ID: 997601514

View in Genome Browser
Species Human (GRCh38)
Location 5:135141750-135141772
Sequence CGTGAATTGTTGAGGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997601509_997601514 -2 Left 997601509 5:135141729-135141751 CCTCAATTTCTCCCAAATGTGCG 0: 1
1: 0
2: 2
3: 11
4: 128
Right 997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 65
997601507_997601514 12 Left 997601507 5:135141715-135141737 CCAGTGGGACATGCCCTCAATTT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 65
997601508_997601514 -1 Left 997601508 5:135141728-135141750 CCCTCAATTTCTCCCAAATGTGC 0: 1
1: 0
2: 2
3: 32
4: 278
Right 997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997601514 Original CRISPR CGTGAATTGTTGAGGGCACC TGG Intronic
907614066 1:55905924-55905946 GGTGAGTGGTTGAGGGCAGCAGG + Intergenic
915246821 1:154561470-154561492 CAGGAATTGTAGAGGGCACTGGG + Intergenic
918801626 1:188979904-188979926 TGGGAATTGCTGAGGGCCCCAGG - Intergenic
920997045 1:211003324-211003346 GGTGACTTGTTGGAGGCACCTGG - Intronic
922871515 1:228905768-228905790 TTTGTATTGTTGAGGCCACCAGG + Intergenic
1064102214 10:12473606-12473628 TGAGATTTGTTGAGGTCACCTGG + Intronic
1066617595 10:37311199-37311221 CTTGTTTTGTTGAGGGGACCGGG + Intronic
1070343798 10:75522615-75522637 CGTGAGTGGTAGAGGGGACCTGG + Intronic
1077414079 11:2416413-2416435 CATGACTTGGTGAGGTCACCAGG + Intronic
1086727837 11:90210767-90210789 CCTGCATTGTTGAAGACACCAGG - Intronic
1087063631 11:94007781-94007803 CTTCATTTGTTCAGGGCACCTGG - Intergenic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1092731435 12:11538665-11538687 CCTGGCTTGTTGAGGGCACGGGG + Intergenic
1095662650 12:44755652-44755674 TGGGAATAGTTGAGGCCACCTGG - Intronic
1101625523 12:106436923-106436945 CCTGGATTGCTGAGGACACCAGG - Intronic
1103749316 12:123148901-123148923 AGTGAAGAGTTGAAGGCACCTGG + Intronic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1117545937 14:56794864-56794886 AGTGACTTGCTGGGGGCACCGGG + Intergenic
1122028312 14:98893980-98894002 AGTGAATTGGTTAGGGCAGCTGG - Intergenic
1122037723 14:98960761-98960783 CGTGATTGGTTTAGGGCTCCCGG + Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1126064182 15:44812447-44812469 CCCGAGTTGATGAGGGCACCTGG + Intergenic
1126551842 15:49940145-49940167 AGTCCATTGTTGATGGCACCTGG - Intronic
1128304547 15:66589321-66589343 CTGGAAGTGTTGAGGGGACCTGG + Intronic
1130789285 15:87134764-87134786 CCTGAAGTCTTCAGGGCACCTGG + Intergenic
1135615523 16:23907985-23908007 GGTGTATTGTTGGGGGCAGCAGG + Intronic
1139562008 16:67749060-67749082 CGTGAATAGGCGAGGGCACAGGG + Intronic
1142498255 17:317879-317901 TGTGAACTGTTGAGAGAACCGGG - Intronic
1142808402 17:2383730-2383752 AGTGACTTGTTGAGGCCACACGG - Intergenic
1143757982 17:9080339-9080361 CCTGAAGTGTAGAGGGCTCCAGG - Intronic
1145919281 17:28598568-28598590 CCAGAGTTGGTGAGGGCACCGGG + Exonic
1156105920 18:33660561-33660583 CATGACTTTTTAAGGGCACCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160480281 18:79233718-79233740 CGTGGATTGTTGACTGCACAGGG - Intronic
1161378257 19:3950949-3950971 CATGCATTGTTGGGGTCACCCGG + Intergenic
1165305237 19:34999576-34999598 AGTGACTTGTTGGGGTCACCTGG - Intronic
926309117 2:11661873-11661895 AGTGACTTGCTGAGGTCACCCGG + Intronic
931145726 2:59514968-59514990 AGTGAATTATTGAGGGGACCTGG + Intergenic
941735813 2:168976043-168976065 CGTGTCTTGTTCAGGGCACATGG - Intronic
1172446038 20:34993922-34993944 CGGGAATTGCAGAGGCCACCAGG + Intronic
1176075142 20:63244942-63244964 AGTGAATTTTTGGGGTCACCCGG - Intronic
1184739653 22:46420454-46420476 CGTGAGTGGGTGAGTGCACCTGG - Intronic
951510580 3:23496854-23496876 CATGAATTTTTGATGGCACAGGG - Intronic
951767027 3:26211356-26211378 CATGTATTGTTGGGGGGACCTGG + Intergenic
953710960 3:45270560-45270582 CATGAAATGTTGAGGGAGCCTGG + Intergenic
955238215 3:57158520-57158542 AGTGATTTGTTGAGGACAGCTGG + Intronic
955856152 3:63276299-63276321 GGTGCACTGTTGAGGGCAGCAGG + Intronic
962251774 3:133840215-133840237 CCTGGATTTTTGAGTGCACCTGG - Intronic
963626293 3:147678250-147678272 CCTGAATAGGTGAGGGCACTAGG + Intergenic
965351084 3:167611888-167611910 AGTGAAGTGTTGAGGTCGCCAGG - Intronic
971966832 4:33569925-33569947 GATGAATTGTTGAGGACAGCAGG - Intergenic
979563123 4:122122408-122122430 AATGAAGTGTTGAGGGCACATGG + Intergenic
981018717 4:140003161-140003183 CATGAACTGTTGATGGCACGAGG + Intronic
985992596 5:3575644-3575666 AGTGCCTGGTTGAGGGCACCTGG - Intergenic
997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG + Intronic
999631200 5:153573143-153573165 CATGTATTGTTGAGGGTGCCAGG + Intronic
1000711264 5:164581918-164581940 CCTGAATTGGTGTGGGCATCTGG + Intergenic
1002434529 5:179222517-179222539 CTTGCAGTGTTGAGGGCAGCTGG - Intronic
1010728154 6:79358962-79358984 CGTGAATTTTTGACTGCACAGGG - Intergenic
1012672382 6:102071098-102071120 CTTGAAAAGTTGAGGGCAGCAGG - Intergenic
1015765742 6:136714274-136714296 TGTAAATTGGTGAGGACACCTGG - Intronic
1018907222 6:168082627-168082649 AGTGACTTGTTCAGGGCCCCAGG + Intergenic
1030574160 7:111265184-111265206 CGTGAATTTATGTGGGCAGCTGG - Intronic
1034299949 7:150006639-150006661 AGTGGGTTGTTGAGGGCACCAGG - Intergenic
1034806097 7:154090674-154090696 AGTGGGTTGTTGAGGGCACCAGG + Intronic
1042220841 8:66472365-66472387 CGGGAGCTGTTGAGGGGACCAGG + Intronic
1047957617 8:129987413-129987435 TGTGGCTTGTTGATGGCACCTGG + Intronic
1056923745 9:90814704-90814726 TGGGAACTGATGAGGGCACCAGG + Intronic
1189554075 X:42124063-42124085 CCTGAATTGGTGGTGGCACCTGG + Intergenic
1192146542 X:68686503-68686525 CGTGGGGTGTGGAGGGCACCCGG + Intronic