGGGCTGGG - Intronic
1092262063 12:6958202-6958224 CTGGAGCCATGAGGGGACCCAGG - Intronic
1093054910 12:14546476-14546498 CTGGAACTCTGGGTGGAGCTAGG - Intronic
1093484754 12:19640884-19640906 ATGGAGGCATGGAGGGAGCGCGG - Intronic
1094443517 12:30505433-30505455 CTGAAGCGATGTGGGGAGCCTGG - Intergenic
1096220163 12:49824113-49824135 CTGCAGCCTAGGAGGGAGCTTGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1100690033 12:97029952-97029974 CTGGAGCCATGGGAAGAGCTTGG + Intergenic
1101251466 12:102939849-102939871 CTGCAGCCCTGGGGCAAGCTTGG - Intronic
1101949379 12:109162672-109162694 CTGGAGCCCCGGGGGGAACGGGG - Intronic
1102756827 12:115348353-115348375 CTGGAGCCTTGGGCTGAGGTCGG + Intergenic
1103725007 12:122993230-122993252 CTGGAGCTTCGGGGGGATCTGGG - Intronic
1104180273 12:126373060-126373082 CTGGAGTCATGGGTAGTGCTGGG + Intergenic
1104595841 12:130119475-130119497 CTGGGGCCCTGGGGAGAGCTGGG + Intergenic
1105378376 13:19864284-19864306 CTGCAGCCATGGCGGGAGGTGGG - Intergenic
1105388838 13:19958064-19958086 CTGCAGCCATGGCGGGAGGTGGG + Intergenic
1106270286 13:28146386-28146408 CTGGATCTATGGGGGGAGGAGGG - Intronic
1106589179 13:31084559-31084581 CTGGAGCCCTGGGATGTGCTGGG + Intergenic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1109653071 13:65353840-65353862 CTGGAGCCATGGGGAGTGGTTGG - Intergenic
1110626869 13:77662503-77662525 CAGGAGCCGTGGGGGCAGCCCGG + Intergenic
1111240265 13:85464689-85464711 CTGGAGACATTGGGATAGCTGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1113382999 13:109820795-109820817 CTGGAGCCTTCGAGGGAGCATGG - Intergenic
1113507212 13:110825619-110825641 CTGTGGCCATGGGTGGAGTTGGG - Intergenic
1114455102 14:22848979-22849001 CTGGAGCCAGTGGAGGAGCCTGG + Intronic
1117043790 14:51791955-51791977 CAGAAGGCATGGGGGAAGCTAGG + Intergenic
1119477659 14:74940398-74940420 CTGGGGCTTTGAGGGGAGCTGGG - Intergenic
1119787507 14:77324495-77324517 CAGGAGCCAATGGGGAAGCTGGG - Intronic
1120916346 14:89713826-89713848 GTGGGGACATGGGTGGAGCTGGG - Intergenic
1121095601 14:91216094-91216116 CGGGAGGAATGGGGGGAGCAGGG + Intronic
1121323441 14:93006249-93006271 CTGGAGCCCTGGGAAGGGCTGGG + Intronic
1121387078 14:93537702-93537724 CCTCAGCCATGGGGGGAGCGAGG - Intronic
1122277731 14:100603825-100603847 GTGGAGCCATGGGGGTGGTTTGG + Intergenic
1122404989 14:101495302-101495324 ATGGAGCCATGTGGGGAACAGGG + Intergenic
1123821600 15:24036091-24036113 CTGGAGCTGTGGGAGCAGCTGGG + Intergenic
1124438438 15:29670173-29670195 CAGGATCCATGGTGGGGGCTGGG + Intergenic
1124974509 15:34520447-34520469 CTAGAGCCATGTGGGGAGCTGGG + Intergenic
1126755796 15:51923670-51923692 CTGGAGCTATGGGGAGCTCTGGG - Intronic
1127931171 15:63598489-63598511 CTGGGACCATGGAGGGAGCCTGG - Intronic
1128233527 15:66051664-66051686 CTGGAGCCTTGGGGCATGCTCGG + Intronic
1128457871 15:67843026-67843048 CTGGAGCCATGGAGGGCCCCAGG + Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129198141 15:73983169-73983191 CTGGGGGCATGGGGTGGGCTAGG - Exonic
1129280582 15:74481609-74481631 CTGGAGCCAAGGAGGGTGCAGGG + Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1131519195 15:93100478-93100500 CAGCAGCTGTGGGGGGAGCTGGG + Intergenic
1132237362 15:100232283-100232305 ATGGAGCCAGGGTGGGAGGTGGG + Intronic
1132804155 16:1768046-1768068 CTGGGGACATGGGAGGAGCATGG - Intronic
1132843863 16:1991024-1991046 GTGGAGCCAAGGGGGAAGCCGGG - Intronic
1133522675 16:6574300-6574322 CTGTTGCCATGGGGAGACCTAGG - Intronic
1134192948 16:12136543-12136565 CTGGTGTCATTGGGGGACCTGGG - Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1135048503 16:19173407-19173429 CTGAGGCCATTGGGGGAGGTGGG - Intronic
1135639094 16:24104788-24104810 CTGGATCCATGAGGGGAGAGTGG + Intronic
1135714761 16:24753222-24753244 CTGGAACCATGGGGTGAGACAGG - Intronic
1136140081 16:28282726-28282748 TTGGAGCCATGTGAGGGGCTTGG - Intergenic
1136270173 16:29143896-29143918 CGGAAGCCCTGGTGGGAGCTCGG + Intergenic
1136294175 16:29292209-29292231 CTGGAGCTATGGGGGGACTTGGG + Intergenic
1136407075 16:30054266-30054288 CTGGAGCAGTGGGGCAAGCTTGG - Intronic
1136554500 16:30999882-30999904 CTGGAGCAAGGGGGAAAGCTGGG + Intronic
1136604134 16:31321254-31321276 CTGGAGCCTGGGAGAGAGCTTGG - Exonic
1136618494 16:31412851-31412873 CTGCAGCCTGGGGGAGAGCTGGG - Exonic
1137584325 16:49655156-49655178 CGGGAGCCATGGCTGAAGCTTGG + Intronic
1137644869 16:50065354-50065376 CAGGAGCTATGGGAGGTGCTGGG + Intergenic
1137685448 16:50383580-50383602 CAGTAGCCTTGAGGGGAGCTGGG + Intergenic
1138572341 16:57884064-57884086 CTTGAGCCGTGGGGGAAGGTGGG + Exonic
1139356095 16:66367779-66367801 CTTGAGACCTGGGGAGAGCTGGG - Intronic
1139518130 16:67463932-67463954 CTGAAGCCACTGGGGGAGGTGGG + Intronic
1139584777 16:67894972-67894994 CTGGAGCAATGGCGCGATCTTGG + Intronic
1139611119 16:68059474-68059496 ATGGAGCCAGGGGGAGTGCTGGG + Intronic
1140871446 16:79110334-79110356 CTGGAATGATGGGGGGAGGTTGG - Intronic
1140896914 16:79332967-79332989 CCGGAGACAGGGGGTGAGCTGGG - Intergenic
1141315678 16:82960462-82960484 CTGGAGCCAAGGGGAGATGTGGG + Intronic
1142073765 16:88105730-88105752 CAGAAGCCCTGGTGGGAGCTCGG + Intronic
1142100080 16:88266255-88266277 CTGGAGCTATGGGGGGACTTGGG + Intergenic
1143015174 17:3887757-3887779 CTGGAGCTTCGGGGAGAGCTTGG + Intronic
1143473456 17:7190476-7190498 CTGGGGTCTGGGGGGGAGCTGGG - Exonic
1143516421 17:7421389-7421411 CTGGGCCCAGGGTGGGAGCTGGG - Exonic
1143540204 17:7563864-7563886 CTGTTGCCATGGTGAGAGCTGGG + Intronic
1144623840 17:16834454-16834476 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1144882591 17:18438262-18438284 CTGCAGGCATGGTGGGAGCCTGG + Intergenic
1145149643 17:20506124-20506146 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1145255705 17:21321167-21321189 CTGGAGCCCTGATTGGAGCTAGG + Intergenic
1145269843 17:21398999-21399021 GTGGAGCCCTGGCAGGAGCTGGG + Intronic
1145320909 17:21766781-21766803 CTGGAGCCCTGATTGGAGCTAGG - Intergenic
1145321050 17:21767615-21767637 CTGGAAGAATGGGGGGAGCACGG + Intergenic
1146052149 17:29562740-29562762 CTGGAGCCATGAGGTCATCTTGG - Exonic
1146466946 17:33093980-33094002 CTGAAGCTATCTGGGGAGCTAGG - Intronic
1147164627 17:38586677-38586699 ATGGAGCCCTGGAGGGAGCTGGG + Intronic
1147578130 17:41614158-41614180 CTGCAGGCATGGTGGGAGCCTGG - Intronic
1147585401 17:41651538-41651560 CTGGAGCCAGCGGGCCAGCTGGG - Intergenic
1147599016 17:41734392-41734414 CTGGAGCCAAGGCAGGAGCCCGG - Exonic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1149447694 17:56726271-56726293 CTGGACCCATGAGTGGAGCTGGG - Intergenic
1149894683 17:60420614-60420636 CTGGAGCAATGGCGTGATCTCGG - Intronic
1150790546 17:68197989-68198011 CTGGAGCCGGGGCGGGAGCGGGG + Intergenic
1151801525 17:76382461-76382483 CCAGAGCCAGGAGGGGAGCTGGG + Intronic
1152333213 17:79685335-79685357 CTGGAACCAGTGGGAGAGCTGGG - Intergenic
1152536044 17:80950879-80950901 GTGGTGCCATGGAAGGAGCTGGG + Intronic
1152804624 17:82349364-82349386 CTGGAGCCACTGGGGTAGCCGGG + Intergenic
1152825441 17:82461956-82461978 TTGGAGCCCTGGAGGCAGCTGGG + Intronic
1152906784 17:82974735-82974757 CTGGACCCTGGGGGTGAGCTGGG + Intronic
1152997963 18:425687-425709 CTGGAGCCATGAGGGCATGTGGG + Intronic
1155438817 18:25840554-25840576 CTGGACACATGAGGGTAGCTGGG - Intergenic
1155862918 18:30926625-30926647 CTGGAGCCATCCTGGGTGCTAGG - Intergenic
1156479540 18:37427380-37427402 ATGCAGCCCTGGGGAGAGCTGGG - Intronic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1156497566 18:37536178-37536200 TTGGAGCAATGAGGGGAGGTGGG + Intronic
1160366866 18:78333993-78334015 CTGGAGCCTTGCAGGGCGCTAGG - Intergenic
1160419091 18:78731961-78731983 CTGGAGCCCTGGGGCCAGCAGGG - Intergenic
1160806291 19:993624-993646 CTCCAGCCATGGGGAGAGCCTGG - Intronic
1161482973 19:4519881-4519903 TGGGAGCCATGGAGGGTGCTGGG - Intergenic
1161802965 19:6425966-6425988 CTGGACCCAGTAGGGGAGCTGGG - Intergenic
1162342829 19:10102267-10102289 CAGGAGCCATGGAGGGTTCTGGG + Intronic
1162760633 19:12886304-12886326 CTGGAGCTGGGGGGGGAGCGGGG - Intronic
1162780916 19:13006726-13006748 CTGGGGCCCTGGTGGGAGTTGGG - Intronic
1163583719 19:18153228-18153250 GTGGAGCCACGGGGCGGGCTTGG + Exonic
1164480866 19:28610041-28610063 CTTGAACCCTTGGGGGAGCTGGG - Intergenic
1164672518 19:30080797-30080819 CTGGGGTCCTGGGGGAAGCTGGG + Intergenic
1164817471 19:31216258-31216280 CTTGAGACATGGTGGGGGCTGGG - Intergenic
1164920178 19:32083449-32083471 CTGGAGCCAAGGGGGAGGCTGGG - Intergenic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165834467 19:38745680-38745702 CTGGAGCCATTGGAGGAAATGGG + Intronic
1166054417 19:40279913-40279935 AGGGAGCCATGGGAGGATCTGGG - Intronic
1166790340 19:45395503-45395525 CTGGGGCTGTGGGGGCAGCTGGG + Exonic
1167111732 19:47466394-47466416 GGGGAGCCATGGGGGGTGGTGGG + Exonic
1167323884 19:48812511-48812533 CTGGACCCAGGGGGGGGGCAGGG - Intergenic
1167455711 19:49595958-49595980 CTCGGGCCATGGGGGTGGCTGGG + Exonic
1167508000 19:49881276-49881298 CAGGAGCCCTGGGGGCAGCTGGG - Exonic
1167508166 19:49882036-49882058 CGGGAGTCCTGCGGGGAGCTGGG - Exonic
1167538967 19:50073429-50073451 CTGGAGACCTGGGGGGATGTGGG + Intergenic
1168246344 19:55114701-55114723 CTGGAGCATTGGGGTGGGCTGGG - Intronic
1168322125 19:55517041-55517063 CTGGAGCCATCGGAGGACGTAGG + Intronic
1202711125 1_KI270714v1_random:19954-19976 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
925134413 2:1516339-1516361 CTGGAGCCCTGGGGGGACGGGGG - Intronic
925727303 2:6885526-6885548 CTGGAACCATGGTGGAATCTTGG - Intronic
926219462 2:10925349-10925371 CTGGAGCCAGGGTGGGATTTGGG + Intergenic
926238443 2:11067537-11067559 CTGGAACCATTTGTGGAGCTTGG - Intergenic
926316819 2:11715988-11716010 CTGGAGGCAGGGGGGCAGCTTGG + Intronic
927010968 2:18903888-18903910 GTGGTGCCATGGGAGGACCTGGG + Intergenic
927081285 2:19633351-19633373 CTGCGTCCATGGGGGGAGCTTGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927969767 2:27298252-27298274 TTGGAGCCATGGGGAGACATTGG - Intronic
928205271 2:29279376-29279398 CTGGAGCCATGGGGGAGGGTTGG - Intronic
928613117 2:33010096-33010118 CAGCAGCCATGGGGGGACATGGG + Intronic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
931665180 2:64605366-64605388 CCGGAGCCAGGGTGGAAGCTGGG + Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
932954149 2:76331872-76331894 CTGTGACCATGGGGGAAGCTGGG + Intergenic
933354438 2:81195677-81195699 CTCGAGCTCTGTGGGGAGCTGGG + Intergenic
934160155 2:89242024-89242046 CTGAAGCCATGAGGGCAGCAGGG + Intergenic
934207120 2:89940410-89940432 CTGAAGCCATGAGGGCAGCAGGG - Intergenic
934675753 2:96248637-96248659 GTGAAGCCATGGGGGCATCTGGG + Exonic
934756586 2:96828519-96828541 CAGGAGCCATGCTGGCAGCTGGG - Intronic
938218984 2:129549444-129549466 CTGGAGGCAGGGGAGGAGTTAGG - Intergenic
938266571 2:129932578-129932600 CTGGAGCCTGGGGCTGAGCTGGG + Intergenic
941108718 2:161393410-161393432 CTGGAGCCATGGGAGAAAATGGG + Intronic
942971885 2:181966919-181966941 GTGAAGCCATGGGGGGTGCTTGG + Intronic
943106127 2:183546760-183546782 CAGGAGCCCAGGGGGGAGGTGGG + Intergenic
945039237 2:205730345-205730367 TTGATGCCATGGGGGGAGGTGGG + Intronic
947094407 2:226549871-226549893 CTGGAACCATGGGGAGAATTTGG + Intergenic
948393982 2:237631278-237631300 CTGGAGCGAGGGGAAGAGCTAGG + Intronic
948802250 2:240438251-240438273 CTGCAGCCATAGGGGGTGCAGGG - Intronic
948836333 2:240627874-240627896 GGGGAGCGATGGGGGAAGCTGGG + Intronic
948858295 2:240740827-240740849 CTGGTGCCCTGGGGGCAGCTGGG - Intronic
1169074479 20:2752503-2752525 GTGGAGCCATTGAGGAAGCTGGG - Exonic
1169209092 20:3755729-3755751 CTGGAGTGATGGAGGGAGTTGGG - Intronic
1169303645 20:4469486-4469508 CTGGAGCCTGGGGAGGAGCAGGG - Intergenic
1169894189 20:10485008-10485030 CTGAAGCCAAGGGGAGACCTGGG + Intronic
1172625138 20:36342470-36342492 ATGGGGCCTTGGTGGGAGCTGGG - Intronic
1172786701 20:37473352-37473374 CTGGAGTCATGGGGTGAGGCAGG + Intergenic
1173342990 20:42170119-42170141 TTGCATCCATGAGGGGAGCTGGG + Intronic
1174498244 20:50964996-50965018 CAGGAGCCACGAGGTGAGCTGGG + Intergenic
1175443847 20:59007381-59007403 CCGGAGCCAGGGAGGGAGCGGGG - Intergenic
1175681792 20:60994715-60994737 CTGGTTCTATGGGGGGAACTGGG - Intergenic
1175791448 20:61742794-61742816 CTGGAGCCGTGAAGGGAGGTTGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176021893 20:62966410-62966432 GTGGAGCCACGGGAGGGGCTGGG - Intronic
1176373720 21:6077187-6077209 CTGGAGCAATGGGGCCAGCGTGG - Intergenic
1178432109 21:32525965-32525987 CAGGACCCCTGGGGGGAGTTTGG - Intergenic
1179401759 21:41090859-41090881 TTGGAGGCATGGGGGGAGCCAGG + Intergenic
1179626506 21:42652568-42652590 CTGGAGCTCTGGTGGCAGCTGGG - Intergenic
1179644948 21:42770164-42770186 CAGAGGCCCTGGGGGGAGCTGGG - Intronic
1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG + Intergenic
1179791811 21:43760070-43760092 CTGTAGCCCTGGGCAGAGCTGGG + Exonic
1179880996 21:44293299-44293321 CTGGGGCTGTGGGGGGAGCGTGG + Intronic
1180002689 21:45002291-45002313 TGGGAGCTGTGGGGGGAGCTGGG + Intergenic
1180032747 21:45223587-45223609 CTGGGGCCATGGGGAGAGATTGG + Exonic
1180040863 21:45278965-45278987 CAAGAGCCCTGGGGGGAGTTTGG - Intronic
1180042833 21:45288603-45288625 CTGGAGACCTGGGGGGATCCGGG + Intergenic
1180146545 21:45923199-45923221 CTGGAACCCTGTGGGGAGGTGGG + Intronic
1180336177 22:11578605-11578627 CAGGGACCATGGAGGGAGCTGGG - Intergenic
1180855363 22:19041741-19041763 ATGGAGACATGGGGTGACCTGGG + Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181466201 22:23112028-23112050 CTGGAGCCTTGGGGGTAACCAGG + Intronic
1181509403 22:23382334-23382356 CTGGAGTCCTGGGCTGAGCTGGG - Intergenic
1181877270 22:25949384-25949406 CGGGAGCCATGAGGGCAGCATGG + Intronic
1183022045 22:35035057-35035079 CAAGAGCCATGGAGGGAACTGGG + Intergenic
1183191646 22:36325431-36325453 TTGAAGCCATCAGGGGAGCTTGG - Intronic
1183541970 22:38434651-38434673 CTGGAGGGATGGGGAGAGCCTGG - Intronic
1184142202 22:42584510-42584532 CTGGAGCCAGTTGGGGAGCACGG - Exonic
1184252690 22:43269707-43269729 CTGGAGCCTTGGGGGTGGCAGGG + Intronic
1184289000 22:43488242-43488264 CTGGGGCCTTGGGGGGCCCTGGG - Intronic
1184490391 22:44804939-44804961 CAGGATTCATGGGGCGAGCTTGG + Intronic
1184686898 22:46100342-46100364 CTGCAGCCTTGGGGGCTGCTGGG + Intronic
1185031029 22:48442969-48442991 CTGGAGCCTGGGGTGGGGCTCGG + Intergenic
1185177239 22:49334871-49334893 CTGCAGCCTTTGGGGGTGCTCGG + Intergenic
1185222103 22:49634276-49634298 CAGGAGCCTTGGGGGCAGGTTGG - Intronic
1185343695 22:50302370-50302392 CTGGAGCTGTGTGGGGAGGTGGG + Intronic
950466867 3:13161000-13161022 CTGGAGCTTTCAGGGGAGCTGGG - Intergenic
950639654 3:14340530-14340552 CTGGACACATGGGTGGTGCTTGG - Intergenic
950791933 3:15478993-15479015 CTCCATCCATAGGGGGAGCTTGG - Exonic
952163821 3:30723949-30723971 CTAGGGCCATAGGGGGAGCATGG + Intergenic
953018904 3:39101346-39101368 CTGGAGCCAGGGGTTGAGCCCGG - Intronic
953237264 3:41117708-41117730 CTGGCTGCATGTGGGGAGCTGGG + Intergenic
953391273 3:42535268-42535290 CTGGAGCCAGGGGTGGGGCAGGG + Intronic
954424887 3:50438100-50438122 CTGGAGCCAGGTGGGGATGTGGG + Intronic
954610861 3:51943874-51943896 ATGGAGGTATGGGGGGTGCTGGG - Intronic
954664554 3:52245056-52245078 CTGGAGCCTTTGGGGGACCACGG + Intergenic
956699724 3:71948290-71948312 CTGGAGCCATGTGGGGAGGGAGG + Intergenic
957022318 3:75139711-75139733 CTTGAACCCTTGGGGGAGCTGGG - Intergenic
957113151 3:75992367-75992389 CGGGAGCAATGGGCTGAGCTTGG - Intronic
957794320 3:84983600-84983622 CTGGAGCCAAGCGGGGAATTAGG + Intronic
960898599 3:122531924-122531946 CTAGAGCTCTTGGGGGAGCTTGG + Intronic
961081607 3:124033170-124033192 CGGGAGCCGGGGGAGGAGCTGGG + Intergenic
961555120 3:127691874-127691896 CTGGAACCCTTGTGGGAGCTGGG + Exonic
961629705 3:128287310-128287332 GTGCAGCCATGGGGGGAGGAAGG + Intronic
963611829 3:147478037-147478059 CTGGAGCAATGGTGTGATCTTGG - Intronic
963801085 3:149676965-149676987 CTGGAGCAATGGGGCGATCTTGG + Intronic
964719582 3:159757798-159757820 CAGGAGGCATGGAGGTAGCTTGG - Intronic
966914085 3:184575425-184575447 CTGGAGCCTCGGGGAGAGGTGGG + Intronic
968186267 3:196635104-196635126 AGGGAGCCATGGGAGGAGCCAGG - Intergenic
968661583 4:1800936-1800958 CAGGAGCCTTGGAGGCAGCTGGG - Intronic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
968903173 4:3440599-3440621 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
968903209 4:3440688-3440710 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
969067357 4:4497123-4497145 CTGGAGCCGGAGGGGGAGCCTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969857985 4:10015255-10015277 GTCCAGCCATGGGGGGAGTTTGG - Intronic
970567214 4:17343335-17343357 GTGGAGCCATGGGTGGAGGTAGG - Intergenic
974292790 4:59955184-59955206 CTGGAGGCAGGGGGGGATTTGGG + Intergenic
975541323 4:75514704-75514726 CTGGAGAAAGGGGCGGAGCTCGG + Intronic
976920241 4:90432023-90432045 CTAGACCCATGGGGAGATCTAGG - Intronic
978496852 4:109368434-109368456 ATGGAGGCATGGGGAGAGCCAGG - Intergenic
981586906 4:146313246-146313268 CTGGAGACATGGGATGAGTTGGG - Intronic
985054410 4:186023919-186023941 CAGGAGCCAGGACGGGAGCTGGG - Intergenic
985505679 5:278878-278900 CTGGGGACATGGGAGGGGCTAGG + Intronic
985640660 5:1062071-1062093 CTGGGAGCATGGGGGGTGCTGGG + Intronic
986293966 5:6422244-6422266 CTGGAGCTTTGGAGGGAGCGTGG + Intergenic
986455113 5:7910891-7910913 CTGGAACCATGTGATGAGCTGGG - Intergenic
987193277 5:15500470-15500492 CTGGAGCCACCGGGGGTGCCAGG + Exonic
989113340 5:37928383-37928405 CAGGAGCCCTGGTGGGACCTCGG + Intergenic
990249023 5:53893774-53893796 CTGGAGCCATGGCGTGGGCATGG - Intronic
992170291 5:74094885-74094907 CAGGAGCCATGGTGGGGGATGGG - Intergenic
994109674 5:95987117-95987139 CTGGAGCTGTGGGGGCAGCAAGG - Intergenic
995903325 5:117094281-117094303 CTGGACTCATGGGTGGATCTGGG + Intergenic
997564687 5:134877821-134877843 CTGGAGCAATGGTGCGATCTTGG + Intronic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999516037 5:152302399-152302421 CTAGTGCCATGGGGGAAGCAGGG + Intergenic
1000105936 5:158058762-158058784 CAGGAGTCATGGGGGGAGAAAGG + Intergenic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000302462 5:159968605-159968627 CTGGAGCCATGGCCCGAGGTGGG - Intronic
1001221217 5:169902609-169902631 CTGGGGCCATTTGGGAAGCTGGG + Intronic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1002375883 5:178788902-178788924 CTGGAGCCCTGGGCAGAGCCGGG + Intergenic
1002444357 5:179280026-179280048 TTGGAGCTATGGCTGGAGCTGGG + Intronic
1002710435 5:181191860-181191882 CTGCGGCCGTGGGAGGAGCTTGG - Intergenic
1002931316 6:1637055-1637077 CTGGAGCCATGCCTGGCGCTGGG - Intronic
1004267668 6:14163227-14163249 GTGGAGACATGGTGGGAGCGGGG + Intergenic
1006082962 6:31577949-31577971 CTGGCTCCATGGGGAGGGCTGGG - Exonic
1006137561 6:31904813-31904835 CTTGAGCCATGGGCTGAGTTAGG - Intronic
1007670496 6:43549110-43549132 CTGGAGCAATGGCGTGATCTTGG + Intronic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1011277088 6:85642438-85642460 CTGCAGCCGTGCGGCGAGCTTGG - Intronic
1013480635 6:110549880-110549902 GTGGAGGCATGGGAGGAGCTGGG - Intergenic
1016278684 6:142386767-142386789 CTGGAGCCATCTGGGCAGCTCGG + Intronic
1017534787 6:155335244-155335266 CTGGGGACCTGGGGGGAGCACGG - Intergenic
1017739989 6:157398091-157398113 CTGGGGCCATCTGGGGAGCCGGG - Intronic
1019213634 6:170425354-170425376 CCGGGGTCATGGGGGAAGCTGGG + Intergenic
1019428806 7:989120-989142 GGGGGGCCCTGGGGGGAGCTAGG - Exonic
1019928107 7:4206393-4206415 CTGTGACCAAGGGGGGAGCTGGG - Intronic
1022539266 7:31121233-31121255 CTGGAGCCATGGGGCAGGCTGGG - Intergenic
1024548289 7:50540093-50540115 TGGGAGCCATGGGGGTACCTGGG - Intronic
1024765168 7:52649397-52649419 CAGCAGCCATGAGTGGAGCTTGG - Intergenic
1025084222 7:56009556-56009578 CTGGGGCCATGGGGTGGGGTGGG - Intergenic
1025192034 7:56903087-56903109 CTGGGGCCATGGATGGTGCTAGG - Intergenic
1025194843 7:56924784-56924806 CAGGAGCCATGCAGGCAGCTGGG - Intergenic
1025677109 7:63652159-63652181 CAGGAGCCATGCAGGCAGCTGGG + Intergenic
1025679918 7:63673844-63673866 CTGGGGCCATGGATGGTGCTAGG + Intergenic
1026828526 7:73597817-73597839 CTGGGGCCCTGGGGAGAGATAGG + Intronic
1027408535 7:77888501-77888523 CTGGAGGCATTGGGGGAGGGAGG + Intronic
1029112170 7:98217991-98218013 CTGGAGCCCTGCGGGTAGCTGGG + Exonic
1030205711 7:106950504-106950526 CTGGAGCCATGGGGAGAAAGAGG + Intergenic
1030260909 7:107563535-107563557 CTGGAGGCATGGGGGGGGGGGGG + Intronic
1032765651 7:134990264-134990286 CTGGAGCCAGGGGTGAAGCCTGG - Intronic
1033728415 7:144147104-144147126 CTGGAGCCATGGGGCCAGCCAGG - Intergenic
1034364710 7:150536297-150536319 CTGGAGCCATGGGGCCAGCCTGG - Intergenic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1037440969 8:18915733-18915755 CTGGAGCCATGTGGGAAGAAGGG + Intronic
1039574225 8:38610819-38610841 CTGGAACCCTGGGGGGATCATGG + Intergenic
1039798384 8:40934236-40934258 CAGGAGGCATGGGGGGGACTGGG + Intergenic
1042654974 8:71085861-71085883 CTGAAGACATGGGGGCAGGTGGG + Intergenic
1047676830 8:127211863-127211885 CTGGGGCCATGGGTGGGGTTTGG - Intergenic
1048801651 8:138199471-138199493 CTGATGCCATGGGGAGTGCTGGG + Intronic
1049244622 8:141555608-141555630 GTGGAGCCCTGGGGGGCCCTGGG + Intergenic
1049288001 8:141786978-141787000 CAGCAGCCATTGTGGGAGCTGGG - Intergenic
1049308488 8:141920591-141920613 GTGGGACCATGGGGGGAGCTTGG - Intergenic
1049571482 8:143372111-143372133 CTGGGGCCAGGAGGGGAGCAGGG + Intronic
1049594739 8:143478118-143478140 CTGGACCCAGGTGGAGAGCTGGG - Intronic
1049697596 8:143991386-143991408 CTGGGGCCATGGGGGTACCCTGG - Exonic
1050938646 9:11430014-11430036 CTGGTCCCATGGGGGGATCCTGG + Intergenic
1052826608 9:33180773-33180795 CTGCCTCCATGGTGGGAGCTAGG + Intergenic
1053411871 9:37921016-37921038 CTGCAGCCCTGGTGAGAGCTGGG - Intronic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1057301810 9:93890770-93890792 CTGGCCCCCTGGGGGGACCTGGG + Intergenic
1057629644 9:96708927-96708949 GTGGAGCCAGGGGAGTAGCTTGG - Intergenic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1057903409 9:98966436-98966458 CTGGGGCCATGGGGCAAGGTAGG - Intronic
1058421487 9:104837097-104837119 CTGGAGTCAGGTGGGGAGCCAGG + Intronic
1058533631 9:105932077-105932099 CTGGAGAAATGGGGGCAGCTAGG + Intergenic
1058746168 9:107992824-107992846 CTGGAGGCATGCAGGAAGCTTGG - Intergenic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060779300 9:126399900-126399922 CTGGAGCCATGGGAGGCGATGGG + Intronic
1061235021 9:129337137-129337159 CTGGAGGCAGGAGGGGAGCCGGG + Intergenic
1062209827 9:135357415-135357437 CAGGTGCCATGGGAGGAGCCTGG + Intergenic
1062482515 9:136759182-136759204 CCGGTGCCGGGGGGGGAGCTGGG - Intergenic
1062491293 9:136806296-136806318 CTGCAGCCAGGCTGGGAGCTGGG + Intronic
1062722867 9:138053595-138053617 GTGGAGCCATGGTGGGGGGTGGG - Intronic
1062722890 9:138053654-138053676 GTGGAGCCATGGTGGGAGGGTGG - Intronic
1185885285 X:3776860-3776882 CTGTAGCGATGGGGGAAGCTGGG + Intergenic
1185909772 X:3970932-3970954 CTGGAACCCTTGGGGAAGCTGGG - Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187902156 X:24035289-24035311 CTGGAGCCAGTTGGGGAGCAGGG - Intergenic
1188058972 X:25577057-25577079 CTGGAGCCAGGGTGGGGGTTAGG - Intergenic
1188939981 X:36225668-36225690 CTTGAACCATGGGTGGGGCTGGG + Intergenic
1190339481 X:49285811-49285833 CTGGAGCCATGGCCGGGGCAAGG - Intronic
1190881480 X:54495455-54495477 CTGGAGCCAAGCGGGGAGCTCGG - Exonic
1191266794 X:58403650-58403672 CTGAAGCCATTGGGGGAGAAAGG + Intergenic
1195111806 X:101657421-101657443 CTGGAGCCAGGGCTAGAGCTGGG - Exonic
1195176048 X:102316458-102316480 CTGGAGGCAGGAGGGCAGCTTGG + Intronic
1195182816 X:102370635-102370657 CTGGAGGCAGGAGGGCAGCTTGG - Intronic
1195755294 X:108193488-108193510 CAGGAGCCATGAGGGGCTCTTGG + Intronic
1197433414 X:126394806-126394828 CTGCAGCCTTGGGGTGAGCCTGG - Intergenic
1197970888 X:132113914-132113936 TTGGAGACTTGGGGGGAGGTGGG - Intronic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199600576 X:149539341-149539363 GTGGAGCTGTGGGTGGAGCTGGG - Intergenic
1199721488 X:150545901-150545923 CTGGAGGCGTGGGCAGAGCTGGG - Intergenic
1200057964 X:153471375-153471397 CAGGAGCCGTGAGGGGAGCAGGG - Intronic
1200114257 X:153763258-153763280 CTGGAGCCCTGGGGGCGGCCAGG - Intergenic
1200133609 X:153864209-153864231 CAGGAGCCGTGGAGGGAGCCTGG + Intronic
1202368660 Y:24183139-24183161 CTGGAGTAAGGGGTGGAGCTGGG - Intergenic
1202502125 Y:25486978-25487000 CTGGAGTAAGGGGTGGAGCTGGG + Intergenic